sort by

339 publications mentioning mmu-mir-29b-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-29b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 539
1005238.g007 Fig 7 (A&B) Knockdown of miR-29 in IMR-90 cells or PASMCs leads to upregulation of KLF4 expression (n = 3); increased miR-29 levels by mimic in PASMCs suppress the expression of KLF4 (n = 3); (C) miR-29 suppresses 3’UTR luciferase reporter of KLF4 which depends on an intact miR-29 binding site (n = 3); (D) Knockdown of KLF4 in PASMCs, in which miR-29 is also knocked down, restore the expression of CNN1 and α-SMA (n = 3). [score:17]
In general, miRNAs are negative regulators of their targets, therefore, we hypothesized that miR-29 indirectly upregulates the expression of SMC-related genes by targeting a negative regulator of SMC differentiation. [score:13]
Since there is no predicted miR-29 binding site in the 3’UTR of FBXO32 mRNA, it is likely that miR-29 indirectly suppresses the expression of FBXO32 by targeting Foxo3a, which is also upregulated in miR-29 knockdown cells. [score:12]
While expression of miR-29 is suppressed by treatment of PDGFB, miR-29 is known to directly target the expression of components of the PDGF pathway, such as PDGFRB [29 – 31 ]. [score:10]
Future implications are to study the expression and function of miR-29 in human pulmonary vascular diseases, which might lead to establishing miR-29 as a therapeutic target for disease intervention. [score:9]
This reduced expression of α-SMA is associated with upregulation of COL1A1(red), a known direct target of miR-29. [score:9]
Most recently, it has been shown in a vascular injury mo del that upregulation of miR-29 suppresses the expression of PDGFRB in modulating SMC phenotype [32 ]. [score:8]
Interestingly, knockdown of miR-29 leads to significant upregulation of all PDGF ligands and receptors (15%-30% upregulation, p<0.05), except for PDGFB (Fig 9A). [score:8]
Interestingly, KLF4 is a predicted target of miR-29 (TargetScan) and the binding site of miR-29 within 3’UTR of KLF4 is evolutionarily conserved among all species of vertebrates (total 22 species, TargetScan). [score:7]
Upregulation of miR-29 expression during postnatal lung development. [score:7]
Indeed, in miR-29 knockdown IMR-90 cells, expression of all components of the PDGF pathway, except for PDGFB, is significantly upregulated (Fig 9A). [score:7]
We then investigated whether KLF4 is under the control of miR-29 in PASMCs, and found that over -expression of miR-29 with its mimic resulted in a two fold reduction of KLF4 mRNA, while knockdown of miR-29 resulted in about a two fold upregulation of KLF4 expression in PASMCs (Fig 7B). [score:7]
As expected, knockdown of miR-29 alone results in more than a two fold upregulation of KLF4 and significantly reduced expression of α-SMA and CNN1 (Fig 7D). [score:7]
The postnatal growth retardation and lethality are coincident with the drastic upregulation of miR-29 expression in multiple organs during postnatal development. [score:7]
Disruption of miR-29 leads to upregulation of Klf4 expression in vSMCs in vivo. [score:6]
Disruption of miR-29 leads to upregulation of Klf4 expression in vSMCs in vivo We then investigated the expression of Klf4 in miR-29 null mouse lungs. [score:6]
Moreover, by targeting a large number of ECM-related genes, miR-29 plays a significant role in collagen vascular diseases that has been increasingly recognized as potential causes for the development of PAH. [score:6]
Our next inquiry was to determine how miR-29 up-regulates the expression of SMC-related genes. [score:6]
It has been showed that down-regulation of miR-29 is associated with dystrophic muscles[54, 60] and restoration of miR-29 expression improved dystrophy pathology[60]. [score:6]
miR-29 also directly suppresses the expression of ECM-related genes associated with synthetic phenotypes, such as collagen [22, 23, 68]. [score:6]
This upregulation of FBXO32 is not presented in SMCs of airway and large proximal vessels, consistent with the expression pattern of miR-29 (S4A and S4B Fig). [score:6]
Here we showed that KLF4 is directly targeted by miR-29 in vSMCs and our data indicates that Klf4 is a physiological target of miR-29 in vivo. [score:6]
As expected, and consistent with miR-29 expression pattern, we found that the prominent upregulation of COL1A1 is associated with distal vessel walls of miR-29 null lungs (Fig 4A–4D). [score:6]
We selected hsa-miR-29c-3p miRCURY LNA microRNA inhibitor (product#: 4105460–001, and sequence: CCGATTTCAAATGGTGCT) and miRCURY LNA microRNA inhibitor negative control (product#: 199007–001, sequence: AGAGCTCCCTTCAATCCAA) for knockdown assay based on our published data that hsa-miR-29c LNA antisense (50nM) can efficiently reduce the endogenous levels of all three miR-29 family members. [score:5]
Upregulation of components of PDGF pathway in both miR-29 knockdown cells and miR-29 null lungs. [score:5]
Together, these results suggest that it is highly relevant to examine the expression and function of miR-29 in vSMCs of pulmonary vascular diseases. [score:5]
The most drastic upregulation of miR-29 (S2 Table and S3 Fig, about 20–40 folds) happens during postnatal development, a period in which distal vSMCs gradually switch from synthetic to contractile phenotypes in human or animal lungs. [score:5]
One of the most upregulated genes in miR-29 knockdown human lung myofibroblast cells is FBXO32 (Atrogin-1), together with its activator FOXO3a (Fig 10A). [score:5]
Moreover, it has been shown in vitro that MYOCD induces the expression of miR-24 and miR-29 and promotes SMC differentiation by suppressing PDGFRB [32]. [score:5]
This analysis showed that upregulation of KLF4 by miR-29 knockdown is reversed by co-transfection of KLF4 siRNA, which leads to even lower KLF4 levels, as compared to cells of miR-29 knockdown alone. [score:5]
Upregulation of Foxo3a and Fbxo32 in both miR-29 knockdown cells and miR-29 null lungs. [score:5]
We found that knocking down levels of endogenous miR-29 resulted in about 25–50% reduction of both α-SMA and calponin1 (CNN1), while increased miR-29 levels resulted in about a two fold upregulation of α-SMA and CNN1 in PASMCs (Fig 6A). [score:5]
Previously we showed that levels of miR-29 are significantly upregulated during embryonic and postnatal lung development that was confirmed by Next Generation of Sequencing and qRT-PCR [23] (S2 Table and S3 Fig). [score:5]
First, we examined whether targets of miR-29 are derepressed in D KO lungs by staining COL1A1, a well-known target of miR-29 [22, 23]. [score:5]
Together, our study showed that miR-29 is a central player in promoting SMC differentiation by suppressing the expression of KLF4, PDGFRB and ECM-related synthetic genes. [score:5]
1005238.g004 Fig 4 (A&B) Increased COL1A1 IHC signal is prominently associated with vessel walls, where endogenous miR-29 expression is highly expressed. [score:5]
This analysis revealed that knockdown of endogenous miR-29 results in 20–35% reduction of about 15 smooth muscle- and actin cytoskeleton-related genes including well-known SMC markers (all p<0.05), such as CNN1, CNN3 (calponin3), ACTG2 (actin, gamma 2, smooth muscle, enteric), ACTA2 (α-SMA), SMTN (smoothelin), TAGLN, as well as MYOCD, a master regulator of SMC gene expression (Fig 6B and S1 Table). [score:5]
Together our ISH analysis revealed a vessel specific expression of miR-29 in vSMCs in both human and mouse lungs, suggesting a conserved expression pattern in vSMCs of distal vessels including those of distal pulmonary arteries. [score:5]
Disruption of miR-29 expression in vivo results in aberrant vSMC differentiationSince expression of miR-29 family members (miR-29a/b/c) transcribed from both loci are enriched in vSMCs (Fig 1F), we decided to investigate the role of miR-29 in vivo by generating mutant mice in which both loci were deleted (double knockout or miR-29 null mice). [score:4]
This confirmed that KLF4 is a direct target of miR-29. [score:4]
Together, our results identified that FBXO32 is a novel downstream gene of miR-29, suggesting miR-29 might regulate smooth muscle protein degradation by modulating the expression of Foxo3a/Fbxo32. [score:4]
However, little is known regarding the expression and function of miR-29 during development in vivo. [score:4]
Disruption of miR-29 leads to upregulation of components of the PDGF pathway. [score:4]
We then examined whether reduction of KLF4 by siRNA can rescue defects in the expression of contractile markers of miR-29 knockdown cells. [score:4]
In the course of our study, KLF4 proved to be the direct target of miR-29 in cancer cell lines [65, 66]. [score:4]
This is consistent with the decreased expression of MYOCD and a large number of SMC contractile markers in miR-29 knockdown cells and miR-29 null lungs (Fig 5 and Fig 6). [score:4]
Then, we examined whether reduction of KLF4 by siRNA can restore the expression of α-SMA and CNN1 in miR-29 knockdown PAMSCs. [score:4]
We then performed co-immunofluorescence staining of α-SMA with FBXO32, and found that levels of FBXO32 are drastically upregulated specifically in the distal vessel walls of miR-29 null lungs, negatively correlated with the reduced α-SMA staining (Fig 10C–10F). [score:4]
Suppression of KLF4 rescues the defective SMC phenotype of miR-29 knockdown cells. [score:4]
We found that miR-29 family members are abundantly, selectively and dynamically expressed during mouse and human lung development. [score:4]
Levels of Foxo3a and Fbxo32 are significantly upregulated in miR-29 deficient cells. [score:4]
This might be due to the upregulation of Foxo3/Fbxo32 in the skeletal muscle of miR-29 null mice, which requires careful examination. [score:4]
Moreover, disruption of miR-29 leads to significant upregulation of Foxo3a/Fbxo32, a pathway well known for skeletal muscle wasting, which might lead to excessive degradation of important smooth muscle cell proteins. [score:4]
Together, our results suggested that miR-29 suppresses the PDGF pathway in promoting vSMC differentiation during lung development in vivo. [score:4]
1005238.g006 Fig 6 (A) qRT-PCR results of α-SMA and CNN1 mRNAs in PASMCs in which the level of miR-29 is either elevated by miR-29 mimic or knocked down by miR-29 antisense LNA oligos (n = 3); (B) mRNA levels of contractile SMC markers in IMR-90 cells, in which miR-29 is knocked down (n = 3, Affymetrix array data); (C) Levels of α-SMA protein in IMR-90 cells, in which endogenous miR-29 is knocked down. [score:4]
Upregulation of KLF4 in miR-29 null lungs. [score:4]
While we were working on this project, it was reported that Foxo3a is a direct target of miR-29 during chondrogenic differentiation[41]. [score:4]
Moreover, our work also suggests a novel role of miR-29 in regulating the expression of Foxo3a/Fbxo32 in distal vSMCs. [score:4]
Instead, mRNA levels of both CNN1 and α-SMA in these cells are 30–70% higher than those of cells with miR-29 knockdown alone, negatively correlated with reduced KLF4 expression. [score:4]
We then investigated whether miR-29 directly target KLF4 to exert its effects on SMC gene expression. [score:4]
We found that the level of Pdgfrb is significantly upregulated in miR-29 null lungs (Fig 9B). [score:4]
# CN-001000-01) were transfected at 5nM for upregulation of miR-29 in cultured cells. [score:4]
By investigating the expression and function of miR-29 in vivo, we found a vessel selective enriched expression and function of miR-29 during mouse lung development. [score:4]
To ask whether the PDGF pathway is under the control of miR-29 in vSMCs, we first examined their expression in our array data of miR-29 knockdown IMR-90 cells. [score:4]
In distal lung vSMCs, miR-29 promotes the differentiation of vSMCs by targeting Klf4 and the PDGF pathway, two major negative regulators of vSMC maturation. [score:4]
KLF4 is a direct target of miR-29 in SMCs. [score:4]
Upregulation of COL1A1 in distal vasculature of miR-29 D KO lungs. [score:4]
We first performed qRT-PCR for Foxo3a and Fbxo32, and found that both of them are significantly upregulated in miR-29 null lungs, as compared to littermate controls (Fig 10B). [score:3]
To determine whether KLF4 is a direct target of miR-29, we conducted a 3’UTR luciferase assay. [score:3]
Together, these results for the first time showed that KLF4 is a physiological target of miR-29 in vivo, and increased KLF4 in distal vSMCs of miR-29 null lungs likely contribute to the immature vSMC phenotype. [score:3]
This suppression was abolished by mutating the miR-29 complementary binding site in KLF4 3’UTR(Fig 7C). [score:3]
To examine the expression pattern, we performed in situ hybridization (ISH) for miR-29 using DIG-labeled LNA probes. [score:3]
Luciferase reporter analysis revealed that the activity of reporter containing wild type 3’UTR of KLF4 was significantly suppressed (about 40% reduction) by miR-29, but not by miR-365 (Fig 7C). [score:3]
This strongly suggests that endogenous miR-29 promotes the expression of vSMC contractile markers. [score:3]
In this study, we found that miR-29 expression is selectively enriched in vSMCs of distal vessels of mouse lungs, a pattern that is also conserved in human lungs. [score:3]
miR-29 promotes the expression of contractile SMC markers. [score:3]
To further examine miR-29 expression in SMCs, we sorted and collected SMCs (α-SMA-EGFP transgenic mice) or type I epithelial cells (T1α-EGFP transgenic mice, gift from Dr. [score:3]
Expression of miR-29 in vasculature of mouse lungs. [score:3]
Expression of miR-29 in mouse lungs. [score:3]
1005238.g005 Fig 5Disruption of miR-29 expression in vivo leads to aberrant vSMC differentiation. [score:3]
In this study, we also showed that Pdgfrb is a physiological target of miR-29 in vivo (Fig 9B–9F). [score:3]
In this study, we found that the expression of contractile SMC markers is significantly attenuated in miR-29 null lungs, preferentially affecting vSMCs of distal pulmonary vasculature. [score:3]
A evolutionarily conserved miR-29 binding site is present in the 3’UTR of Foxo3a (Targetscan). [score:3]
We showed that miR-29 promotes vSMCs differentiation by targeting Klf4, the PDGF pathway and ECM-related synthetic markers. [score:3]
By co-staining with α-SMA, we found that miR-29 ISH signal co-localizes with α-SMA within vessel walls suggesting an enriched expression in vSMCs (Fig 1D). [score:3]
Interestingly, disruption of miR-29 results in defects in vSMCs differentiation of distal vessels, reminiscent of vSMC phenotype observed in the early stage of PAH in which immature/synthetic vSMCs of distal arteries failed to differentiate and were unable to tune down the expression of collagens and other extracellular-related genes. [score:3]
We found that the level of KLF4, a known negative regulator of SMC differentiation, is significantly increased (more than 40%, P<0.01) in miR-29 knockdown cells (Fig 7A). [score:3]
Together, results from these two cell lines suggest that expression of KLF4 is under the control of miR-29. [score:3]
Expression of miR-29 in human lung vasculature. [score:3]
This strongly suggests that derepression of KLF4 contributes to the negative regulation of SMC differentiation in miR-29 knockdown cells. [score:3]
Expression of miR-29 in mouse lungs is abundant, selective and dynamic. [score:3]
Our data suggested that miR-29 promotes SMC differentiation at least partially by suppressing KLF4 and components of the PDGF signaling pathway. [score:3]
Disruption of miR-29 expression in vivo results in aberrant vSMC differentiation. [score:3]
Disruption of miR-29 expression in vivo leads to aberrant vSMC differentiation. [score:3]
Together, these results suggested that miR-29 is part of the miRNA regulatory network in promoting SMC differentiation. [score:2]
This is the first evidence that miR-29 selectively regulates vSMCs differentiation and vessel wall formation. [score:2]
1005238.g010 Fig 10 (A) Affymetrix array data of Foxo3a and Fbxo32 in miR-29 knockdown cells (n = 3). [score:2]
Here, we report a vessel specific role of miR-29 in promoting the differentiation of vSMC during mouse lung development. [score:2]
Here, we report that miR-29 is required for postnatal growth and development. [score:2]
miR-29 also plays a critical role in regulating the PDGF pathway in multiple cell types [29, 32]. [score:2]
