Stem-loop sequence mes-MIR397b

AccessionMI0037906 (change log)
DescriptionManihot esculenta miR397b stem-loop
Literature search

2 open access papers mention mes-MIR397b
(5 sentences)

Stem-loop
   aauaa a      --au           c                a    ---u      c     u 
5'      g uuccag    uggagaaacau auugagugcagcguug ugaa    ucccug aauuu c
        | ||||||    ||||||||||| |||||||||||||||| ||||    |||||| |||||  
3'      c aagguc    acuuuuuugua uaacuuacgucgcgac acuu    aggggu uuaag u
   cguug a      auuc           c                c    uagu      -     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09000: 647747-647876 [-]
intergenic
Database links

Mature sequence mes-miR397b

Accession MIMAT0045970
Sequence

26 - 

ucauugagugcagcguugaug

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).