Stem-loop sequence pte-iab-8-1

AccessionMI0038012 (change log)
DescriptionParasteatoda tepidariorum iab-8-1 stem-loop
Stem-loop
   -ua           g    a  g  g   c 
5'    cguauacugaa guau cc ga agu a
      ||||||||||| |||| || || ||| a
3'    gcauaugacuu caua gg cu uua u
   caa           a    -  a  a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_497: 896333-896393 [+]
intergenic
Clustered miRNAs
< 10kb from pte-iab-8-1
pte-iab-4-1Scf5bK3_497: 896331-896391 [-]
pte-iab-8-1Scf5bK3_497: 896333-896393 [+]
Database links

Mature sequence pte-iab-8-5p

Accession MIMAT0046080
Sequence

1 - 

uacguauacugaagguauaccgga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-iab-8-3p

Accession MIMAT0046081
Sequence

40 - 

aggauacauucaguauacgaac

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).