Stem-loop sequence fhe-mir-277

AccessionMI0037127 (change log)
DescriptionFasciola hepatica miR-277 stem-loop
Literature search

1 open access papers mention fhe-mir-277
(2 sentences)

Stem-loop
   --   -     -   g   c     -------- a     c      g 
5'   ggc agaaa ugc auu uacau        c cgcuc cgcguc a
     ||| ||||| ||| ||| |||||        | ||||| ||||||  
3'   ccg ucuuu acg uaa augua        g guggg gugcag a
   gc   g     u   -   -     acaaccuc a     u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold2714: 111146-111229 [-]
intergenic
Database links

Mature sequence fhe-miR-277

Accession MIMAT0045225
Sequence

64 - 

guaaaugcauuuucuggcccg

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).