Stem-loop sequence sly-MIR7981d

AccessionMI0033705 (change log)
DescriptionSolanum lycopersicum miR7981d stem-loop
Stem-loop
   --u             c         c              a           -             a  uaa  u          a        c            uccugugggccauu 
5'    auguucgaaaucu agagacaca uuauacuauauuaa guccuauuacc ccugaacuuauuu au   ua uuuuuuaucc uuuuuagc uacguggcacua              g
      ||||||||||||| ||||||||| |||||||||||||| ||||||||||| ||||||||||||| ||   || |||||||||| |||||||| ||||||||||||              a
3'    ugcaggcuuuaga ucucugugu aauaugauauaauu caggauaaugg ggauuugaauaaa ua   au aaaagauagg aaaaaucg augcaccgugau              c
   agu             a         a              c           a             a  uuc  u          g        a            caaacuuuuuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 32938803-32939046 [-]
intergenic
Database links

Mature sequence sly-miR7981d

Accession MIMAT0042031
Sequence

6 - 

ucgaaaucucagagacacacuuau

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1