Stem-loop sequence fhe-mir-36a

AccessionMI0037117 (change log)
DescriptionFasciola hepatica miR-36a stem-loop
Literature search

1 open access papers mention fhe-mir-36a
(1 sentences)

Stem-loop
   ----    -    cg      c   uagcaa           
5'     augg uguc  uucggu acc      aguuaccgau 
       |||| ||||  |||||| |||      ||||||||| c
3'     uacu acag  gggcca ugg      ucgaugguuu 
   cacu    u    au      c   ------           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold581: 1962-2033 [+]
intergenic
Database links

Mature sequence fhe-miR-36a

Accession MIMAT0045215
Sequence

49 - 

gucaccggguagacauucauucac

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).