miR-29 regulates KLF4. [score:2]
Due to the nature of systemic knockout of miR-29 in animals examined in this study, and diverse functions of miR-29 in different cell types and organs, failure of multi-organs might contribute to the growth retardation and lethality. [score:2]
To do this, we repeated the experiment, in which miR-29 was knocked down alone in PASMCs. [score:2]
S3 Fig Levels of miR-29 a/b/c in RNA samples of mouse lungs at different stages of postnatal development (qRT-PCR, n = 3). [score:2]
We first turned to our array data of IMR-90 cells, in which endogenous miR-29 was knocked down. [score:2]
These findings suggest that miR-29 is specifically required for the proper differentiation of vSMCs of distal lung vasculature during development. [score:2]
The immature/synthetic vSMC phenotype of distal lung vessels of miR-29 null mice indicates a potential dysregulation of miR-29 in the pathogenesis of PAH. [score:2]
Since expression of miR-29 family members (miR-29a/b/c) transcribed from both loci are enriched in vSMCs (Fig 1F), we decided to investigate the role of miR-29 in vivo by generating mutant mice in which both loci were deleted (double knockout or miR-29 null mice). [score:2]
Unlike miR-29, there is little change in levels of miR-143/145 during embryonic and postnatal development (S2 Table). [score:2]
miR-29ab1 [+/-]; miR-29b2c [+/-] mice are viable and fertile, and were used to breed for generation of double knockout (miR-29 null) mice with mixed genetic background containing 129/SvJ and C57BL/6. [score:2]
1005238.g009 Fig 9 (A) Affymetrix array data of components of PDGF signaling pathway in miR-29 knockdown cells (n = 3). [score:2]
In addition, Western Blot analysis showed a more than 60% reduction in α-SMA protein in miR-29 knockdown cells (Fig 6C). [score:2]
Smooth muscle related genes reduced in miR-29 knockdown IMR-90 cells. [score:2]
Generation of miR-29 knockout mice. [score:2]
The strongest ISH signal of miR-29 in adult mouse lungs was detected in distal vascular structures (Fig 1B and 1C). [score:1]
In addition, we also found potent activity of miR-29 in promoting SMC differentiation in vitro. [score:1]
S5 Fig A) Hearts of miR-29 D KO and WT littermates at age four weeks were fixed overnight in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with H&E. [score:1]
In embryonic day 18.5 (E18.5) lungs, in which α-SMA positive cells are found in limited numbers of distal vessels with relatively thick walls, a typical morphological feature before extrauterine adaptation; high levels of miR-29 were also selectively detected in α-SMA positive cells of these vessel walls (Fig 1E). [score:1]
miR-29 null mice began to die around 4 weeks of age and none of them survived to the age of 6 weeks (Fig 3D). [score:1]
Interestingly, levels of miR-29 in the media layer of large arteries, such as the dorsal aorta, where vSMCs reside, are much lower (S1A and S1B Fig). [score:1]
We first manipulated miR-29 levels in PASMCs by transfecting with miR-29 mimic or LNA antisense oligos. [score:1]
Previously, we have carried out Affymeritx array profiling for downstream genes of miR-29 in human fetal lung fibroblast cells (IMR-90) [23]. [score:1]
Examination of the lungs of miR-29 D KO mice at age four weeks revealed significant defect in differentiation of vSMCs. [score:1]
Interestingly, results from different cell types showed a potential reciprocal negative feedback loop of miR-29 and components of the PGDF pathway. [score:1]
Luciferase reporters were co -transfected with miR-29 mimic or miR-365 mimic, an unrelated miRNA as negative control. [score:1]
Postnatal growth retardation and lethality of miR-29 null mice. [score:1]
miR-29 D KO mice develop smaller hearts. [score:1]
Due to the difficulty in isolation and culture of mouse lung SMCs, and also based on the selectively enriched expression of miR-29 in vSMCs of human lungs, we decided to investigate the role of miR-29 in human pulmonary arterial smooth muscle cells (PASMCs). [score:1]
We then investigated the expression of Klf4 in miR-29 null mouse lungs. [score:1]
After pre-hybridization (50% formamide, 10mM Tris-HCl pH8.0, 600mM NaCl, 1X Denhardt’s solution, 200μg/mL tRNA, 1mM EDTA, 0.25% SDS, 10% dextran sulfate) at RT for 2 hrs, hybridization was carried out at 50°C overnight in the same hybridization buffer containing 25nM of miR-29c (TAGCACCATTTGAAATCGGTTA) or miR-29a (TAGCACCATCTGAAATCGGTTA) and miR-29b (TAGCACCATTTGAAATCAGTGTT) DIG-labeled LNA probes. [score:1]
This analysis revealed much higher PDGFRB staining in distal vessel walls of miR-29 null lungs, negatively correlated with reduced signal of α-SMA staining (Fig 9C–9F). [score:1]
All miR-29 null mice die within 6 weeks of birth, while none of wild type littermates died in the same period. [score:1]
S4 Fig (A&B) Double IF staining of FBXO32 (red) and α-SMA (green) in WT control and miR-29 D KO lungs. [score:1]
However, we observed a significant postnatal growth retardation, and miR-29 D KO are consistently smaller with about 25%, 40% and 50% reduction of body weight at ages of two, three and four weeks, respectively (Fig 3B and 3C). [score:1]
Since both miR-29 loci were systemically deleted in D KO mice, the observed vSMC phenotype may results of secondary or accumulated causes. [score:1]
Endogenous miR-29 is required for proper SMC differentiation in vitro Since both miR-29 loci were systemically deleted in D KO mice, the observed vSMC phenotype may results of secondary or accumulated causes. [score:1]
Most of these miR-29 null mice develop a hunchback, indicating weakness of the skeletal muscles. [score:1]
Endogenous miR-29 is required for proper SMC differentiation in vitro. [score:1]
Human fetal lung fibroblasts (IMR-90) and human pulmonary arterial smooth muscle cells (PASMCs) were cultured and transfected with miR-29 mimics, miR-29 LNA antisense or KLF4 siRNA as described [23, 73]. [score:1]
However, by examining the weight of hearts of miR-29 null and wild type littermates, there is no significant sign of heart failure. [score:1]
In distal small arteries, miR-29 specifically co-localizes with α-SMA staining (Fig 2D, 2E and 2F). [score:1]
To examine the levels of PDGFRB in distal vessel wall of miR-29 null lungs, we performed co-immunofluorescence staining of α-SMA and PDGFRB. [score:1]
By double immunofluorescence staining of KLF4 and α-SMA, we found significantly increased Klf4 staining in the nucleus of cells associated with distal vessel walls of miR-29 null lungs, inversely correlated with the reduced staining of α-SMA (Fig 8A–8D). [score:1]
A fragment of the 3’UTR of KLF4 containing the wild type or mutated miR-29 binding sites was cloned into the psiCHECK2 dual luciferase reporter plasmid. [score:1]
miR-29 is known for its roles in fibrosis, cell proliferation/apoptosis, tumor and adaptive and innate immunity [42– 54]. [score:1]
Scale bar: 100μM (TIF) A) Hearts of miR-29 D KO and WT littermates at age four weeks were fixed overnight in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with H&E. [score:1]
# 002112), mmu-miR-29b (Cat. [score:1]
Levels of COL1A1, α-SMA and KLF4 are not significantly altered in airway SMCs of miR-29 D KO lungs. [score:1]
This indicates a critical role of miR-29 in the postnatal vSMC maturation. [score:1]
Together, these analyses suggest that defects in vSMC differentiation in miR-29 null lungs, might lead to the reduction in pulmonary arterial pressure. [score:1]
However, there is no significant difference between miR-29 null and control mice in heart weight when normalized to body weight (S5C Fig). [score:1]
We then performed qRT-PCR to examine the levels of Pdgfrb in miR-29 null or wild type lungs. [score:1]
This was further confirmed by western blot analysis (Fig 8F and 8G), in which protein levels of KLF4 of miR-29 null lungs are significantly higher than those of control littermates. [score:1]
We found that there is a significant reduction in heart weight, left ventricle weight and right ventricle weight when normalized to tibial length in miR-29 null mice (S5B Fig). [score:1]
1005238.g001 Fig 1 (A) miR-29 family members are the most abundant miRNAs in adult mouse lungs, representing about 19% of total reads of known miRNAs (Next Generation of Sequencing). [score:1]
This profiling revealed that miR-29 family members (miR-29a/b/c) transcribed from two genomic loci, miR-29a/b1 and miR-29b2/c, are the most abundant miRNAs in adult mouse lungs (Fig 1A). [score:1]
Moreover, levels of miR-29 in airway SMCs is also much lower than those present in the distal vascular structure (Fig 1B and 1C). [score:1]
We then examined whether this vessel specific pattern is also present in human lungs, and found that high levels of miR-29 is selectively detected in vSMCs of small arteries including pulmonary arteries, but not in the vSMCs (media layer) of large pulmonary arteries (Fig 2A, 2B and 2C). [score:1]
This indicates a reduction of heat size in miR-29 null mice. [score:1]
[1 to 20 of 159 sentences]
2
[+] score: 472
Since, hsa-miR29b expression in NSCLC cells is anti-proliferative, we hypothesize that expression of hsa-miR29b might downregulate MDM2 expression. [score:10]
These data suggest that loss of hsa-miR29b in cancers might lead to MDM2 upregulation and corresponding downregulation of p53 tumor suppressor. [score:9]
Although PTEN and Cdk2 display hsa-miR29b target sites (Fig.  4A), expression of hsa-miR29b in A549 or H157 cells had no impact either on PTEN (Fig.  4E) or Cdk2 (Fig.  4F) expression, suggesting that the observed effects of hsa-miR29b on MDM2 expression are indeed specific. [score:9]
Similar to the effects of ERK5 expression, overexpression of PPARγ in A549 or H157 cells also induced a 28-fold (A549, Fig.  3E) and 54-fold (H157, Fig.  3F) increase in hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c expression, as determined by Q-RT-PCR (Fig.  3E,F). [score:9]
Interestingly, the expression of Wnt7a in A549 cells (that lack endogenous Wnt7a) severely attenuated A549 cell proliferation (Fig.  2F), whereas depletion of hsa-miR29b in A549 cells re -expressing Wnt7a blocked the inhibitory effects of Wnt7a expression on A549 cell growth (Fig.  2F). [score:9]
Consistent with the induction of p53 -dependent gene transcription upon hsa-miR29b expression, knockdown of hsa-miR29b expression in non-transformed cells (Beas2B) resulted in reduced p53 -dependent gene transcription (Fig.  4I), an effect similar to that of PPARγ inhibition (Fig.  4I) (Winn et al., 2006). [score:8]
The reason for selecting hsa-miR29b over other miRNAs is 2-fold: 1) hsa-miR29b was upregulated by more than 19-fold in A549 cells expressing Wnt7a in comparison to empty vector control (Table 1), and 2) several studies have shown either a direct or an indirect role for hsa-miR29b in human cancers (Fabbri et al., 2007; Kole et al., 2011; Rothschild et al., 2012; Ru et al., 2012). [score:8]
We confirmed our observation experimentally through hsa-miR29b expression, wherein expression of hsa-miR29b could block the expression of MDM2 both at the transcript level and protein level (Fig.  4). [score:7]
To ascertain that the effects of hsa-miR29b expression on MDM2 were specific and that there were no off-target effects, we also tested the effects of hsa-miR29b re -expression on other proteins identified in silico, viz. [score:7]
Interestingly, Q-RT-PCR analyses of RNA isolated from ERK5 overexpressing NSCLC cells, revealed a 4-fold (A549) and a 3-fold (H157) increase in hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c expression (Fig.  3A,B). [score:7]
In order to identify potential hsa-miR29b targets, which are specific to lung cancer and tumor suppressor pathway, we scanned for hsa-miR29b targets in silico (http://www. [score:7]
In cells expressing the reporter, mature hsa-miR29b targets the binding site downstream of luciferase gene resulting in repression in luciferase gene expression and as detected by reduced luciferase enzyme activity. [score:7]
In strong contrast, treatment of Wnt7a expressing A549 or H157 cells with U0126 [that blocks only MEK 1 and 2 (Cameron et al., 2003; Kamakura et al., 1999; Winn et al., 2006)] has no impact on Wnt7a -induced hsa-miR29b expression (Fig.  3D), strongly suggesting that ERK5 (but not ERK 1 and 2) mediates Wnt7a -induced hsa-miR29b expression. [score:7]
Since, Wnt7a induce hsa-miR29b expression in NSCLC cell lines (Table 1; Fig.  1) and Wnt7a expression is lost in a majority of NSCLC cell lines (Winn et al., 2005), we probed next for the expression levels of hsa-miR29b in a panel of NSCLC cell lines using quantitative RT-PCR (qPCR, Fig.  2A). [score:7]
We show herein that hsa-miR29b expression is lost in non-small cell lung cancer (NSCLC) cell lines and stimulation of β-catenin independent signaling, via Wnt7a expression, in NSCLC cell lines results in increased expression of hsa-miR29b. [score:7]
Although a speculation, PPARγ might impose an indirect control on hsa-miR29b expression and regulate the biogenesis of mature form of hsa-miR29b, since Wnt7a or ERK5 could stimulate only the expression of mature form of hsa-miR29b (Figs 1, 3). [score:7]
Consistent with the effects on MDM2 expression, expression of hsa-miR29b in A549 cells increased p53 expression as determined by western blots with anti-p53 antibodies (Fig.  4G). [score:7]
Interestingly, knockdown of hsa-miR29b was enough to abrogate the tumor suppressive effects of Wnt7a and Fzd9 expression in NSCLC cells, suggesting that Wnt7a and/or hsa-miR29b plays a critical during lung tumorigenesis. [score:6]
As a strategy to identify potential miRNAs involved in the Wnt7a -dependent regulation of NSCLC cell growth, we performed miRNA expression profiling on Wnt7a-stimulated human lung adenocarcinoma cell line (A549) and identified hsa-miR29b as an important downstream target of Wnt7a. [score:6]
Since, hsa-miR29b expression was attenuated in all the NSCLC cell lines tested; we probed next if hsa-miR29b could affect NSCLC cell proliferation, either by using gene specific knockdowns (Fig.  2B,C) or re -expression of hsa-miR29b (Fig.  2D,E) in NSCLC cells. [score:6]
Finally, we also show that hsa-miR29b plays an important role as a tumor suppressor in lung cancer by targeting murine double mutant 2 (MDM2), revealing novel nodes for Wnt7a/Fzd9 -mediated regulation of NSCLC cell proliferation. [score:6]
hsa-miR29b induction later promotes downregulation of MDM2, increased p53 expression, and reduced cell proliferation (Fig.  5). [score:6]
Finally, we show for the first time that hsa-miR29b plays an important role as a tumor suppressor in lung cancer by targeting murine double mutant 2 (MDM2), revealing novel nodes for Wnt7a/Frizzled9 -mediated regulation of NSCLC cell proliferation. [score:6]
Expression of hsa-miR29b, on the contrary, failed to impact Wnt7a expression (data not shown). [score:5]
The same study also identified an inhibitor of DNA binding/differentiation 1 (ID1) as a novel target for hsa-miR29b (Rothschild et al., 2012), in addition to DNA methyl transferase 3B [DNMT3B (Fabbri et al., 2007)]. [score:5]
Furthermore, the loss of hsa-miR29b expression results in increased levels of MDM2, reduced p53 expression, and increased cell proliferation (Fig.  5). [score:5]
List of lung cancer-specific tumor-suppressor genes with potential hsa-miR29b targets. [score:5]
Consistent with our q-RT-PCR and Northern analysis, Wnt7a stimulation of three different NSCLC cells (A549, H157+Fzd9, and H661) expressing hsa-miR29b-luciferase reporter plasmid displayed a similar reduction in luciferase activities, strongly indicating an increased hsa-miR29b expression upon Wnt7a stimulation (Fig.  1F). [score:5]
Consistent to their effects on MDM2 mRNA, re -expression of hsa-miR29b in A549 or H157 cells (Fig.  4D) resulted in reduced MDM2 expression (Fig.  4D). [score:5]
The ability of PPARγ to induce hsa-miR29b expression suggests that induction of hsa-miR29b expression is the most distal event of Wnt7a signaling. [score:5]
Consistent with our Q-RT-PCR analyses, PPARγ expression also induced hsa-miR29b expression in NSCLC cells (A549, H157 and H661), as revealed by reduced hsa-miR29b-luciferase activities (Fig.  3G). [score:5]
The hsa-miR29b expression targets MDM2 mRNA to degradation, which results in increased p53 levels and reduced cell proliferation. [score:5]
