Stem-loop sequence oan-mir-29a-2

AccessionMI0006702 (change log)
DescriptionOrnithorhynchus anatinus miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
         -------cca         -  ggc           ucu       --ca   ucu 
5' caggac          ucucuuaca ca   ugaccgauuuc   ugguguu    gag   c
   ||||||          ||||||||| ||   |||||||||||   |||||||    |||    
3' guccug          gggggaugu gu   auuggcuaaag   accacga    uuc   a
         acgacgaaaa         a  ---           uuu       ucug   uug 
Get sequence
Deep sequencing
28470 reads, 340 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 38484002-38484114 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-29a-2
oan-mir-29b-27: 38484593-38484673 [-]
oan-mir-29a-27: 38484002-38484114 [-]
Database links

Mature sequence oan-miR-29a-2-5p

Accession MIMAT0009167
Previous IDsoan-miR-29a-2*
Sequence

24 - 

ugaccgauuucucuugguguu

 - 44

Get sequence
Deep sequencing386 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-29a-3p

Accession MIMAT0006807
Previous IDsoan-miR-29a
Sequence

64 - 

uagcaccauuugaaaucgguu

 - 84

Get sequence
Deep sequencing56189 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).