Stem-loop sequence ppc-mir-8248

AccessionMI0026907 (change log)
DescriptionPristionchus pacificus miR-8248 stem-loop
Stem-loop
   - g      u   uuc         uaua 
5'  c cggucu ugc   gcuauuugc    u
    | |||||| |||   |||||||||     
3'  g gucgga acg   cgauaaacg    u
   g a      u   -ua         uaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000039.1: 666392-666449 [+]
intergenic
Database links

Mature sequence ppc-miR-8248-5p

Accession MIMAT0032960
Sequence

1 - 

cgcggucuuugcuucgcuauuugc

 - 24

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8248-3p

Accession MIMAT0032961
Sequence

38 - 

aauagcaugcauaggcugagg

 - 58

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).