Another study suggests increased efficacy of combination therapy of EGFR antibody with cisplatin/gemcitabine might be due to increased expression of hsa-miR29b and reduced expression of anti-apoptotic genes like DNA methyltransferease 3B (Samakoglu et al., 2012). [score:5]
In total, the results from several distinct and powerful analyses reveal a consistent story: Wnt7a stimulates hsa-miR29b expression and hsa-miR29b modulates NSCLC cell proliferation via repressing MDM2 expression. [score:5]
Consistent with the effects of hsa-miR29b knockdown on Beas2B cell proliferation, re -expression of hsa-miR29b was inhibitory to the cell growth of A549 or H157 cells as determined by clonogenic (Fig.  2D) or MTS cell proliferation assays (Fig.  2E). [score:5]
We show herein that hsa-miR29b expression is lost in NSCLC cell lines and Wnt7a-stimulation of NSCLC cell lines results in increased expression of hsa-miR29b. [score:5]
Interestingly, treatment of Wnt7a expressing A549 or H157+Fzd9 cells with PD98059 [that blocks, MEK 1, 2 and 5, (Cameron et al., 2003; Kamakura et al., 1999; Winn et al., 2006)], blocked Wnt7a -induced hsa-miR29b expression, as revealed by an increase in luciferase activities (Fig.  3D). [score:5]
For studies involving the use of MEK inhibitors PD98059 (20 µM, Sigma) or U0126, (10 µM, Calbiochem/EMD Biosciences, San Diego, CA), A549 and H157 cells were co -transfected either without or with pLNCX-Wnt7a-HA and hsa-miR29b-luciferase reporter plasmids followed by treatment with MEK inhibitors. [score:5]
Expression of Wnt7a, as expected induced hsa-miR29b expression as revealed by the reduced luciferase activities (Fig.  3D) in both the cell lines. [score:5]
miRNA expression profiling on a human lung adenocarcinoma cell line (A549) identified hsa-miR29b as an important downstream target of Wnt7a/Frizzled9 signaling. [score:5]
These data strongly suggest that Wnt7a specifically regulates hsa-miR29b expression in the lung, and that loss of Wnt7a and/or hsa-miR29b might be an important player in the development of lung cancer. [score:5]
In the presence of increased hsa-miR29b expression (Fig.  4B), we observed a corresponding decrease in MDM2 mRNA expression (by more than 50%) in both the cell lines tested (Fig.  4C). [score:5]
Indeed, re -expression of hsa-miR29b in NSCLC cells restored p53 expression and attenuated NSCLC cell proliferation (Fig.  4). [score:5]
For these studies, A549 or H157 cells expressing either hsa-miR29b luciferase reporter alone or together with Wnt7a-HA plasmid were treated without or with MEK inhibitors (Fig.  3D). [score:5]
We show herein that the activation of a β-catenin-independent pathway, mediated by Wnt7a/Fzd9, strongly induce hsa-miR29b expression in NSCLC cells (Fig.  1), while activators of β-catenin -dependent pathway (Wnt3), in strong contrast, failed to stimulate hsa-miR29b expression. [score:5]
Loss in hsa-miR29b expression results in increased MDM2 levels reduced p53 expression and increased cell proliferation. [score:5]
In the current study, we identify hsa-miR29b as a novel tumor suppressor, which is regulated by Wnt7a in NSCLC cells. [score:4]
hsa-miR29b regulates MDM2 expression. [score:4]
Interestingly, knockdown of hsa-miR29b was enough to abrogate the tumor suppressive effects of Wnt7a/Frizzled9 signaling in NSCLC cells, suggesting that hsa-miR29b is an important mediator of β-catenin independent signaling. [score:4]
hsa-miR29b regulates MDM2 expression in NSCLC cells. [score:4]
Of note, Wnt7a -mediated induction of hsa-miR29b expression is unidirectional. [score:4]
miRNA-29b suppresses prostate cancer metastasis by regulating epithelial–mesenchymal transition signaling. [score:4]
, PPARγ (Winn et al., 2006) could also regulate the expression of hsa-miR29b (Fig.  3E,F). [score:4]
Co -expression of hsa-miR29b and p53-luciferase reporter in A549 cells resulted in an 8-fold induction in p53 -dependent gene transcription in comparison to A549 cells transfected with p53-luciferase reporter alone (Fig.  4H). [score:3]
To test if the anti-proliferative effects of Wnt7a in NSCLC cells are mediated via the induction of hsa-miR29b, we first stimulated A549 cells with Wnt7a (to induce hsa-miR29b expression), followed by treatment with miR29b precursors. [score:3]
Since, normal bronchial epithelial cells (Beas2B) express high levels of hsa-miR29b (Fig.  2A), we first probed the effects of chemically synthesized double stranded miR29b precursor molecules (Ambion, anti-miR29b1 and anti-miR29b2) on Beas2B cell proliferation. [score:3]
Consistent with our PCR array and q-RT-PCR data, Northern analysis revealed a robust Wnt7a -induced expression of hsa-miR29b, as detected by hsa-miR29b specific probes (Fig.  1D). [score:3]
ERK5 and PPARγ modulate hsa-miR29b expression in NSCLC cells. [score:3]
It was also interesting to note that Wnt7a stimulated the expression of only the mature form of hsa-miR29b but not its primary or precursor form (Fig.  1D). [score:3]
We therefore probed if ERK5 could also modulate hsa-miR29b expression (Fig.  3A,B). [score:3]
In silico analysis for hsa-miR29b complimentary sites identified MDM2 as a potential target (Fig.  4A). [score:3]
Total RNA was extracted from a non-transformed cell line (Beas2B) or NSCLC cell lines (A549, H157, H661 and H2122) and hsa-miR29b expression was quantified as described in. [score:3]
In addition, NSCLC cell lines displaying Wnt7a loss also showed an accompanying loss of hsa-miR29b expression (Fig.  2). [score:3]
In order to test the specificity of ERK5 -mediated induction of hsa-miR29b, we made use of hsa-miR29b-specific luciferase reporter and MEK inhibitors, PD98059 and U0126 (Fig.  3D). [score:3]
miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. [score:3]
In total, by using several distinct and powerful analyses we establish that activation of a β-catenin-independent pathway by Wnt7a stimulates the expression of hsa-miR29b, but not hsa-miR29a or hsa-miR29c, in NSCLC cells. [score:3]
Thus, Wnt7a mediated regulation of hsa-miR29b represents a novel mechanism for Wnt7a/Fzd9 -mediated regulation of NSCLC cell proliferation. [score:3]
Q-PCR established the relative expression of hsa-miR29b in normal and NSCLC cell lines (Fig.  2A). [score:3]
ERK5 and PPARγ stimulate hsa-miR29b expression in NSCLC cells. [score:3]
Therefore, a decreased luciferase activity represents increased expression of hsa-miR29b and vice versa. [score:3]
Stimulation of NSCLC cells with Wnt7a not only induced the expression of hsa-miR29b but also attenuated NSCLC cell proliferation (Tennis et al., 2010; Winn et al., 2005). [score:3]
It was interesting to note that Wnt7a induced the expression of only hsa-miR29b but not hsa-miR29a or hsa-miR29c (supplementary material Table S1). [score:3]
A549 or H157 cells were transfected either with empty vector or phsa-miR29b plasmid for 24 h. The lysates were later immunoblotted for MDM2 (D), PTEN (E) and Cdk2 (F) expression. [score:3]
Schematic representation of the role of Wnt7a -induced hsa-miR29b expression in NSCLC proliferation. [score:3]
In addition, ERK5 and PPARγ, key effectors of Wnt7a/Fzd9 pathway, were also observed to be strong inducers of hsa-miR29b expression. [score:3]
To further validate our findings, we also tested the effects of hsa-miR29b re -expression on MDM2 protein levels. [score:3]
In strong agreement with our observations, recent studies also reveal specific induction of hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c (Kole et al., 2011; Rothschild et al., 2012; Ru et al., 2012). [score:3]
These data suggest that has-miR29b is a novel downstream target of Wnt7a/Fzd9 signaling and the anti-tumorigenic effects of Wnt7a in NSCLC cells. [score:3]
Absence of Wnt7a in NSCLC fails to activate the Wnt7a/Fzd9 pathway, which in turn fails to induce hsa-miR29b expression. [score:3]
We show herein for the first time that Wnt7a/Fzd9 signaling pathway in NSCLC cells leads to increased expression of hsa-miR29b (Fig.  1). [score:3]
Mature hsa-miR29b upon binding to its complimentary sequence in the reporter repress luciferase gene expression. [score:3]
Interestingly, ERK5, obligate for Wnt7a-stimulated PPARγ activation, was also observed to be indispensable for hsa-miR29b expression. [score:3]
In NSCLC, on the contrary, absence of Wnt7a fails to activate Wnt7a/Fzd9 pathway, which blocks induction of hsa-miR29b expression. [score:3]
Surprisingly, in the hsa-miR29 family, Wnt7a induced the expression of only hsa-miR29b, but not hsa-miR29a or hsa-miR29c. [score:3]
Real-time PCR analyses of the expression of hsa-miR29a, hsa-miR29b and hsa-miR29c in NSCLC cell lines. [score:3]
Additionally, we also performed Northern blot analysis using [32]P -labelled hsa-miR29b or hsa-miR29a/c specific probes to confirm the Wnt7a -induced hsa-miR29b expression (Fig.  1D). [score:3]
Consistent with our PCR array data, Wnt7a induced the expression of hsa-miR29b, but not hsa-miR29a or hsa-miR29c (Fig.  1B,C). [score:3]
Therefore, a decrease in luciferase activity represents increased expression of hsa-miR29b and vice versa. [score:3]
These data strongly suggest that the anti-proliferative effects of PPARγ are also mediated via the induction of hsa-miR29b expression. [score:3]
Wnt7a -induced hsa-miR29b expression is represented as the percentage of empty vector control. [score:3]
The reporter plasmids (hsa-miR29b-luciferase reporter and p53 luciferase-reporter), expression plasmids (pLNCX-Wnt7a-HA, pCDNA3.2-ERK5, pCDNA3.1-PPARγ and Fzd9) and CMV-β-galactosidase control plasmids were transiently transfected into NSCLC cells using LipofectAmine reagent (18324-012, Invitrogen, Carlsbad, CA, USA) as per the manufacturer's recommendations. [score:3]
Wnt7a/Fzd9 signaling regulates hsa-miR29b. [score:2]
We also interrogated Wnt7a -mediated regulation of hsa-miR29b by using an hsa-miR29b-specific luciferase reporter plasmid (Fig.  1E). [score:2]
In a more recent study, an important role for c-Src kinase in the regulation of hsa-miR29b was identified in human lung adenocarcinoma (Rothschild et al., 2012). [score:2]
Interestingly, our screening succeeded in identifying hsa-miR29b as a novel miRNA regulated by Wnt7a. [score:2]
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. [score:2]
Surprisingly, we also identify specific regulation of hsa-miR29b by Wnt7a but not by Wnt3, a ligand for β-catenin -dependent signaling. [score:2]
hsa-miR29b knockdown studies. [score:2]
hsa-miR29b regulates NSCLC cell proliferation. [score:2]
Interestingly, hsa-miR29b expression was severely attenuated in all the NSCLC cell lines tested when compared to non-transformed bronchial epithelial cell line (Beas2B, Fig.  2A). [score:2]
These data suggest that Wnt7a regulates hsa-miR29b, but not hsa-miR29a or hsa-miR29c. [score:2]
The current study also reveals a novel role for hsa-miR29b in MDM2 regulation. [score:2]
To corroborate our PCR array data, we performed q-RT-PCR analyses on RNAs isolated from two NSCLC cell lines (H661 and H157) transiently transfected with either empty vector, Wnt3, or Wnt7a expression vectors and by using primers specific for the hsa-miR29 family members (Fig.  1B,C). [score:2]
MicroRNA-29b is involved in the Src-ID1 signaling pathway and is dysregulated in human lung adenocarcinoma. [score:1]
Treatment of Beas2B cells with miR29b precursors showed a significant decrease in hsa-miR29b levels (>50%, Fig.  2B). [score:1]
Our data would also suggest that identifying pharmacological activators of Wnt7a/Fzd9 pathway and/or hsa-miR29b might have utility in the treatment of lung cancer. [score:1]
On the contrary, activation of Wnt7a/Fzd9 signaling by Wnt7a, and mediated by ERK5 and PPARγ, leads to the induction of hsa-miR29b. [score:1]
LR-0062), in which the mature hsa-miR29b complementary sequence was sub-cloned downstream of luciferase gene. [score:1]
After 48 h, total RNA was extracted and the expression levels of hsa-miR29b were measured as described in. [score:1]
hsa-miR29b-luciferase reporter plasmid was purchased from Signosis (Cat. [score:1]
Beas2B cells were treated with either negative control or synthetic double stranded miR29b precursors. [score:1]
Wnt7a/Fzd9 signaling leads to induction hsa-miR29b, which is mediated by ERK5 and PPARγ. [score:1]
We also confirmed that ERK5 -induced hsa-miR29b levels in A549 cells via Northern analyses (Fig.  3C). [score:1]
Fig. 5. Wnt7a/Fzd9 signaling leads to induction hsa-miR29b, which is mediated by ERK5 and PPARγ. [score:1]
Fig. 1. (A) Multiple alignments of hsa-miR29a, hsa-miR29b and hsa-miR29c. [score:1]
After 16 h, cells were transfected with 30 nM each of chemically synthesized double stranded miR29b precursors [Ambion, anti-miR29b1 (AM1234) and anti-miR29b2 (AM12626)] or with a negative control (AM17010, Ambion Life Technologies, Grand Island, NY) using Attractene Transfection Reagent (301005, Qiagen, Valencia, CA). [score:1]
A549, H157 and H661 cells were transfected either with empty vector or pLNCX-Wnt7a-HA along with hsa-miR29b luciferase reporter plasmid. [score:1]
The hsa-miR29b pcDNA plasmid was a kind gift from Dr Gregory Gores (Mayo Clinic). [score:1]
Beas2B cells were transfected with negative control precursors or chemically synthesized double stranded miR29b precursors (Ambion, 30 nM each of anti-hsa-miR29b-1 and anti-hsa-miR29b-2) together with p53 luciferase reporter plasmid. [score:1]
In this reporter, the complimentary sequence of hsa-miR29b has been engineered downstream of luciferase gene (Fig.  1E). [score:1]
We tested our hypothesis by measuring MDM2 transcript levels by Q-PCR in A549 and H157 cells upon re -expression of hsa-miR29b (Fig.  4B). [score:1]
In summary, we propose herein a novel role for Wnt7a/Fzd9 signaling in inducing hsa-miR29b. [score:1]
For these experiments, total RNA was extracted from normal lung bronchial epithelial cells (Beas2B), lung adenocarcinoma (A549, H2122), squamous cell carcinoma (H157+Fzd9) and large cell carcinoma cell lines (H661), reverse transcribed and the cDNAs were later used to measure the levels of hsa-miR29b expression (Fig.  2A). [score:1]
The binding site of hsa-miR29b differs from that of hsa-miR29a or hsa-miR29c at the underscored bases. [score:1]
The membranes were probed with 5′ end [32]P-γ-ATP -labeled DNA oligonucleotides of either hsa-miR29b (AACACTGATTTCAAATGGTGCTA) or hsa-miR29a/c (TAACCGATTTCAGATGGTGCTA and CCGATTTCAAATGGTGC, since the mature sequences of hsa-miR29a/c differ in only one nucleotide, we used the probes together). [score:1]
A549 or H157 cells were transfected either with empty vector or phsa-miR29b plasmid. [score:1]
[1 to 20 of 126 sentences]
3
[+] score: 464
Interestingly, Smad3 protein was inhibited by miR-29 over -expression but increased upon miR-29 knock-down in C2C12 cells (Fig. S4), suggesting miR-29 regulates Smad3 expression although it is not predicted to be a direct target of miR-29. [score:12]
TGF-β treatment suppressed the expression of miR-29 which in turn up-regulates Histone Deacetylase 4 (HDAC4) to inhibit the myogenic commitment. [score:10]
Interestingly, α-SMA and VIM were also found to be down-regulated although they are not predicted to be direct targets of miR-29 by multiple computational algorithms (data not shown), indicating that miR-29 may control α-SMA and VIM expression indirectly. [score:10]
However, the expressions of Col 1A1, Col 1A2, and Col 3A1 were suppressed (Fig. 2C), suggesting that miR-29 inhibits fibrogenic differentiation likely through targeting collagens. [score:9]
Additionally, activities of the reporter with Lims1 binding site were significantly inhibited by miR-29 expression while mutation of this site abolished the inhibition (Fig. 2J). [score:8]
In contrast, knockdown of Smad7, an inhibitor of Smad3 activation, enhanced the inhibition of TGF-β on miR-29 expression and promoter activity. [score:8]
The mRNA expression of Lims1 was also down-regulated in miR-29 expressing cells at all time points of differentiation comparing to NC cells (Fig. 2H). [score:8]
This is in line with a recent report showing miR-29 suppresses basal Smad3 expression possibly through inhibiting TGF-β3 [13]. [score:7]
Moreover, knock-down of miR-29 led to opposite augmenting effect on Col 1A1, Col 1A2 and Col 3A1 expression (Fig. 2D), supporting that collagens are direct targets of miR-29. [score:7]
