Stem-loop sequence ghr-MIR7510a

AccessionMI0024200 (change log)
DescriptionGossypium hirsutum miR7510a stem-loop
Gene family MIPF0001684; MIR7510
Literature search

2 open access papers mention ghr-MIR7510a
(2 sentences)

Stem-loop
   a   -         gu     -              cgu 
5'  gcg ccgcuaaag  cauga ucuuuagcggcguu   g
    ||| |||||||||  ||||| ||||||||||||||   g
3'  ugc ggcgauuuc  gugcu ggaaaucgccgcga   c
   a   c         ug     u              aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR7510a

Accession MIMAT0029158
Sequence

11 - 

aaggucaugaucuuuagcggcguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22138860 "A comparative miRNAome analysis reveals seven fiber initiation-related and 36 novel miRNAs in developing cotton ovules" Wang ZM, Xue W, Dong CJ, Jin LG, Bian SM, Wang C, Wu XY, Liu JY Mol Plant. 5:889-900(2012).