Stem-loop sequence dev-mir-D17

AccessionMI0023596 (change log)
DescriptionDuck enteritis virus miR-D17 stem-loop
Stem-loop
       - aa         a      --       
5' ggug c  cgaaggcga cgguug  acgauc 
   |||| |  ||||||||| ||||||  ||||| a
3' ccac g  gcuuccgcu gccagc  ugcugg 
       c ga         c      cu       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D17-5p

Accession MIMAT0028190
Sequence

3 - 

ugcaacgaaggcgaacgguug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D17-3p

Accession MIMAT0028191
Sequence

40 - 

gaccgcucgccuucgaggccacc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).