The decrease of ECM expression in miR-29 expressing cells led us to hypothesize that miR-29 functions to inhibit the transdifferentiation of C2C12 myoblasts into fibrogenic cells. [score:7]
As a result, a total of 472 and 739 genes were found to be up- and down-regulated in miR-29 expressing cell line vs NC cell line (Fig. 1A and Table S1 and Table S2). [score:6]
Table S3 Functional annotation clustering of up-regulated genes in miR-29 expressing C2C12 cells. [score:6]
Furthermore, it exerted a dose -dependent inhibition on miR-29 promoter activities (Fig. 3C), suggesting that the inhibition could be at the transcriptional level through direct action on miR-29 promoter. [score:6]
Table S4 Functional annotation clustering of down-regulated genes in miR-29 expressing C2C12 cells. [score:6]
In this study, in an effort trying to gain insights into the global effect of miR-29 on myogenic cells, a transcriptome analysis by high throughput RNA-sequencing (RNA-seq) was conducted and the results revealed that miR-29 down-regulates ECM and cell adhesion genes in addition to promoting the myogenic differentiation, suggesting a role of miR-29 in suppressing fibrogenic differentiation of myoblasts. [score:6]
These data thus add a novel target to the growing list of miR-29 targets, and implicate miR-29 as a potent regulator in many cellular processes involving cell adhesion factors such as cell migration, cell invasion and cell survival. [score:6]
Indeed, Lims1 protein was evidently down-regulated by over -expression of miR-29 in C2C12 cells (Fig. 2G). [score:6]
Table S1 List of up-regulated genes in miR-29 expressing C2C12 cells. [score:6]
As shown in Figure 4B–C, knockdown of Smad3 but not Smad2 abolished the inhibition of TGF-β on both miR-29 expression and miR-29 promoter activity. [score:6]
Table S2 List of down-regulated genes in miR-29 expressing C2C12 cells. [score:6]
Stable over -expression of miR-29 in C2C12 cells down-regulates ECM and cell adhesion genes. [score:6]
In addition to ECM molecules, many cell adhesion genes are down-regulated in miR-29 expressing cells (Table S4). [score:6]
Considering that myofibroblast differentiation is dependent on cell adhesion [26], [27], down-regulation of Lims1 probably mediates the suppressive role of miR-29 during myoblast conversion to myofibroblast. [score:6]
It was shown that intramuscular injection of miR-29 into dystrophic muscles down-regulated collagen expression [19]; however, the cellular mechanisms underlying this anti-fibrotic action of miR-29 was still obscure. [score:6]
Loss of miR-29 upregulates the expression of ECM genes such as Collagens as well as cell adhesion genes such as Lims1, thus promoting the conversion of myoblasts into myofibroblasts. [score:6]
Having gained insights into the role of miR-29 during the conversion of myoblasts to myofibroblasts, we now turned our attention to its upstream regulator by asking: what leads to the down-regulation of miR-29 in this process? [score:5]
TGF-β suppresses miR-29 expression during myoblast conversion to myofibroblast. [score:5]
0033766.g001 Figure 1 (A) Differentially expressed genes between C2C12 cells stably expressing vector negative control (NC) and miR-29 were determined by RNA-seq. [score:5]
Our results reveal that in addition to promoting myogenic differentiation, miR-29 inhibits the expression of a large number of ECM genes including Collagens, MATN1, ECM1 (Tables S2 and S4). [score:5]
In the normal myogenesis, the recruitment of MyoD/SRF and the displacement of YY1/PRC from miR-29 promoter lead to the elevation of miR-29 expression and its feedback inhibition on YY1 and successful myogenic differentiation. [score:5]
miR-29 suppresses C2C12 myoblast conversion into myofibroblast through targeting Collagens and Lims1. [score:5]
A C2C12 cell line stably expressing miR-29 was established by infecting cells with a miR-29 expressing lentivirus. [score:5]
Smad3 suppresses miR-29 promoter through inhibiting MyoD binding and enhancing YY1 recruitment. [score:5]
For this purpose, myoblasts transfected with specific siRNAs, capable of attenuating the expressions of Smad2, Smad3, or Smad7 (Fig. 4A), were tested for the responsiveness to TGF-β in regard to inhibiting miR-29. [score:5]
Subsequent analyses demonstrated that indeed miR-29 inhibits C2C12 transdifferentiation into myofibroblasts by suppressing both collagens and Lims1 (LIM and senescent cell antigen-like-containing domain protein). [score:5]
This causes a loss of miR-29 expression and increased expression of Collagens and Lims1, leading to the transdifferentiation of myoblasts into myofibroblasts. [score:5]
Figure S4 miR-29 inhibits Smad3 expression. [score:5]
The inhibition of miR-29 by TGF-β was mediated by Smad3 at the transcriptional level through both inhibiting MyoD binding and enhancing YY1/Polycomb recruitment on its promoter region. [score:5]
Together, these data demonstrate that Lims1 is a direct target of miR-29. [score:4]
Multiple ECM genes such as collagens, fibrillins and elastin [15], [16], [17], [18], [19] are identified as direct targets of miR-29 in fibroblasts, implicating miR-29 as a potent factor in modulating ECM mo deling and tissue fibrosis. [score:4]
Smad3 regulates miR-29 promoter through inhibiting MyoD binding and enhancing YY1/Polycomb recruitment. [score:4]
Subsequent Gene Ontology (GO) analysis with up-regulated list of genes revealed that the top ranked lists of enriched GO categories include “contractile fiber”, “contractile fiber part”, “sarcomere”, “myofibril”, “I band”, “Z disc” (Table S3), which is in agreement with the previously identified roles of miR-29 in accelerating muscle regeneration. [score:4]
The subsequent experimental data confirmed that Lims1 is a direct target of miR-29. [score:4]
Interestingly, Lims1 was predicted to contain miR-29 binding sites in their 3′UTR regions (Fig. 2F), indicating that it may be a direct target of miR-29. [score:4]
These findings suggest that miR-29 involved circuitries are critical regulator of gene expression in skeletal muscle cells. [score:4]
Figure S2 miR-29 down-regulates Collagens in C2C12 myoblasts. [score:4]
Collectively, our transcriptome analysis demonstrated that the two main functions of miR-29 in muscle development are to increase myogenic differentiation and to suppress fibrogenic differentiation. [score:4]
Therefore, the above two modes of actions exert reinforcing levels of control on miR-29 transcription, ensuring its down-regulation during the fibrogenic differentiation of myoblasts. [score:4]
However, under normal myogenic differentiation condition, YY1 regulated miR-29 drives myoblasts fusion into myotubes [5], suppressing the fibrogenic pathway. [score:4]
Knock-down of miR-29, on the other hand, led to opposite augmenting effect on Lims1 expression (Fig. 2I). [score:4]
Given that Smad proteins transmit most of the transcriptional effect exerted by TGF-β, subsequently we examined their involvement in the down-regulation of miR-29. [score:4]
Basal and phosphorylated (p) Smad3 levels were examined in C2C12 cells over -expressing miR-29 or with miR-29 knock-down by Anti-miR oligos. [score:4]
Interestingly, miR-29 was found to be down-regulated in dystrophic muscles in concomitant with the increased TGF-β signaling (our unpublished data). [score:4]
To substantiate this finding, primary myoblasts were isolated from tibialis anterior muscles of wild type (Smad3 [+/+]), Smad3 heterozygous (Smad3 [+/−]) or knockout (Smad3 [−/−]) mice and examined for miR-29 expression. [score:4]
Only mild increase (1.9 fold, p<0.01) was detected in Smad3 [+/−] cells, suggesting a Smad3 dose -dependent regulation on miR-29 expression. [score:4]
X- and Y-axis represent the log2 based FPKM values for expressed genes in NC and miR-29 samples, respectively. [score:3]
These results reaffirm that Smad3 and Smad7 are critical mediators of TGF-β inhibition on miR-29. [score:3]
Expression folds are shown with respect to 0 hr cells where normalized copy numbers were set to 1. Data are plotted as mean ± S. D. (B and C) C2C12 cells were transfected with negative control (NC) or miR-29 oligos and differentiated for 48 hrs, at which time total RNAs were isolated for qRT-PCR measurement of the expressions of Myogenin, Troponin, α-Actin or MyHC as well as Col 1A1, Col 1A2, Col 3A1, α-SMA or VIM. [score:3]
To produce virus particles expressing vector or miR-29, pMIF-cGFP-Zeo Vector or pMIF-cGFP-Zeo-miR-29 plasmids along with the packaging plasmid mix (pPACK) (System Biosciences) were transfected into HEK293T cells maintained in 10% FBS. [score:3]
Replication -deficient lentivirus -based expression plasmids pMIF-cGFP-Zeo Vector and pMIF-cGFP-Zeo-miR-29b, along with the packaging plasmid mix (pPACK), were obtained from System Biosciences (SBI). [score:3]
In line with a recent study demonstrating that TGF-β controls miR-29 to inhibit myogenic differentiation [13], we also found that TGF-β can attenuate the pro-myogenic actions of miR-29. [score:3]
Next, the potential inhibitory role of TGF-β on miR-29 was examined. [score:3]
As differentiation ensues, MyoD replaces the silencing complex causing the derepression of miR-29 transcriptional expression. [score:3]
This leads to trimethylation of histone lysine 27 and subsequent silencing of miR-29 expression. [score:3]
In addition to miR-29c, the other two members of miR-29 family, miR-29a and miR-29b could also target Collagen 3′UTR (Fig. S2). [score:3]
In order to assess whether miR-29 is a critical factor in determining the fate of myoblast differentiation, miR-29 was over-expressed in C2C12. [score:3]
TGF-β inhibits miR-29 during myogenic and fibrogenic differentiation of C2C12 cells. [score:3]
However, it was not clear how TGF-β exerts the suppression on miR-29. [score:3]
Additionally, when injected with Cardiotoxin, a snake venom that induces extensive muscle necrotic injury and subsequent regeneration, a steady increase of miR-29 levels were observed during the course of degeneration and regeneration (day 1, 2, 4, 6, 9) in Smad7 [+/+] muscles while Smad7 [−/−] mice displayed much lower levels of miR-29 expression at all time points examined (Fig. 4F). [score:3]
Thus, it is our interest to explore the full spectrum of the influence by miR-29 in these cells and discover other targets under the control of miR-29. [score:3]
Collectively, the above results suggest the inhibitory action of TGF-β/Smad3 on miR-29 transcription is exerted through dual mechanisms by blocking MyoD binding and enhancing YY1/Ezh2 association. [score:3]
Furthermore, in our case, inhibition of MyoD binding on miR-29 promoter seems to be dependent on Smad3 association with proximal SBE as all the identified E-boxes are in the vicinity of SBEs (Fig. 5A). [score:3]
This is inverse to the effect of miR-29 (Fig. 2), suggesting that TGF-β may function upstream of miR-29 as a suppressor. [score:3]
Expectedly, TGF-β treatment abrogated the suppression of miR-29 on Collagens and α-SMA as well as Lims1 (Fig. 3F–H). [score:3]
As shown in Figure 5F, ectopic expression of YY1 repressed miR-29 reporter activities and the repression is enhanced with co-transfection of Smad3 at a dose -dependent manner, suggesting a repressive synergy between YY1 and Smad3. [score:3]
Total RNAs were isolated from NC or miR-29 expressing C2C12 cells and subjected to high throughput mRNA sequencing (mRNA-seq). [score:3]
This is in line with others' results and led us to believe that miR-29 inhibits the transdifferentiation of myoblasts into myofibroblasts. [score:3]
In undifferentiated myoblasts, miR-29 expression is epigenetically silenced by a repressive complex containing Yin Yang 1 (YY1) and Polycomb protein, Enhancer of Zeste Homolog 2 (Ezh2), which is associated to the miR-29 promoter region causing tri-methylation of histone 3 lysine 27 (H3K27me3). [score:3]
In addition, we noticed that cell-adhesion genes under GO categories “Cell adhesion”, “Biological adhesion” and “Focal adhesion” represent another category of genes under significant influence by miR-29 expression (Fig. 1B). [score:3]
The black dots represent genes with no significant expression changes between NC and miR-29 samples. [score:3]
Expression folds are shown with respect to NC cells where normalized copy numbers were set to 1. Data are plotted as mean ± S. D. (D) C2C12 cells were transfected with negative control (Anti-NC) or Anti-miR-29 oligos and differentiated for 48 hrs, at which time total RNAs were isolated for qRT-PCR measurement of the expressions of Col 1A1, Col 1A2, and Col 3A1. [score:3]
demonstrated that TGF-β treatment (+) markedly reduced miR-29 expression (Fig. 3B). [score:3]
Collectively, our findings suggest that high level of miR-29 is important for driving myogenic differentiation and loss of miR-29 promotes transdifferentiation of myoblasts into myofibroblasts by targeting Collagens. [score:3]
Expression folds are shown with respect to Anti-NC cells where normalized copy numbers were set to 1. Data are plotted as mean ± S. D. (J) Wild type (WT) or Mutant Lims1-3′UTR luciferase reporter constructs were transfected into C2C12 cells with miR-29 or negative control (NC) oligos. [score:3]
Our studies identify a novel pathway through which miR-29 regulates TGF-β signaling induced transdifferentiation. [score:2]
Our results, however, for the first time demonstrated that miR-29 also regulates TGF-β induced transdifferentiation, thus establishing the dual roles of TGF-β-miR-29 axis in both myogenic and fibrogenic differentiation of muscle cells. [score:2]
0033766.g006 Figure 6 The mo del depicts the roles of the TGF-β-Smad3-miR-29 regulatory circuit in myogenic and fibrogenic differentiation of C2C12 cells. [score:2]
Although it is not known whether miR-29 plays a part in regulating transdifferentiation of myoblasts into myofibroblasts, emerging studies implicated miR-29 family in cardiac, liver, pulmonary, skin and muscle fibrosis [14], [15], [16], [17], [18], [19]. [score:2]
To test whether Smad3 can directly bind to miR-29 promoter, we searched for its binding site on miR-29b/c promoter [5]. [score:2]
In addition to MyoD regulation, we have previously demonstrated that miR-29 promoter is epigenetically silenced in undifferentiated myoblasts by an YY1/Polycomb repressive complex through recruitment to an YY1 binding CCAT box, and removal of this complex is necessary for the myogenic program to occur [25]. [score:2]
Furthermore, it was not clear whether miR-29 regulates both the anti-myogenic and the pro-fibrogenic effect of TGF-β signaling. [score:2]
Very recently, interplay between TGF-β and miR-29 was discovered in the regulation of myogenic differentiation [13]. [score:2]
Next, we sought to determine whether TGF-β repression is biologically functional in terms of regulating the pro-myogenic and anti-fibrogenic action of miR-29. [score:2]
Muscles were harvested at designated days after the injection and assayed for miR-29 expression levels by qRT-PCR. [score:2]
The application of this new mechanism may extend beyond miR-29 promoter and represent a general mode of TGF-β/Smad3 repression in skeletal muscle differentiation considering many myofibrillar genes were also regulated by MyoD and YY1/Ezh2 complex [5], [25]. [score:2]
This regulation appeared specific to miR-29 binding since changes in luciferase activity were not impacted when transfections were repeated with an irrelevant miRNA, miR-212, or with the miR-29 site deleted from the collagen 3′UTR (Mutant). [score:2]
In agreement, miR-29 expression levels were significantly elevated in Smad3 [−/−] myoblasts (Figure 4D, 7.3±0.1 fold, p<0.0001) compared to Smad3 [+/+] cells. [score:2]
The mo del depicts the roles of the TGF-β-Smad3-miR-29 regulatory circuit in myogenic and fibrogenic differentiation of C2C12 cells. [score:2]
In turn, the accumulation of miR-29 during differentiation leads to the depletion of YY1 which is also a repressor of muscle genes. [score:1]
Subsequently, PolyA-tailed mRNAs from control and miR-29 cells were subjected to transcriptome analysis using a RNA-seq platform. [score:1]
Although the addition of miR-29 oligos rescued the anti-myogenic effect of TGF-β, it is still largely existent. [score:1]
