Stem-loop sequence bdo-mir-8

AccessionMI0037264 (change log)
DescriptionBactrocera dorsalis miR-8 stem-loop
Literature search

3 open access papers mention bdo-mir-8
(42 sentences)

Stem-loop
   -      -   g     c      uuuuuc 
5'  caucuu acc ggcag auuaga      a
    |||||| ||| ||||| ||||||      a
3'  guagaa ugg cuguc uaaucu      a
   u      a   a     a      uuacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00093: 156315-156375 [-]
intergenic
Database links

Mature sequence bdo-miR-8

Accession MIMAT0045387
Sequence

40 - 

uaauacugucagguaaagaugu

 - 61

Get sequence
Evidence experimental; Torrent [1]

References

1