Stem-loop sequence dre-mir-129-4

AccessionMI0039508 (change log)
DescriptionDanio rerio miR-129-4 stem-loop
Literature search

3 open access papers mention dre-mir-129-4
(12 sentences)

Stem-loop 
                -       c   cu      g  -   caua 
5' gucuuucgcgaau cuuuuug ggu  gggcuu cu guu    a
   ||||||||||||| ||||||| |||  |||||| || |||    g
3' cggaaggcguuua gaaaaac cca  cccgaa gg cga    u
                c       c   uu      g  u   ucua
Get sequence
Deep sequencing
540 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 30176471-30176559 [+]
intergenic
Database links

Mature sequence dre-miR-129-5p

Accession MIMAT0001825
Previous IDsdre-miR-129
Sequence

14 -  

cuuuuugcggucugggcuugcu

 - 35

Get sequence
Deep sequencing1532 reads, 9 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-129-3p

Accession MIMAT0003158
Previous IDsdre-miR-129*
Sequence

57 -  

aagcccuuaccccaaaaagcau

 - 78

Get sequence
Deep sequencing305 reads, 5 experiments
Evidence experimental; array [2]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).