For the construction of mutant plasmid, the 29 base pair seed region of the predicted miR-29 binding site was deleted from the above parental constructs using QuickChange XL-mutagenesis (Stratagene). [score:1]
We thus speculated that the pro-fibrogenic action of TGF-β mediated through miR-29 represents a novel signaling event contributing to fibrogenic conversion of myoblasts. [score:1]
We were thus intrigued to explore the underlying mechanisms through which Smad3 represses miR-29 transcriptional activity. [score:1]
As mo deled in Figure 6, during normal muscle regeneration, miR-29 level is elevated through replacing a repressive YY1/Ezh2/HDAC1 complex by a MyoD/SRF activating complex on its promoter, leading to successful myogenic differentiation [5]; However, during the transdifferentiation, activated TGF-β signaling induces Smad3 translocation into nucleus where it binds to miR-29 promoter, resulting in MyoD dissociation as well as YY1/Ezh2 stabilization. [score:1]
Smad3 mediates the repression of TGF-β on miR-29 at the transcriptional level by binding to miR-29 promoter region. [score:1]
miR-29-promoter luciferase reporter was created and used as described (Wang et al., 2008). [score:1]
A total of 26.3 million and 11.4 million raw reads were sequenced from miR-29 and NC samples, respectively, which were then mapped to mouse NCBIM37.61 mm9 reference genome via Tophat v1.2 [21]. [score:1]
To construct Lims1-3′UTR reporter plasmid, a 45 bp fragment encompassing miR-29 binding site was cloned into pMIR-report vector (ABI) between Spa1 and Sac1 sites. [score:1]
In the current study, we present evidences for the pleiotropic roles of miR-29 in skeletal muscle cells. [score:1]
Together, these data support that TGF-β acts upstream of miR-29 to antagonize its pro-myogenic and anti-fibrogenic effect in C2C12. [score:1]
A mo del of TGF-β-Smad3-miR-29 circuit in myogenic and fibrogenic differentiation of C2C12 myoblasts. [score:1]
In addition to the above mechanism, we present evidence for a new layer of repression through recruitment of YY1/Ezh2 repressive complex on multiple sites of miR-29 promoter. [score:1]
In addition to ECM genes, we found that cell adhesion genes represent an important category of genes under control by miR-29. [score:1]
Enrichment folds are shown with respect to IgG control where normalized PCR values were set to 1. Data are plotted as mean ± S. D. (F) Upper: 10T1/2 cells were transfected with 0.25 µg of miR-29-promoter-luc reporter plasmid along with 0.5 µg YY1 plasmid and Smad3 plasmid (0, 0.20, 0.50, 1.00, or 2.00 µg). [score:1]
TGF-β repression on miR-29 promoter is transcriptionally mediated by Smad3. [score:1]
This is in agreement with the emerging reports demonstrating the pivotal role of miR-29 in ECM remo deling as well as fibrosis of multiple tissues [15], [16], [17], [18] (Fig. S1D–E). [score:1]
0033766.g005 Figure 5 (A) Schematic illustration of proximal promoter region of mmu-miR-29b/c primary transcript. [score:1]
TGF-β treatment led to an obvious delay in the myogenic program in both NC (Lane 9–12) and miR-29 (Lane 13–16) cells, suggesting that TGF-β acts upstream of miR-29 in antagonizing its pro-myogenic action. [score:1]
We thus asked whether Smad3 repression on miR-29 promoter could be executed in a similar fashion as MyoD has been implicated as an activator of miR-29 at the onset of myogenic differentiation [5]. [score:1]
Straight line, promoter/enhancer region of mmu-miR-29b/c with arrow denotes TSS; CCAT, YY1 binding elements; E-box, MyoD binding sites; SBE, Smad3 binding element; Me, methylation of histone lysine 27; Ac, acetylation of histones. [score:1]
miR-29 is anti-fibrogenic in C2C12 cells. [score:1]
On the other hand, miR-29 partially attenuates both the pro-fibrogenic and anti-myogenic actions of TGF-β. [score:1]
Upon TGF-β stimulation, activated Smad3 translocates into nucleus where it binds to SBE, resulting in MyoD dissociation as well as YY1/Ezh2 recruitment to multiple CCAT boxes of miR-29b/c promoter. [score:1]
Previously, our group identified miR-29 as a pro-myogenic factor [4], [5]. [score:1]
Furthermore, we demonstrated that TGF-β controls both the pro-myogenic and anti-fibrogenic functions of miR-29. [score:1]
To our knowledge, this is the first report to describe the global effects of miR-29 on cellular transcriptome. [score:1]
On the contrary, primary myoblasts isolated from Smad7 [−/−] mice displayed a significant reduction on miR-29 level (Figure 4E, 0.11±0.2 fold, p<0.001). [score:1]
Co-transfections of the reporter plasmid (WT) with miR-29 caused significant repressions of luciferase activities (Fig. 2E). [score:1]
As expected, miR-29 stable cells (Fig. 3D, Lane 5–8) displayed accelerated myogenic differentiation vs NC cells (Lane 1–4). [score:1]
This promoted us to ask whether TGF-β silencing miR-29 can be mediated by YY1/Polycomb complex. [score:1]
This notion was further examined by using reporters with a fragment of the collagen (Col 1A1, Col 1A2, Col 3A) 3′ UTR containing the miR-29 binding site fused downstream of the firefly luciferase (Luc) gene. [score:1]
In a similar fashion, we examined the effect of TGF-β on the anti-fibrogenic action of miR-29. [score:1]
Our findings thus fuels the interesting hypothesis that loss of miR-29 through TGF-β signaling promotes transdifferentiation of myoblasts into myofibroblasts, which represents a novel contributing route to muscle fibrogenesis in dystrophic muscles. [score:1]
In both NC (A) and miR-29 (B) samples, the majority of the RNA-seq reads fall into the transcript regions (CDs, 5′UTR, and 3′UTR), demonstrating good specificity for mRNAs. [score:1]
In order to gain insights into the miR-29 mediated events in muscle cells, we decided to conduct a genome-wide transcriptome analysis. [score:1]
Analysis of miR-29 affected transcriptome using RNA-seq. [score:1]
Taken together, our results identified miR-29 as a pleiotropic molecule in muscle cells. [score:1]
[1 to 20 of 138 sentences]
4
[+] score: 433
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
E. and F. Inhibition of miR-29b expression by target inhibitors transfection leads to increased glucose consumption and lactate production in A2780 cells, and over -expression of miR-29b by target mimics transfection causes decreased glucose consumption and lactate production in S KOV3 cells. [score:13]
As indicated in Figure 6E, the expression of AKT2, AKT3, PKM2 and HK2 were significantly lower in the miR-29b agomir group compared with the NC agomir group, suggesting that miR-29b agomir treatment down-regulated in vivo AKT2/3 levels and further inhibited cancer cell glycolysis via downregulation of PKM2 and HK2 expression. [score:12]
Figure 4 A. A schematic is provided to demonstrate various enzymes involved in regulating glycolytic metabolism of cancer cells; B. Correlation analysis between speed-limiting glycolytic genes (LDHA, PKM2, GLUT1, and HK2) expressions and miR-29b levels using the NCI-60 expression profiling data; C. and D. qPCR and WB results show changes in AKT2, AKT3 and four interested glycolytic enzymes when miR-29b is silenced by target inhibitors transfection in A2780 and 3AO cells at mRNA and protein levels, respectively; E. and F. Key glycolytic product pyruvic acid was increased by miR-29b silencing, while the ratio of NAD [+]/NADH decreased as ovarian cancer cells were transfected with miR-29b inhibitors in both A2780 and S KOV3 cells. [score:12]
A. Survival rate prediction results show that AKT2/3 expression negatively correlates with ovarian cancer patients' probability of progression-free survival, while no statistically significance was observed between AKT1 expression and probability of progression-free survival; B. MTT assay results reveal that both AKT2 and AKT3 overexpression led to an increase in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells, while simultaneous overexpression of AKT2/3 and miR-29b lead to no significant change in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells; C. AKT2/3 overexpression lead to increased glucose consumption in both A2780 and S KOV3 cells, while simultaneous overexpression of AKT2/3 and miR-29b lead to no significant change in glucose consumption in both A2780 and S KOV3 cells. [score:12]
A. A schematic is provided to demonstrate various enzymes involved in regulating glycolytic metabolism of cancer cells; B. Correlation analysis between speed-limiting glycolytic genes (LDHA, PKM2, GLUT1, and HK2) expressions and miR-29b levels using the NCI-60 expression profiling data; C. and D. qPCR and WB results show changes in AKT2, AKT3 and four interested glycolytic enzymes when miR-29b is silenced by target inhibitors transfection in A2780 and 3AO cells at mRNA and protein levels, respectively; E. and F. Key glycolytic product pyruvic acid was increased by miR-29b silencing, while the ratio of NAD [+]/NADH decreased as ovarian cancer cells were transfected with miR-29b inhibitors in both A2780 and S KOV3 cells. [score:12]
Figure 3 A. Survival rate prediction results show that AKT2/3 expression negatively correlates with ovarian cancer patients' probability of progression-free survival, while no statistically significance was observed between AKT1 expression and probability of progression-free survival; B. MTT assay results reveal that both AKT2 and AKT3 overexpression led to an increase in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells, while simultaneous overexpression of AKT2/3 and miR-29b lead to no significant change in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells; C. AKT2/3 overexpression lead to increased glucose consumption in both A2780 and S KOV3 cells, while simultaneous overexpression of AKT2/3 and miR-29b lead to no significant change in glucose consumption in both A2780 and S KOV3 cells. [score:12]
Figure 2 A. A schematic shows the prediction and screening process of miR-29b downstream target gene involved in cancerous glycolysis regulation by a series of microRNA bioinformatics softwares; B. Expression analysis between miR-29b and predicted downstream target genes using the NCI-60 expression profiling data. [score:10]
A. A schematic shows the prediction and screening process of miR-29b downstream target gene involved in cancerous glycolysis regulation by a series of microRNA bioinformatics softwares; B. Expression analysis between miR-29b and predicted downstream target genes using the NCI-60 expression profiling data. [score:10]
As shown in Figure 3C and 3D, the over -expression of AKT2/3 increased glucose consumption and lactate production in both the A2780 and S KOV3 cells, while simultaneous over -expression of AKT2/3 and miR-29b caused no significant change in glucose consumption and lactate production in both the A2780 and S KOV3 cells, indicating that AKT2/3 overexpression leads to an increase in cancerous glycolytic metabolism, which could later be blocked by miR-29b overexpression. [score:9]
As demonstrated in Figure 4C, the mRNA expression of AKT2/3, HK2, and PKM2 was upregulated when miR-29b was silenced, whereas no changes in GLUT1 and LDHA expression were observed. [score:8]
To test our hypothesis, we employed miRNA mimics and inhibitors to specifically over-express and knock down endogenous expression of miR-29b in S KOV3 and A2780 cells, respectively. [score:8]
First, we tested the expression levels of miR-29b in different metabolic conditions (high/low glucose plus normoxia/hypoxia) in two representative ovarian cancer cell lines, A2780, with the highest endogenous miR-29b expression among the four cancer cell lines, and S KOV3, with the lowest endogenous miR-29b expression among the four cancer cell lines. [score:7]
Inhibition of miR-29b expression led to increased glucose consumption and lactate production in the A2780 cells, while over -expression of miR-29b decreased glucose consumption and lactate production in the S KOV3 cells (Figure 1E and 1F). [score:7]
To this end, we employed four miRNA target predicting websites (including miRanda, Targetscan, PITA, and miRWalk) to predict the downstream targets of miR-29b related to cancerous metabolism. [score:7]
Collectively, these data indicate that the miR-29b agomir is capable of inhibiting [18]F-FDG uptake as well as glycolytic metabolism in xenograft tumors, suggesting that targeting miR-29b may prove to be an effective treatment to suppress ovarian cancer via the modulation of tumor glucose metabolism. [score:7]
We then assessed the changes in the expression of AKT2, AKT3, and the four glycolytic enzymes caused by silencing endogenous miR-29b expression in the two ovarian cancer cell lines with constitutively high endogenous miR-29b expressions (A2780 and 3AO). [score:7]
Thus, we hypothesized that miR-29b might play a role in the Warburg effect by directly targeting AKTs and negatively regulating their expression. [score:7]
In contrast, miR-29b knockdown via the transfection of target miRNA inhibitors led to an increase in the (OD value at 570 nm in the same cell lines (Figure 1C). [score:6]
As shown in Figure 2C and 2D, the expression of AKT2 and AKT3 was significantly decreased after the cells were transfected with miR-29b mimics and was significantly increased at both the mRNA and protein levels after administration with miR-29b inhibitors. [score:5]
In this study, we showed that miR-29b reduced glycolysis in ovarian cancer cells and suppressed xenograft tumor formation in mouse mo dels, revealing that miR-29b suppresses glucose metabolism in cancer cells. [score:5]
This observation raised the possibility that miR-29b might negatively regulate AKT2/AKT3 expression by directly binding to their 3′UTR sequences. [score:5]
D. AKT2/3 overexpression lead to increased lactate production in both A2780 and S KOV3 cells, while simultaneous overexpression of AKT2/3 and miR-29b lead to no significant change in lactate production in both A2780 and S KOV3 cells. [score:5]
While no change in AKT1 levels was observed in both conditions; D. Western blot results show that miR-29b inhibition increased AKT2 and AKT3 levels, and miR-29b overexpression decreased AKT2 and AKT3 levels in both A2780 and S KOV3 cells. [score:5]
Increased miR-29b expression suppresses xenograft tumor formation. [score:5]
To confirm the involvement of the miR-29b-AKT axis in the regulation of the Warburg effect in ovarian cancer cells, we next silenced miR-29b and simultaneously employed AKT inhibitors to knock-down AKT expression; we then evaluated downstream changes in common glycolytic products. [score:5]
Among the five selected genes, AKT2 and AKT3 showed a significantly negative correlation against miR-29b level; C. qPCR results indicate that miR-29b inhibition increased AKT2 and AKT3 levels in A2780 cells, and miR-29b overexpression decreased AKT2 and AKT3 levels in S KOV3 cells. [score:5]
Figure 1 A. Normal ovarian epithelial cells HOSEpiC shows highest endogenous miR-29b expression compared with 4 selected ovarian cancer cell lines; B. qPCR results shows that miR-29b in benign ovarian epithelia is much higher than those in human cancerous ovarian epithelia; C. MTT assay results reveal that miR-29b mimics transfection led to a decrease in absorbance (OD value) at 570 nm, while miR-29b inhibitors transfection led to an increase in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells; D. qPCR results indicate that miR-29b expression varies in different metabolic conditions in ovarian cancer cell lines A2780 and S KOV3. [score:5]
Similar to those findings, we demonstrated in our study that miR-29b suppresses glycolysis by targeting AKT-HK2/PKM2 in ovarian cancer cells. [score:5]
Previous studies have suggested that miR-29b exerts its tumor-suppressing function by targeting oncogenes such as Bcl-2, Mcl-1, and MMP-2 [35– 38]. [score:5]
Toward this end, we correlated the levels of these four glycolysis rate-limiting enzymes and miR-29b expression using the NCI-60 expression profiling data (GSE5846, http://www. [score:5]
A. Normal ovarian epithelial cells HOSEpiC shows highest endogenous miR-29b expression compared with 4 selected ovarian cancer cell lines; B. qPCR results shows that miR-29b in benign ovarian epithelia is much higher than those in human cancerous ovarian epithelia; C. MTT assay results reveal that miR-29b mimics transfection led to a decrease in absorbance (OD value) at 570 nm, while miR-29b inhibitors transfection led to an increase in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells; D. qPCR results indicate that miR-29b expression varies in different metabolic conditions in ovarian cancer cell lines A2780 and S KOV3. [score:5]
