Stem-loop sequence zma-MIR11970

AccessionMI0038158 (change log)
DescriptionZea mays miR11970 stem-loop
Literature search

1 open access papers mention zma-MIR11970
(1 sentences)

Stem-loop
     a  c    g              gg  c               g                       ac         acagauacaaccaugguuuguuaggagcuauuuuauaaagau 
5' ag ca cgau gcuaugcaagcagu  uu ugugcaagcgugcaa caaaccauuugauccauuagauu  gauucaacc                                          u
   || || |||| ||||||||||||||  || ||||||||||||||| |||||||||||||||||||||||  |||||||||                                          a
3' uc gu gcug cgauacguucguca  aa acacguuugcacguu guuugguagauuagguaaucuag  cuagguugg                                          u
     c  u    g              gg  a               g                       ca         cauuuaguguaaauugugaauuugagaagguggugaucgagu 
Get sequence
Deep sequencing
1888 reads, 1.06e+03 reads per million, 148 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 208954641-208954887 [-]
intergenic
Database links

Mature sequence zma-miR11970-5p

Accession MIMAT0046334
Sequence

35 - 

caagcgugcaagcaaaccauu

 - 55

Get sequence
Deep sequencing174 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR11970-3p

Accession MIMAT0046335
Sequence

195 - 

ugguuugguugcacguuugca

 - 215

Get sequence
Deep sequencing78 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27313591 "Novel Meiotic miRNAs and Indications for a Role of PhasiRNAs in Meiosis" Dukowic-Schulze S, Sundararajan A, Ramaraj T, Kianian S, Pawlowski WP, Mudge J, Chen C Front Plant Sci. 7:762(2016).