Stem-loop sequence mdo-mir-215

AccessionMI0012508 (change log)
DescriptionMonodelphis domestica miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   -   a aaau  ug      aa a  a     -   u         uuauau 
5'  gua g    gg  uguagg  a ug ccuau gaa ugacagaca      u
    ||| |    ||  ||||||  | || ||||| ||| |||||||||       
3'  cgu c    cu  auguuc  u ac ggaug cuu acugucugu      u
   u   - gugu  gu      cg a  c     u   u         uugaaa 
Get sequence
Deep sequencing
661118 reads, 1.02e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 130471225-130471327 [-]
antisense
ENSMODT00000005623 ; IARS2-201; intron 12
Database links

Mature sequence mdo-miR-215

Accession MIMAT0012751
Sequence

23 - 

augaccuaugaauugacagaca

 - 44

Get sequence
Deep sequencing661117 reads, 5 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).