Stem-loop sequence sly-MIR10539

AccessionMI0033707 (change log)
DescriptionSolanum lycopersicum miR10539 stem-loop
Stem-loop
   --uu  u               g  a    --      auuaucccuuuauauuagucugguauuuucucuguuucaauuuauuuauucuauuuauuuuuauaa 
5'     ug uggugauugugguuc aa auug  auguug                                                                  u
       || ||||||||||||||| || ||||  ||||||                                                                   
3'     ac accauugacaccaag uu uaac  uacaac                                                                  c
   ucau  c               g  c    au      acagauauguaaaacauguagugcacauacgcucaagucuuaaauuuauauauuuuuaaacuuugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 4194340-4194545 [-]
intergenic
Database links

Mature sequence sly-miR10539

Accession MIMAT0042033
Sequence

181 - 

cuuggaaccacaguuaccacc

 - 201

Get sequence
Evidence experimental; Illumina [1]

References

1