Stem-loop sequence dre-mir-212-2

AccessionMI0039509 (change log)
DescriptionDanio rerio miR-212-2 stem-loop
Stem-loop
   -     a     -  a  u     c       c      cuua  gag 
5'  ucaga cuuca ug cc uggcu uagacug uuacug    ug   u
    ||||| ||||| || || ||||| ||||||| ||||||    ||    
3'  ggucu gaagu au gg acuga aucugac aaugac    ac   c
   c     -     c  c  u     c       -      -aug  agc 
Get sequence
Deep sequencing
278 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 35644706-35644798 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-212-2
dre-mir-212-2chr10: 35644706-35644798 [+]
dre-mir-132-2chr10: 35645017-35645135 [+]
dre-mir-2184chr10: 35654245-35654354 [-]
Database links

Mature sequence dre-miR-212-5p

Accession MIMAT0048650
Sequence

14 - 

accuuggcucuagacugcuuacu

 - 36

Get sequence
Deep sequencing239 reads, 9 experiments
Evidence not experimental

Mature sequence dre-miR-212-3p

Accession MIMAT0048651
Sequence

60 - 

uaacagucuacagucauggcuac

 - 82

Get sequence
Deep sequencing37 reads, 10 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).