Stem-loop sequence mdm-MIR10996a

AccessionMI0035633 (change log)
DescriptionMalus domestica miR10996a stem-loop
Stem-loop
   uucuc    ag    g  a  c   -        uaa    a       c   -a   a -  u   au       ugaaaa 
5'      gaga  agcu ac ug aac ugagaugc   ggug ugguauu caa  cca c ca gcu  gucaugu      g
        ||||  |||| || || ||| ||||||||   |||| ||||||| |||  ||| | || |||  |||||||       
3'      cucu  uuga ug ac uug acucuacg   ccac accguaa guu  ggu g gu ugg  caguaua      u
   -ucac    ca    a  c  c   u        cua    a       a   cg   a w  u   --       caaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC010449.276: 6773-6932 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR10996a
mdm-MIR10996aMDC010449.276: 6773-6932 [+]
mdm-MIR7123bMDC010449.276: 9258-9440 [+]
Database links

Mature sequence mdm-miR10996a

Accession MIMAT0043580
Sequence

120 - 

acaccaucgcaucucauguucc

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).