Stem-loop sequence ipu-mir-192

AccessionMI0024541 (change log)
DescriptionIctalurus punctatus miR-192 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   -a  a     -          c    guuug 
5'   ug ccuau gaauugacag cagu     c
     || ||||| |||||||||| ||||      
3'   ac ggaug cuugacuguc gucg     a
   uc  c     u          c    accug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-192

Accession MIMAT0029446
Sequence

1 - 

augaccuaugaauugacagcc

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1