Stem-loop sequence mes-MIR535c

AccessionMI0037916 (change log)
DescriptionManihot esculenta miR535c stem-loop
Literature search

4 open access papers mention mes-MIR535c
(11 sentences)

Stem-loop
   ----auu    uag       aua    gu        ag               ua  a      - u 
5'        gccu   cuuugac   auug  ugacgacg  agagagcacacuugu  gc uucaug c g
          ||||   |||||||   ||||  ||||||||  |||||||||||||||  || |||||| |  
3'        ugga   gaaacug   uaac  acugcugc  ucucucgugugaaua  ug ggguac g u
   uucuauu    --a       gua    au        cg               uc  c      u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05782: 12520-12652 [-]
intergenic
Database links

Mature sequence mes-miR535c

Accession MIMAT0045980
Sequence

26 - 

uugacgacgagagagagcaca

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).