![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-2285bh |
|||||
Accession | MI0038212 (change log) | ||||
Description | Bos taurus miR-2285bh stem-loop | ||||
Literature search |
![]()
11 open access papers mention bta-mir-2285bh | ||||
Stem-loop |
-- gg c -g c 5' aaa uucguu gg uuuuucugug a ||| |||||| || |||||||||| g 3' uuu aaguaa cc aaaaagacau c gu ga a aa c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-2285bh |
|
Accession | MIMAT0046388 |
Sequence |
1 - aaagguucguucggguuuuucu - 22 |
Deep sequencing | 6219 reads, 65 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:27100870
"Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells"
PLoS One. 11:e0154129(2016).
|