Stem-loop sequence sly-MIR7981c

AccessionMI0033695 (change log)
DescriptionSolanum lycopersicum miR7981c stem-loop
Stem-loop
   --uu  cu                  c     a    u    cuc      ccacac   cuua        g   a         c              a           aacuugaaaaaaaaag 
5'     ug  cgaaaucucagagacaca uuaua uaua uagg   cuauua      ucc    aacuuauu uau aguaauuuu uaucccuuuucgac uacgugacacu                u
       ||  |||||||||||||||||| ||||| |||| ||||   ||||||      |||    |||||||| ||| ||||||||| |||||||||||||| |||||||||||                c
3'     ac  gcuuuagagucucugugu aauau auau auuc   gauaau      agg    uugaauaa aua uuauuaaaa auggggaaaagcug augcacuguga                a
   ggau  ag                  c     g    u    caa      -----a   --ac        a   a         a              g           gaacaccuggguacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 6501675-6501926 [+]
intergenic
Database links

Mature sequence sly-miR7981c

Accession MIMAT0042021
Sequence

6 - 

ucgaaaucucagagacacacuuau

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1