u u G G U gau guu ggg cccuu ACUUG UCUAAGCUCCUCAG gu g ||| ||| ||||| ||||| |||||||||||||| || a caa uuc gggAA UGAAC AGAUUUGAGGAGUc ca u c u A G - aau
| Accession | MIMAT0048669 |
| Description | Danio rerio dre-miR-7132-5p mature miRNA |
| Sequence | 14 - GACUUGGUCUAAGCUCCUCAGU - 35 |
| Evidence | not_experimental |
| Accession | MIMAT0048670 |
| Description | Danio rerio dre-miR-7132-3p mature miRNA |
| Sequence | 50 - UGAGGAGUUUAGAGCAAGUAAA - 71 |
| Evidence | not_experimental |
|