Stem-loop sequence fhe-mir-3479

AccessionMI0037129 (change log)
DescriptionFasciola hepatica miR-3479 stem-loop
Literature search

1 open access papers mention fhe-mir-3479
(2 sentences)

Stem-loop
   --c        cuuu          - u 
5'    ggcggagg    ugcaauguau c a
      ||||||||    |||||||||| | g
3'    ccgcuucc    acguuaugua g c
   auu        uuuc          a g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold4876: 38045-38100 [-]
intergenic
Database links

Mature sequence fhe-miR-3479

Accession MIMAT0045227
Sequence

34 - 

guauugcacuuuccuucgccuua

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).