Stem-loop sequence tgu-mir-215

AccessionMI0013804 (change log)
DescriptionTaeniopygia guttata miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   guccaggaaaa  a     -   u      a ---   c 
5'            ug ccuau gaa ugacag c   ugu u
              || ||||| ||| |||||| |   ||| u
3'            ac ggaua cuu acuguc g   acg u
   ------uuaua  c     u   c      c uuu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr3: 9653905-9653975 [+]
sense
ENSTGUT00000018325 ; tgu-mir-215-201; exon 1
antisense
Clustered miRNAs
< 10kb from tgu-mir-215
tgu-mir-194-1chr3: 9653586-9653657 [+]
tgu-mir-215chr3: 9653905-9653975 [+]
Database links

Mature sequence tgu-miR-215-5p

Accession MIMAT0014577
Sequence

11 - 

augaccuaugaauugacagac

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-miR-215-3p

Accession MIMAT0027009
Sequence

47 - 

ccugucacuucuauaggccaau

 - 68

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).