miR-29b directly targets and thus negatively regulates AKT2 and AKT3. [score:5]
Specifically, the over -expression of miR-29b via the transfection of target miRNA mimics led to a decrease in absorbance (OD value) at 570 nm in both A2780 and S KOV3 cells. [score:5]
Together, these results demonstrated that miR-29b binds directly to its complementary sequence motifs in the 3′ UTR of AKT2/AKT3, negatively regulating their expression. [score:5]
The miR-29b mimics, control mimics, miR-29b inhibitors, and control inhibitors were all purchased from RiboBio (Guangzhou, China). [score:5]
To generate AKT2/AKT3 3′UTRs with a mutant target sequence, transversion mutations of 7 nucleotides were made at the miR-29b seed region complementary sites as shown in Figure 3C. [score:4]
miR-29b is differentially expressed in human ovarian cancers & normal ovaries, and involved in regulating ovarian cancer cell metabolism. [score:4]
However, miR-29b negatively regulated both AKT2 and AKT3 expression in both of the selected ovarian cancer cell lines. [score:4]
miR-29b is differentially expressed in human ovarian cancers & normal ovaries and is involved in the regulation of ovarian cancer cell metabolism. [score:4]
The MTT assay results (Figure 3B) showed that over -expression of AKT2 and AKT3 enhanced cellular proliferation in the A2780 and S KOV3 ovarian cancer cell lines, while simultaneous over -expression of miR-29b and AKT2/3 led to no statistically significant change in cellular proliferation. [score:4]
Intriguingly, the ovarian cancer tissues that exhibited lower miR-29b expression also showed higher levels of AKT2 and AKT3 compared to their counterparts that exhibited higher miR-29b expression (Figure 2H). [score:4]
These lines of evidence indicate that miR-29b silencing upregulated AKT2/3 levels and thus contributed to the activation of key enzymes in the Warburg effect. [score:4]
miR-29b has been shown to be downregulated in ovarian cancer. [score:4]
B. WB results show that compared with those treated with miR-29b inhibitors transfection, an additional incubation of specific AKT inhibitor GSK690693 leads to a decrease in the protein levels of p-AKT2, p-AKT3, HK2, and PKM2 in both A2780 and 3AO cells. [score:4]
Using bioinformatics -based predictions, we found that miR-29b was involved in the regulation of AKT2 and AKT3 expression. [score:4]
Additionally, the identification of miR-29b downregulation in ovarian cancer cells and tissues may increase the scope of potential therapeutics for ovarian cancer. [score:4]
miR-29b is a well-documented tumor-suppressing miRNA that is dysregulated in a number of human cancers, including prostate cancer, non-small-cell lung cancer, and breast cancer, among others [22, 25– 28]. [score:4]
As shown in Figure 1A, compared with the expression in four cancerous ovarian cell lines, miR-29b expression was significantly higher in the human normal ovarian epithelial cell line HOSEpiC. [score:4]
At the end of the experimental period, the mean wet weight of the tumors of the miR-29b over -expression group was significantly lower than that of the tumors of the control group (Figure 6B and 6C). [score:3]
Moreover, the production of key metabolic products such as pyruvic acid and NAD [+]/NADH also changed as miR-29b expression was silenced. [score:3]
AKT inhibition blocks miR-29b silencing -induced AKT2/3 activation and glycolytic metabolic changes. [score:3]
Similarly, exogenous over -expression of miR-29b in ovarian cancer via the transfection of synthetic miR-29b oligonucleotides, infection with miR-29 viral vectors or other approaches to increase endogenous miR-29bmay be potent options for future clinical treatments of ovarian cancer. [score:3]
We believe that elucidating the specific roles of miR-29b in both the Warburg effect and the latent molecular mechanisms of ovarian cancer will benefit our theoretical understanding of human ovarian cancer and provide future clinical approaches to treating this disease. [score:3]
The targets and binding sites of miR-29b were predicted using several online programs that differed with respect to their databases and algorithms, including miRBase (http://www. [score:3]
Collectively, these data suggest that miR-29b may inhibit xenograft tumor formation of ovarian cancer cells in vivo. [score:3]
G. Immunohistochemical results reveal that expression of AKT2 and AKT3 is higher in EOC epithelia than in normal ovarian epithelia; H. Immunohistochemical results indicate a negative correlation between miR-29b and AKT2/3 levels in EOC epithelia. [score:3]
AKT inhibitor blocked miR-29b silencing -induced AKT2/3 activation and glycolytic metabolic change. [score:3]
Furthermore, among the four human ovarian cancer cell lines, A2780 exhibited the highest endogenous miR-29b expression, and S KOV3, the lowest (Figure 1A). [score:3]
As demonstrated in Figure 4B, none of the four selected glycolytic genes was significantly correlated with miR-29b expression in the NCI-60 cancer cell lines or in the 7 ovarian cancer cell lines. [score:3]
Our findings here showed that the targeting of AKTs and their downstream effectors HK2 and PKM2 also contributes to miR-29b's anti-tumor function. [score:3]
Ovarian cancer cells were seeded into 6-well plates until 50%–60% confluent and transiently transfected with 60 nM control or miR-29b mimics or with 120 nM control or miR-29b inhibitors using X-treme GENE siRNA Transfection Reagent (Roche, Indianapolis, IN, USA) according to the manufacturer's instructions. [score:3]
E. An incubation of specific AKT inhibitor GSK690693 slowed cellular proliferation in miR-29b-silenced A2780 and S KOV3 cells. [score:3]
Similar to the results of the cellular experiments, the expression of miR-29b was much higher in the normal ovarian epithelia than in the human cancerous ovarian epithelia (Figure 1B). [score:3]
Still, the concrete role of miR-29b in regulating the Warburg effect and the precise mechanism underlying this regulation remained unclear. [score:3]
C. and D. the ratio of NAD [+]/NADH was increased, while key glycolytic product pyruvic acid decreased as specific AKT inhibitor GSK690693 was added in miR-29b-silenced A2780 and S KOV3 cells. [score:3]
This suppressive effect of miR-29b was abolished by mutating the miR-29b site in the AKT2/AKT3 3′UTR (Figure 2F). [score:3]
Pyruvic acid increased, whereas the ratio of NAD [+]/NADH decreased when the ovarian cancer cells were transfected with miR-29b inhibitors, as demonstrated in Figure 4E and 4F. [score:3]
These results indicated a negative correlation and a potential targeting relationship between miR-29b and AKT2/AKT3. [score:3]
The mean volume of the tumors of the miR-29b over -expressing group was significantly smaller than that of the tumors of the control group11 days after inoculation (Figure 6A). [score:3]
We investigated the expression of miR-29b in human ovarian cancer cells and human normal ovarian epithelial cells, to determine whether miR-29b is differentially expressed in cancerous and normal ovarian cells. [score:3]
org/); AKT2 and AKT3 were predicted to be downstream target genes of miR-29b by all of these programs, and this was further validated by experiments. [score:3]
As demonstrated in Figure 1D, miR-29b was differentially expressed under different metabolic conditions in both of the selected ovarian cancer cell lines, indicating the involvement of miR-29b in ovarian cancer metabolism. [score:3]
Considering the findings described above, we then focused on AKT2 and AKT3, key proteins in the AKT signaling pathway, as potential downstream target genes of miR-29b. [score:3]
Also, a statistically significant negative correlation was found between miR-29b and AKT2 or AKT3 expression in EOC tissue (Supplementary Figure S3). [score:3]
Using bioinformatics, we previously identified AKT2 and AKT3, both of which are key proteins in the AKT signaling pathway, as potential downstream target genes of miR-29b, indicating that miR-29b -mediated effects on the AKT signaling pathway is probably involved in cancer glycolysis and the Warburg effect. [score:3]
The AKT2 and AKT3 3′UTRs containing the predicted miR-29b target sequence were amplified from genomic DNA (A2780 and S KOV3 cells) and cloned into the pGL3 firefly luciferase control vector (Promega, Madison, WI) at the XhoI restriction site immediately downstream of the luciferase reporter gene. [score:3]
We then examined miR-29b and its latent downstream targets, AKT2 and AKT3 in 30 human ovarian cancer tissues and 30 matched normal ovarian tissues as negative controls. [score:3]
This could at least partially explain the latent mechanism of miR-29b's regulation of the Warburg effect in ovarian cancer cells. [score:2]
Next, we analyzed the relationships between miR-29b, these four putatively cancer glycolysis -regulating genes, and another key component of the AKT pathway, AKT1. [score:2]
Western blotting showed that GSK690693 blocked the miR-29b silencing -induced activation of AKT2/3, HK2 and PKM2, confirming that the miR-29b-AKT axis regulates the activity of key glycolytic enzymes in ovarian cancer cells (Figure 5B). [score:2]
These results confirm that miR-29b is involved in regulating the Warburg effect in ovarian cancer cells. [score:2]
Together, these results indicate that GSK690693 blocked the miR-29b silencing -induced glycolytic metabolic changes and thus provide additional evidence of the function of the miR-29b-AKT axis in regulating the Warburg effect in ovarian cancer cells. [score:2]
Moreover, compared to treatment with miR-29b inhibitors alone, the addition of GSK690693 also enhanced the NAD+/NADH ratio as well as decreased pyruvic acid production and cellular proliferation in both A2780 and 3AO cells, as shown in Figure 5C, 5D, and 5E. [score:2]
This finding, in addition to a previous report of miR-29b -mediatedcontrolof amino acid catabolism in human kidney cells, suggests a novel function of miR-29b in regulating cancer cell glucose metabolism [34]. [score:2]
No change in AKT1 was observed at either the RNA or protein level, indicating that AKT1 is not involved in miR-29b's regulation of the Warburg effect in ovarian cancer cells. [score:2]
Together, these results, suggest the possibility that in addition to regulating glucose metabolism, the miR-29b-AKT-HK2/PKM2 pathway also performs an important role in controlling tumourigenesis in ovarian cancer cells. [score:2]
Because changes in cellular growth, proliferation, and migration are the basic outcomes of altered metabolism in cancer cells, we next explored whether miR-29b also regulated ovarian cancer cell metabolism. [score:2]
Post-transcriptional inhibition of the luciferase reporter gene by miR-29b was assayed in A2780 and S KOV3 cells. [score:2]
Briefly, ovarian cancer cells were transfected with miR-29b or control mimics in addition to a luciferase construct containing either the wild-type AKT2/AKT3 3′UTR or a mutant AKT2/AKT3 3′UTR (Figure 2E). [score:1]
To further evaluate the potential effect of miR-29b on ovarian cancer cell growth in vivo, S KOV3 cells with or without miR-29b over -expression were subcutaneously inoculated into the homolateral flanks of mice. [score:1]
Activation of AKTs by miR-29b silencing contributes to the activation of key enzymes in the Warburg effect in ovarian cancer cells. [score:1]
Furthermore, we analyzed the 3′UTR sequences of AKT2/AKT3 as well as the mature chain sequence of miR-29b and found that the “seed region” of the miR-29b mature chain was fully complementary with and thus could potentially bind to the 3′ UTR sequences of AKT2 and AKT3 (Figure 2E). [score:1]
The cells were then co -transfected with either miR-29b or control mimics at a 120 nM final concentration or with 200 ng of pGL3 reporter construct containing wild-type or miR-29b with the mutated AKT2/AKT3 3′UTR using the X-treme GENE HP DNA Transfection Reagent according to the manufacturer's recommendations (Roche, Indianapolis, IN, USA). [score:1]
A 3′UTR luciferase reporter assay confirmed that miR-29b directly bound to the 3′UTR of both AKT2 and AKT3. [score:1]
A transwell migration assay and wound-healing assay also showed that miR-29b expression negatively correlated with ovarian cancer cell migration capacity, as demonstrated in Supplementary Figures S1 and S2. [score:1]
Stabilized miRNAs (miR-29b agomir and NC agomir) were purchased from RiboBio (Guangzhou, China). [score:1]
miR-29b, a member of the miRNA-29 family, has been shown to participate in both the onset and progression of various malignant tumors, including ovarian cancer [12– 16]. [score:1]
Figure 6An in vivo tumor mo del was established by subcutaneous injection of 1 × 10 [6] S KOV3 cells pre -transfected with Ago-miR-29b or Ago-miR-NC. [score:1]
The tumor weight was plotted between the two groups; D. Representative maximum intensity projection(MIP) and Complete volume rendering images from CT scanning, and [18]F-FDG PET images of tumors(from left to right) in Ago-miR-29b and Ago-miR-NC treated mice. [score:1]
A. Comparison of tumor growth (volume increase) between miR-29b group and the negative control group (control). [score:1]
miR-29b has also been reported to be involved in diverse physiological and pathological processes, including cell differentiation, cell cycle control, apoptosis, and cancer progression [17]. [score:1]
Intriguingly, [18]F-FDG uptake in xenograft tumors seemd to be much less vulnerable to treatment with miR-29b agomirs (Figure 6D). [score:1]
S KOV3 cells were transfected with 100 nM of miR-29b agomir or NC agomir (stabilized miRNA) by nucleofection with program T-028 of Nucleofector II (Amaxa Biosystems, Gaithersburg, MD, USA). [score:1]
Among the nearly 2,000 miRNAs identified in mammalian cells to date, miR-29b particularly aroused our interest. [score:1]
miR-29b was shown to be decreased in several malignant tumors, including ovarian cancer [16]. [score:1]
While no change in AKT1 levels was observed in both conditions; E. Schematic representation of different AKT2/AKT3 3′UTR luciferase reporters used in the transfection experiments are depicted; F. S KOV3/A2780 cells were co -transfected with either miR-29b or control mimics and 200 ng pGL3 reporter construct containing wild type or miR-29b site mutated 3′UTR of AKT2/3. [score:1]
E. and F. Immunohistochemical analysis of AKT2, AKT3, PKM2, and HK2 in Ago-miR-29b or Ago-miR-NC treated mice xenograft tumors. [score:1]
An in vivo tumor mo del was established by subcutaneous injection of 1 × 10 [6] S KOV3 cells pre -transfected with Ago-miR-29b or Ago-miR-NC. [score:1]
However, the molecular mechanisms of the miR-29b-AKT pathway in glycolytic metabolism in ovarian cancer cells remained unknown. [score:1]
[1 to 20 of 109 sentences]
5
[+] score: 400
e, analysis of PTEN mRNA expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively In the present study, we provided evidence that miR-29b expression in high-metastatic CD133 -positive A549 lines was down-regulated when compared to miR-29b expression in paired low-metastatic CD133-negtive A549 cell lines, miR-29b was confirmed directly targeted 3’-UTR of PTEN and MMP2 mRNAs and down-regulated MMP2 protein expression to suppress lung cancer metastasis in vitro and in vivo. [score:21]
We provided important evidence that miR-29b could suppress NSCLC cells proliferation, migration and invasion by targeting the 3’-UTR of MMP2 and PTEN mRNA to down-regulate MMP2 protein expression. [score:10]
Taken together, our results demonstrate that miR-29b serves as a tumor metastasis suppressor, which suppresses NSCLC cell metastasis by directly inhibiting MMP2 expression. [score:10]
Among the predicted target genes of the seven down-regulated miRNAs in CD133 -positive A549 cells, the tumor metastasis PCR array contained four target genes of miR-29b (Fig.   1c). [score:8]
In summary, our studies demonstrated that down-regulated miR-29b expression was found to be associated with increased MMP2 expression in CD133 -positive NSCLC cells through microarrays and bioinformatics analysis. [score:8]
