Stem-loop sequence mmu-mir-6956

AccessionMI0022803 (change log)
Symbol MGI:Mir6956
DescriptionMus musculus miR-6956 stem-loop
Stem-loop
   gcaggcag    u       a    c u  a  c 
5'         ugag ggguggg cugg c gg gu a
           |||| ||||||| |||| | || || g
3'         acuc ccuaucc ggcc g cc ca u
   -------g    u       -    a u  -  c 
Get sequence
Deep sequencing
443 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 79002223-79002284 [+]
sense
OTTMUST00000057719 ; Triobp-008; intron 1
OTTMUST00000057716 ; Triobp-005; intron 10
OTTMUST00000057684 ; Triobp-002; intron 20
OTTMUST00000057683 ; Triobp-001; intron 21
ENSMUST00000129922 ; Triobp-008; intron 1
ENSMUST00000109687 ; Triobp-005; intron 10
ENSMUST00000109688 ; Triobp-201; intron 10
ENSMUST00000109689 ; Triobp-002; intron 20
ENSMUST00000109690 ; Triobp-001; intron 21
Database links

Mature sequence mmu-miR-6956-5p

Accession MIMAT0027812
Sequence

9 - 

ugagugggugggacuggccu

 - 28

Get sequence
Deep sequencing16 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6956-3p

Accession MIMAT0027813
Sequence

43 - 

ugaccggccuauccucucag

 - 62

Get sequence
Deep sequencing419 reads, 45 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).