Stem-loop sequence fhe-mir-36b

AccessionMI0037137 (change log)
DescriptionFasciola hepatica miR-36b stem-loop
Literature search

1 open access papers mention fhe-mir-36b
(1 sentences)

Stem-loop
   ugccu      -    c   uu    ua      auguauaaauc      ga    c -au c   --    -      -    ga   c    au 
5'      gugggu aaug cug  cggu  guguau           ugaucu  ccga u   c gca  uccc gaucug aucu  gac ucga  g
        |||||| |||| |||  ||||  ||||||           ||||||  |||| |   | |||  |||| |||||| ||||  ||| ||||   
3'      cgccua uuac gau  gcca  cacaua           acuaga  ggcu a   g cgu  gggg cuaggc uaga  cug agcu  c
   --agu      c    a   gg    -c      -----------      --    u guu c   uu    a      c    ag   -    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold3316: 118780-118952 [+]
intergenic
Database links

Mature sequence fhe-miR-36b

Accession MIMAT0045235
Sequence

147 - 

accaccggguagacauucauc

 - 167

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).