e, analysis of PTEN mRNA expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively To explore the miRNAs related to NSCLC metastasis, miRNA PCR array (MAH-3100A detected 376 human disease–related miRNA) were used to evaluate miRNA expression in primary cultured CD133 -positive/negative A549 cells. [score:7]
Similar results were obtained when miR-29b inhibitor was transfected into the H460 cells, the miR-29b expression level decreased and MMP2 mRNA was up-regulated significantly after 48 h transfection compared with the NC group and Blank groups (Fig.   6b, c, * P < 0.05). [score:7]
There was no inhibition effect on the following site-specific mutagenesis of the miR-29b MMP2 3’ UTR binding sites (Fig.   6e, * P < 0.05), indicating that miR-29b directly regulated the target gene MMP2 negatively in NSCLC. [score:7]
miR-29b was found down-regulated in A549-H cells and up-regulated in A549-L cells. [score:7]
Through miR-29b overexpression or knockdown analysis, the fact was determined that miR-29b variations were not accompanied with the alteration of PTEN expression. [score:6]
Another reason that might explain our contrasting findings was that miR-29b directly inhibits CDC42 and p85α to activate p53 expression [34]. [score:6]
The inhibition of Sp1 by miR-29b resulted in the upregulation of PTEN in tongue squamous cell carcinoma [36]. [score:6]
and quantitative RT-PCR indicated that miR-29b down-regulated the expression of MMP2 at the protein and mRNA levels. [score:6]
While miR-29b down-regulated the expression of MMP2 at the protein and mRNA levels. [score:6]
org, TargetScan and Pictar datebases results revealed that the expression levels of miR-29b were significantly higher in the H460 and 95C cell lines compared to 16HBE cell line, while the expression levels were lower in the PGCL3, PAa, H520, A549, H1299 and 95D cell lines (Fig.   2a). [score:6]
These findings might indicate that upregulation of miR-29b had a potential to inhibit of metastasis of NSCLC. [score:6]
indicated that miR-29b down-regulated the endogenous protein expression of MMP2. [score:6]
org, TargetScan and Pictar datebases Quantitative RT-PCR results revealed that the expression levels of miR-29b were significantly higher in the H460 and 95C cell lines compared to 16HBE cell line, while the expression levels were lower in the PGCL3, PAa, H520, A549, H1299 and 95D cell lines (Fig.   2a). [score:6]
c, analysis of MMP2 mRNA expression levels in A549 and H460 cell lines after infection LV-miR-29b or miR-29b inhibitor, respectively. [score:5]
PTEN gene was not only indirectly regulated by miR-29b-p53-PTEN positively, but also directly regulated by miR-29b negatively. [score:5]
d, Western blots analysis of PTEN expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively. [score:5]
Twenty pairs of paraffin-embedded NSCLC tissues and normal tissues (Fig.   2b) and ten pairs of fresh NSCLC tissues and normal adjacent tissues (Fig.   2c) were also chosen to detect the expression levels of miR-29b, the results showed that the expression level of miR-29b in twenty cases of paraffin NSCLC tissues was (−1.893 ± 1.367), significantly lower than that in the adjacent lung tissue (−0.605 ± 0.639; P = 0.001, t = −3.817). [score:5]
Based on our findings, the expression of miR-29b is down-regulated in NSCLC compared to normal tissues and significantly associated with metastasis. [score:5]
b, analysis of miR-29b expression levels in A549 and H460 cell lines after infection LV-miR-29b or miR-29b inhibitor, respectively. [score:5]
There was no significant relationship of miR-29b expression with age (P = 0.578), gender (P = 0.862), histology (P = 0.625) and differentiation (P = 0.891); while miR-29b expression was found had significant relationships with lymphatic metastasis (P = 0.004) and clinic stage (P = 0.031). [score:5]
Our data demonstrated that miR-29b inhibited in vitro cell proliferation, invasion and migration and in vivo suppressed NSCLC growth in a nude mice xenograft mo del. [score:5]
The regulatory mechanisms of a miRNA could differ among different microenvironments, miR-29b is upregulated in metastatic breast cancer tissues and indolent lymphocytic leukemia, functioning as an oncogene [21, 22]. [score:5]
d, Western blots analysis of MMP2 expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively. [score:5]
The images showed that miR-29b overexpression inhibited A549-H cells migration and invasion (Fig.   5a). [score:5]
The luciferase reporter gene study further confirmed that miR-29b bound directly to wild-type MMP2 3’ UTR to inhibit the luciferase activity. [score:4]
Details are in the Additional file 1. H460 subline stably knockdown miR-29b (H460-LV-miR-29b inhibitor) and its control line (H460-LV-CON), were established as described in Additional file 1. Analysis for tumorigenicity was performed as described in Additional file 1. All data were analyzed using SPSS 13.0 (SPSS Inc, Chicago, IL, USA); A paired t test was used to investigate the difference in the expression level of miR-29b between normal and cancerous tissues. [score:4]
The influence of miR-29b on PTEN mRNA and protein expression levels were also evaluated in the A549 and H460 cells, There were no obvious changes on PTEN mRNA and protein expression levels in LV-miR-29b infected A549 cells or in miR-29b inhibitor transfected H460 cells compared with the NC or Blank groups (Fig.   7d, e). [score:4]
Details are in the Additional file 1. In vivo studiesH460 subline stably knockdown miR-29b (H460-LV-miR-29b inhibitor) and its control line (H460-LV-CON), were established as described in Additional file 1. Analysis for tumorigenicity was performed as described in Additional file 1. All data were analyzed using SPSS 13.0 (SPSS Inc, Chicago, IL, USA); A paired t test was used to investigate the difference in the expression level of miR-29b between normal and cancerous tissues. [score:4]
miR-29b is down-regulated in NSCLC tissues. [score:4]
Furthermore, the dual-luciferase reporter assay demonstrated that miR-29b inhibited the expression of luciferase gene containing the 3’-UTR of PTEN and MMP2. [score:4]
To verify whether MMP2 is a direct target of miR-29b, the 3’UTR of MMP2 cDNA was cloned into the downstream region of the luciferase reporter gene (psiCHECK-2-Wt-MMP2-3’UTR) and co -transfected this vector into 293-T cells with miR-29b mimic (Additional file 5: Figure S1A, B). [score:4]
Therefore, PTEN was a direct target of miR-29b. [score:4]
Our present results showed that miR-29b bound directly to the two PTEN 3’ UTR binding sites and PTEN was a miR-29b target gene. [score:4]
Furthermore, the dual-luciferase reporter assay demonstrated that miR-29b inhibited the expression of the luciferase gene containing the 3’-UTRs of MMP2 and PTEN mRNA. [score:4]
miR-29b affected PTEN expression by binding directly with the PTEN 3’ UTR. [score:4]
These findings indicated that miR-29b regulated MMP2 expression negatively. [score:4]
Additionally, dual-luciferase reporter assay and western blot results further elucidated that the miR-29b inhibited the expression of the luciferase gene containing the 3’-UTRs of MMP2 and PTEN mRNA. [score:4]
However, miR-29b is down-regulated in lung carcinoma tissues [23]. [score:4]
MMP2 as a target gene of miR-29b in NSCLC. [score:3]
Collectively, these observations suggested that miR-29b suppressed growth and metastasis of NSCLC cell in vitro and in vivo. [score:3]
The expression of miR-29b was down regulated in NSCLC tissues compared to the normal tissues. [score:3]
As expected, miR-29b inhibitor promoted cell migration and invasion (Fig.   5c) of A549-L cells. [score:3]
The expression level of miR-29b in ten cases of fresh non-small cell lung cancer tissues was (−1.996 ± 0.460), significantly lower than that in the adjacent lung tissue (−0.463 ± 0.257; P < 0.001, t = −9.016). [score:3]
Our results showed that miR-29b inhibited growth and metastasis of NSCLC cells in vitro and in vivo. [score:3]
was used to determine whether miR-29b regulates PTEN directly via the software-predicted binding sites. [score:3]
Spearman rank correlation analysis was applied to analyze the expression levels of miR-29b, tumor stage and lymphatic metastasis in NSCLC tissues. [score:3]
Figure  4a showed that cell migration and invasion ability was promoted in miR-29b inhibitor group comparing to the control groups. [score:3]
a, analysis of miR-29b expression levels in NSCLC cell lines and immortalized human bronchial epithelial cell line were shown relative to U6 snRNA as an internal control. [score:3]
Fig. 2Expression of miR-29b in NSCLC cell lines and paired NSCLC tissues. [score:3]
These data confirmed that miR-29b was a metastasis suppressor in NSCLC cells. [score:3]
The results show that miR-29b may be a novel therapeutic candidate target to slow NSCLC metastasis. [score:3]
Our findings provided novel evidence for the involvement of miR-29b in NSCLC metastasis, and suggested that miR-29b could be a potential new target for treatment of NSCLC metastasis. [score:3]
miR-29b inhibitor also increased H460 cells proliferation in a time -dependent manner (Fig.   4b, * P < 0.05, ** P < 0.01). [score:3]
miR-29b played a strong inhibitory role in tumor metastasis. [score:3]
d, Cells were counted in a light scope in four random views (* P < 0.05, n = 4) To further explore the mechanisms of miR-29b which suppresses lung cancer cell invasion and metastasis, we analyzed probable down stream tumor metastasis-related genes. [score:3]
Both sites were conserved among different species and fully complementary to the miR-29b seed sequence, corresponding to the basic rules for predicting miRNA target genes [26]. [score:3]
The results showed that miR-29b maybe a novel therapeutic candidate target or strategy for seeking to control NSCLC metastasis. [score:3]
In our study, low-level expression of miR-29b in NSCLC tissues was significantly associated with lymphatic metastasis. [score:3]
miR-29b suppresses cell proliferation, migration and invasion in A549 cells. [score:3]
a, Predicted binding sites in the 3’-UTR of MMP2 mRNA and seed sequence of miR-29b by TargetScan. [score:3]
All three databases used (TargetScan, PicTar, miRanda) identified the two PTEN 3’ UTR miR-29b binding sites. [score:3]
Ten human non-small cell lung cancer (NSCLC) cell lines and samples from thirty patients with NSCLC were analyzed for the expression of miR-29b by quantitative RT-PCR. [score:3]
MiR-29b was down-regulated 7.6-fold in CD133 -positive cells. [score:3]
combined with tumor metastasis PCR array showed that matrix metalloproteinase 2 (MMP2) and PTEN could be important target genes of miR-29b. [score:3]
of the mean tumor volume (cm [3]) demonstated that miR-29b lentivirus infection inhibited the tumor growth comparing to the control groups (Fig.   3d, ** P < 0.01). [score:3]
To confirm the sequence-specific repression of miR-29b, we designed mutated versions of psiCHECK-2-Wt-MMP2-3’UTR carrying 4-bp substitutions in miR-29b target site (psiCHECK-2-Mut-MMP2-3’UTR) (Additional file 5: Figure S1C, D). [score:3]
The gain-of-function studies revealed that ectopic expression of miR-29b decreased cell proliferation, migration and invasion abilities of NSCLC cells. [score:3]
a, Predicted binding sites in the 3’-UTR of PTEN mRNA and seed sequence of miR-29b by TargetScan. [score:3]
The expression of miR-29b was positively correlated with lymphatic metastasis (r = −0.547, P = 0.043). [score:3]
In contrasts, loss-of-function studies showed that inhibition of miR-29b promoted cell proliferation, migration and invasion of NSCLC cells in vitro. [score:3]
combined with tumor metastasis PCR array showed the potential target genes for miR-29b. [score:3]
are presented as means ± SEM (* P < 0.05, n = 3) TargetScan indicated that miR-29b had two highly conserved PTEN 3’ UTR binding sites (Fig.   7a). [score:3]
Through bioinformatics analysis and miRNA PCR array and tumor metastasis PCR array, PTEN, ETV4, COL4A2 and MMP2 were logically been speculated as miR-29b target genes. [score:3]
The taregets of miR-29b were analyzed by the TargetScan, PicTar and MiRanda databases. [score:3]
Our pilot study using miRNA PCR array found that miRNA-29b (miR-29b) is differentially expressed in primary cultured CD133 -positive A549 cells compared with CD133 -negative A549 cells. [score:2]
The target genes of miR-29b were determined by luciferase assay, quantitative RT-PCR and western blot. [score:2]
a, In Matrigel invasion and transwell migration assay, LV-miR-29b inhibitor infected H460 cells vs NC infected cells in a 200× light scope after crystal violet staining. [score:2]
Nude mice xenograft tumor assay confirmed that miR-29b inhibited lung cancer growth in vivo. [score:2]
A549 subline stably expressing miR-29b (A549-miR-29b) and its control line (A549-NC) were established as described in the Additional file 1. The cells were lysed with radioimmunoprecipitation assay buffer (Beyotime, Shanghai, China). [score:2]
b, miR-29b inhibitor increased cellular proliferation ability in H460 cells by CCK8 assay. [score:2]
This result proved that miR-29b bound directly to both PTEN 3’UTR binding sites. [score:2]
c, Photographs of subcutaneous tumors of mice injected with H460 cells that infected with LV-miR-29b inhibitor compared to NC infected cells treatment. [score:2]
Compared to H460 cells or H460-LV-NC cells group, tumor growth rates and tumor volumes of H460-LV-miR-29b -inhibitor cells group were significantly increased (Fig.   4c, d, * P < 0.05). [score:2]
c, In Matrigel invasion and migration assay, miR-29b inhibitor infected A549-L cells vs NC infected in a 200× light scope after crystal violet staining. [score:2]
After A549 cells were infected with lentivirus LV-miR-29b, the expression of miR-29b was increased significantly compared with the NC and Blank groups (Fig.   6b, * P < 0.05). [score:2]
However, there were no significant changes in the co -transfected with mutant-type3 PTEN-luc reporter and miR-29b mimic group and the blank or NC groups (Fig.   7c, * P < 0.05). [score:1]
Quantitative RT-PCR was performed using kits for U6 and mature miR-29b (ABI, Foster City, CA, USA), according to the manufacturer’s instructions. [score:1]
was performed using kits for U6 and mature miR-29b (ABI, Foster City, CA, USA), according to the manufacturer’s instructions. [score:1]
Two miR-29b binding sites in the 3’UTR region of PTEN were mutated to obtain psiCHECK-2-Mut1-3-PTEN-3’UTR plasmid (Additional file 6: Figure S2C–F). [score:1]
miR-29b deficiency alters the metastasis ability of H460 cells. [score:1]
Plasmid (0.5 μg) and 50 nmol/L miR-29b mimic/mimic NC were cotransfected using Lipofectamine LTX reagent (Invitrogen). [score:1]
Therefore, miR-29b silencing with antisense oligonucleotides was administrated in H460 cells. [score:1]
Effect of miR-29b on cell migration and invasion ability in A549-L and A549-H cells. [score:1]
c, analysis of miR-29b levels in 10 pairs of fresh NSCLC tissues Data present from Table  1 showed the clinicopathologic characteristics of miR-29b expression in NSCLC patients. [score:1]
We performed gain-of-function in A459 cells and loss-of-function in H460 cells of miR-29b. [score:1]
Clinicopathological analysis demonstrated that miR-29b had significant negative correlation with lymphatic metastasis. [score:1]
Based on these results, It’s concluded that miR-29b was related to metastasis in NSCLC. [score:1]
The 1500-bp fragment of the 3’UTR region of PTEN mRNA that included the predicted miR-29b recognition site was subcloned and inserted into a luciferase reporter plasmid (Additional file 6: Figure S2A, B). [score:1]
A 2-sample t test was used to analyse the clinicopathologic characteristics of miR-29b expression in the tissues of patients with NSCLC. [score:1]
Fig. 5Effect of miR-29b on migration and invasion ability of A549-L and A549-H cells. [score:1]
c, analysis of miR-29b levels in 10 pairs of fresh NSCLC tissuesData present from Table  1 showed the clinicopathologic characteristics of miR-29b expression in NSCLC patients. [score:1]
b, Schematic diagrams of miR-29b and PTEN 3’ UTR binding and wild-type and mutated psiCHECK-2-PTEN-3’UTR sequences. [score:1]
The analysis revealed that miR-29b bound to the MMP2 3’ UTR with a partially complementary pattern (Fig.   6a). [score:1]
