Stem-loop sequence mne-mir-215

AccessionMI0003033 (change log)
DescriptionMacaca nemestrina miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   aucauuaa   a      ------      a a  a    -u   u         cu  ag 
5'         gaa ugguau      acagga a ug ccua  gaa ugacagaca  au  c
           ||| ||||||      |||||| | || ||||  ||| |||||||||  ||   
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucugu  ug  u
   ------aa   c      ucagua      a a  c    uu   u         -u  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-215

Accession MIMAT0002736
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Evidence by similarity; MI0000291

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).