Stem-loop sequence mes-MIR398

AccessionMI0037907 (change log)
DescriptionManihot esculenta miR398 stem-loop
Literature search

7 open access papers mention mes-MIR398
(10 sentences)

Stem-loop
   -uuugaaaau        uu   -a    a           u      u      ---   ---     cuu 
5'           guggagga  ccu  cagg gcgaccugaga cacaug ggacac   ccu   aagau   c
             ||||||||  |||  |||| ||||||||||| |||||| ||||||   |||   |||||    
3'           cgccuccu  ggg  gucc cgcuggacucu guguau cuugug   gga   uucua   c
   aguaguucac        uc   cc    c           u      u      uua   acc     uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07991: 99841-99978 [+]
intergenic
Database links

Mature sequence mes-miR398

Accession MIMAT0045971
Sequence

93 - 

uguguucucaggucgccccug

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).