Stem-loop sequence sly-MIR10540

AccessionMI0033708 (change log)
DescriptionSolanum lycopersicum miR10540 stem-loop
Stem-loop
   --                          c         -    c   ag   agaaaa 
5'   gguuauucgacuaauaguuauuauuu agaaaguca cuuu uuu  uga      a
     |||||||||||||||||||||||||| ||||||||| |||| |||  |||      g
3'   ccaguaaguugauuaucaauaauaaa ucuuucagu gaaa aaa  acu      u
   ua                          a         a    -   ga   aaaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 57164-57278 [+]
intergenic
Database links

Mature sequence sly-miR10540

Accession MIMAT0042034
Sequence

90 - 

auaauaacuauuaguugaaug

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1