Stem-loop sequence bta-mir-2285ax-1

Accession

MI0038173 (change log)

Description

Bos taurus miR-2285ax-1 stem-loop

Literature search

11 open access papers mention bta-mir-2285ax-1
(15 sentences)

Stem-loop

   --    a     a             uacu 
5'   aaga guuca ucggguuuuucca    a
     |||| ||||| |||||||||||||     
3'   uuuu caagu aguucaaaaaggu    g
   gg    c     a             ccuc 

Deep sequencing

135 reads, 0 reads per million, 48 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr13: 40232960-40233019 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0038173

Mature sequence bta-miR-2285ax

• Accession: MIMAT0046350
• Sequence: 39 - aaaacuugaaugaaccuuuugg - 60
• Deep sequencing: 356 reads, 50 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).