e, Dual luciferase activity indicating relative luciferase activity following co-transfection with psiCHECK-2-Wt-MMP2-3’UTR or psiCHECK-2-Mut-MMP2-3’UTR and miR-29b mimic. [score:1]
b, analysis of miR-29b levels in 20 pairs of paraffin-embedded NSCLC tissues. [score:1]
[1 to 20 of 110 sentences]
6
[+] score: 387
Expression of mRNAs showed the same pattern of greater change at day 7. Correlation analysis between miRNA and their putative mRNA targets showed that for the four miRNAs with altered expression at day 1 or 3 post-surgery, there was an inverse correlation only between miR-29b-3p and its putative targets (genes containing either 6mer or 7mer-m8 seed sites). [score:9]
Since expression of the miR-29 family in the MSC chondrogenesis mo del was inversely correlated with expression of SOX9, we examined the role of SOX9 in the regulation of miR-29 expression. [score:8]
Overexpression of SOX9 in SW1353 cells leads to a decrease in expression of the miR-29 family, whilst knockdown of SOX9 increased their expression (Fig.   2c). [score:8]
An enrichment of potential miR-29 targets was identified in upregulated genes, when expression of the miR-29 family was low (data not shown) suggesting functional involvement of the miR-29 family. [score:8]
Expression of the miR-29 family was measured by qRT-PCR after overexpression or knockdown of SOX9; data were normalised to U6 RNA expression (mean ± SEM, Student’s t test, n = 3 (overexpression), n = 4 (siRNA). [score:8]
Of the genes whose expression was decreased when expression of the miRNA was increased, there was an enrichment of potential miR-29-3p targets identified and vice versa (Fig.   1a). [score:7]
Among these modulated miRNAs, the expression of miR-29b-3p, a member of miR-29 family, was increased at 1 day post-surgery when it was regulated in the opposite direction to its potential targets. [score:7]
Expression of miR-29b-3p was increased at day 1 and regulated in the opposite direction to its potential targets. [score:7]
The TGFβ, IL-1, and Wnt pathways regulate and/or are regulated by the miR-29 family highlighting a nonlinear system, with outcomes on the expression of matrix or matrix-degrading genes In summary, we have shown that the miR-29 family has a role in osteoarthritis, including early disease. [score:7]
Using whole knee joint RNA, only two miRNA altered significantly in expression 24 h after surgery and of these, miR-29b-3p was inversely correlated with expression of its putative targets. [score:7]
Cells were transfected for 6 h in serum- and antibiotic-free DMEM using Lipofectamine 2000 (Invitrogen), miR-29b-3p mimic at 30 nM (Qiagen), miR-29b-3p inhibitor at 50 nM (Qiagen), or non -targeting controls (All Stars at 30 nM (Qiagen), miScript Inhibitor control at 50 nM (Qiagen)). [score:7]
Having shown the miR-29 family to be expressed in mo dels of OA and cartilage development and regulated directly by Sox9, we explored the regulation of the miR-29 family in chondrocytes by cytokines and growth factors known to be important in cartilage homeostasis and OA. [score:7]
This latter can be seen through LPS repression of miR-29 expression, but also an increased expression of miR-29 upon treatment with an NFκB inhibitor, both pre-miR-29 and at the level of the pri-miR-29a/b1 promoter. [score:7]
These are positive regulators of the Wnt pathway, and targeting them is likely to suppress Wnt signalling, which is the outcome of miR-29 action (Fig.   5). [score:6]
Similarly, the induction of miR-29 precursors was also augmented by inhibiting NFκB (Fig.   4c), suggesting that NFκB acts as a negative regulator of miR-29 expression. [score:6]
Our data also show that there is no direct relationship between SOX9 and growth factor regulating the miR-29 family, in agreement with studies showing SOX9 -dependent and independent regulation of gene expression by growth factors [42]. [score:6]
Wnt3a also decreases SOX9 expression by approximately threefold, yet has no effect on miR-29 expression (data not shown). [score:5]
Data were normalized to 18S rRNA expression for primary and precursor miRNA and to U6 expression for mature miR-29 and then vehicle control (mean ± SEM, ANOVA, n = 3). [score:5]
Empty bars, control; black bars, treatment Similarly, miR-29-3p repressed NFκB signalling, inhibiting IL-1 induction of a κB-luc construct, whilst the inhibitor of miR-29b-3p augmented the response (Fig.   5b). [score:5]
Empty bars, control; black bars, treatmentSimilarly, miR-29-3p repressed NFκB signalling, inhibiting IL-1 induction of a κB-luc construct, whilst the inhibitor of miR-29b-3p augmented the response (Fig.   5b). [score:5]
This figure demonstrates that the miR-29 family adds an additional level of regulation across key pathways of cartilage homeostasis, and its dysregulation could either lead or contribute to disease. [score:5]
SW1353 cells were transfected with (CAGA)12-luc (a), κB-luc (b) or TOPFlash and FOPFlash vectors (c) and co -transfected with either 50 nM miR-29b-3p mimics, inhibitors or non-targetting controls. [score:5]
Figure 5a shows that a miR-29b-3p mimic repressed Smad signalling, inhibiting the TGFβ1 induction of the construct; conversely, an inhibitor of miR-29b-3p augmented TGFβ1 induction. [score:5]
The miR-29 family was regulated in both human and mouse mo dels of cartilage development though decreased expression of the miR-29 family in mo dels of chondrogenesis has been described before [37, 40, 41]. [score:5]
Mutation of miR-29 seed sites (1–5 sites, depending on gene), abolished this repression, demonstrating that all these genes are direct targets of the miR-29 family (Fig.   6a). [score:5]
Cells were transfected with miR-29b-3p mimics, inhibitors or non -targeting controls, and the transcriptome analysed on Illumina microarray. [score:5]
Whilst Wnt3a does not regulate miR-29 expression in primary HACs, miR-29 can repress canonical Wnt signalling, on the TOPFlash construct and the Axin2 gene. [score:4]
Transforming growth factor beta (TGFβ) is a key factor in OA and has been shown to regulate miR-29 expression in fibrosis [18]. [score:4]
Several Wnt-related genes are direct targets of the miR-29 family. [score:4]
The NFκB pathway is repressed by miR-29 though there are opposing effects on miR-29 expression regulated by either IL-1 or LPS. [score:4]
Amongst these, FZD3, FZD5, DVL3, FRAT2, and CK2A2 were validated as direct targets of the miR-29 family. [score:4]
In these data, we have identified and validated a number of genes as new direct targets of the miR-29 family. [score:4]
Interestingly, Axin2 expression, readout of canonical Wnt signalling, was decreased in hip OA cartilage compared to NOF (Fig.   6b) where miR-29 expression was increased (Fig.   1d). [score:4]
Constructs were transfected into DF1 fibroblasts with miR-29 mimics or non -targeting controls (50 nM) and assayed for luciferase activity after 24 h. Data were normalised to Renilla luciferase and then the non -targeting control (mean ± SEM, ANOVA, n = 6). [score:4]
From data above, we hypothesised that SOX9 was a negative regulator of miR-29 expression in chondrocytes. [score:4]
This intersection contained a number of known direct targets for miR-29 (e. g. COL1A1 and COL3A1), see Supplementary Table 3. Pathway analysis (DAVID) highlighted the Wnt signalling pathway, including DVL3, (Dishevelled 3); CSNK2A2, (casein kinase 2 alpha 2 polypeptide); FRAT2, (Frequently Rearranged In Advanced T-Cell Lymphomas 2, a GSK-3 binding protein); FZD3, (Frizzled family receptor 3) and FZD5, (Frizzled family receptor 5). [score:4]
Expression of the miR-29 family is regulated in cartilage during osteoarthritis. [score:4]
Negative regulation of canonical Wnt signalling by miR-29 has been shown to be via targeting of DNMT3A and 3B to demethylate WIF-1 in non-small-cell lung cancer [55]. [score:4]
Fig. 6The miR-29 family directly targets members of the Wnt pathway. [score:4]
Expression of the microRNA-29 family in chondrocyte differentiation and regulation by SOX9. [score:4]
This showed SOX9 as a negative regulator of miR-29 expression, and we further demonstrated that this was via the promoter for the miR-29a/b1 cluster. [score:4]
In monolayer culture, IL-1 increased expression of the primary miR-29a/b1 transcript, precursors of miR-29a and miR-29b1, and the mature miR-29a-3p and miR-29b-3p (Fig.   4a). [score:3]
The miR-29-3p mimic repressed Wnt3a induction of this construct (with no effect on the control FOPFlash), whilst it was augmented by the miR-29b-3p inhibitor (Fig.   5c). [score:3]
SOX9 represses expression of the miR-29 family in chondrocytes. [score:3]
Further, expression of the miR-29 family was significantly increased in human cartilage from end-stage OA. [score:3]
IL-1 induces the miR-29 family in a p38 MAPK -dependent manner, though the NFκB pathway represses miR-29 expression. [score:3]
LPS, another factor which induces NFκB, decreased the expression of pri- and pre-miR-29a and miR-29b1 at an early time point (4 h), with the mature miR-29a-3p and miR-29b-3p reduced at 24 h (Fig.   4d). [score:3]
The frequency of predicted miR-29 targets in mRNA with seed sites of either 6mer or 7mer m8 was calculated (see Material and Methods) across fold changes of gene expression. [score:3]
A p38 inhibitor (SB203580) blocked induction of the miR-29 family by IL-1, showing that this was, at least in part, dependent on the p38 pathway (Fig.   4c). [score:3]
One hundred nanogram of the plasmid and 10 ng of constitutive Renilla plasmid were co -transfected into SW1353 cells with 50 nM miR-29 mimic, inhibitor or control. [score:3]
However, microRNA-29 expression was not modulated by Wnt3a with no effect on the miR-29a/b1 promoter (data not shown). [score:3]
In other cell lines, NFκB has been shown to act as an inhibitor of miR-29 [52– 54]. [score:3]
Since expression of the miR-29 family is increased immediately post-surgery in the DMM mo del and is increased upon hip cartilage avulsion, this may be a response to injury, a known phenomenon for miRNAs in several areas of physiology and pathology, including cartilage, e. g. [38, 39]. [score:3]
Whilst this shows a correlation with miR-29 expression for IL-1, this is not true for TGFβ1 and LPS. [score:3]
It is moot if the same mechanism(s) increase expression of the miR-29 family in cartilage from end-stage human OA. [score:3]
Expression of primary miR-29b2/c, the precursor and mature miR-29b and miR-29c were significantly repressed by TGFβ1 in monolayer culture. [score:3]
SOX9 repressed expression of miR-29a-3p and miR-29b-3p via the 29a/b1 promoter. [score:3]
Fig. 2Expression of the miR-29 family in chondrocyte differentiation. [score:3]
Wnt3 -induced Axin2 expression was significantly, though minimally, repressed by miR-29 family mimics (Fig.   5c). [score:3]
Expression of the microRNA-29 family in osteoarthritis. [score:3]
b In man, the miR-29 family is expressed from two loci, with the primary miR-29a/b1 on chromosome 7 (the last intron of the primary transcript GenBank accession EU154353) and primary miR-29b2/c on chromosome 1 (the last exon of the primary transcript GenBank accession numbers EU154351 and EU154352) [29]; mature sequences of miR-29a, b and c (3p) have identical seed sequences. [score:3]
Figure 5a shows that TGFβ1 -induced ADAMTS4 expression was repressed by transfection of miR-29 family mimics, verifying the effect on an endogenous gene. [score:3]
The 3’ UTR of all these genes was cloned into a luciferase reporter and co-transfection of the miR-29-3p mimics resulted in significant repression of luciferase expression (Fig.   6a). [score:3]
Factors controlling expression of the miR-29 family. [score:3]
In micromass culture, IL-1 increased expression of all primary and precursor transcripts and the mature miR-29 family (Fig.   4b). [score:3]
Expression of the miR-29 family was highest in human articular cartilage tissue, decreasing with cell passage in monolayer culture. [score:3]
Interestingly, miR-29 gain- and loss-of-function microarray experiments in primary HACs highlighted a number of genes from the Wnt signalling pathway as potential targets of miR-29 in articular chondrocytes. [score:3]
Data were normalised to U6 RNA expression Expression of the miR-29 family was also measured across dedifferentiation of human articular chondrocytes upon serial passage in monolayer culture. [score:3]
Expression of primary miR-29a/b1 and the precursor and mature miR-29a-3p and miR-29b-3p were significantly repressed by TGFβ1 in micromass culture. [score:3]
We performed gain-of-function and loss-of-function experiments to identify miR-29 targets in primary HACs. [score:3]
Human primary chondrocytes were transfected with miR-29-3p family mimics or non -targeting control (50 nM) for 24 h, after culture in low serum (0.5 % v/ v FCS) for 24 h, cells were stimulated with TGFβ1 (4 ng/ml) (a), IL-1β (5 ng/ml) (b) or Wnt3a (100 ng/ml) (c) for 24 h. Gene expression (ADAMTS4 a; MMP3 b; Axin2 c) was measured by qRT-PCR and normalized to 18S rRNA (mean ± SEM, ANOVA, n = 3). [score:3]
In human MSC differentiation to form cartilage discs over 14 days, the miR-29 family decreased in expression to 7 days, returning to starting levels by 14 days (Fig.   2a). [score:3]
This gives a feed forward loop where TGFβ1 reduces levels of miR-29 which are repressing the Smad pathway and therefore allows a greater increase in Smad -dependent gene regulation. [score:2]
Whilst miR-29 expression is not regulated by Wnt3a, we measured the impact of miR-29 on canonical Wnt signalling, using the TOPFlash construct. [score:2]
These data identify the miR-29 family as microRNAs acting across development and progression of OA. [score:2]
Since TGFβ1 regulated expression of the miR-29 family, we measured the Smad 2/3/4 pathway using transient transfection of the p(CAGA) [12]-luc Smad-responsive plasmid. [score:2]
The miR-29 family regulates key signalling pathways. [score:2]
The miR-29 family negatively regulates Smad, NFκB, and canonical Wnt signalling. [score:2]
Fig. 3Regulation of the miR-29 family by TGFβ1. [score:2]
The miR-29 family is regulated by a number of factors known to be important in OA and has a functional impact on several relevant signalling pathways. [score:2]
The expression of miR-29a-3p, miR-29b-3p and miR-29c-3p was increased in osteoarthritis compared to NOF (Fig.   1d). [score:2]
Hence, we investigated the expression of the miR-29 family in a number of mo dels relevant to cartilage and OA and their regulation and function in chondrocytes. [score:2]
Fig. 5Regulation of intracellular signaling pathways by miR-29b-3p. [score:2]
The miR-29 family is regulated by TGF-β1 and IL-1 in chondrocytes. [score:2]
Expression of miR-29b-3p was validated by qRT-PCR in the knee undergoing both DMM and sham surgery compared to un-operated control at day 1 post-surgery (Fig.   1a). [score:2]
There is no simple relationship between regulation of SOX9 by these factors and that of miR-29. [score:2]
Axin2 gene expression in osteoarthritic hip cartilage compared to a fracture control is inversely correlated with that of miR-29 in the same tissue. [score:2]
The miR-29 family negatively regulated Smad, NFκB, and canonical WNT signalling pathways. [score:2]
The 3’ UTR of mRNAs containing the predicted binding site of miR-29-3p were subcloned into pmirGLO (Promega), using QuikChange (Agilent) to introduce mutations. [score:2]
Data from this study have identified a complex interplay between the miR-29 family and key signalling pathways which regulate cartilage homeostasis. [score:2]
Fig. 4Regulation of the miR-29 family by interleukin-1 and LPS. [score:2]
In a mouse mo del of cartilage injury and in end-stage human OA cartilage, the miR-29 family was also regulated. [score:2]
They showed SOX9 negatively regulating miR-29 which allowed an increase in FOXO3A leading to the differentiation of MSC into chondrocytes [37]. [score:2]
Expression of the miR-29 family and SOX9 was measured by qRT-PCR from RNA a obtained from human mesenchymal stem cells induced through chondrogenesis to form cartilage discs at day 0, 3, 7 and 14 (mean ± SEM, ANOVA, n = 6); empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
The action of the miR-29 family in articular chondrocytes. [score:1]
Empty bars, miR-29a; grey bars, miR-29b and black bars, miR-29c. [score:1]
These data show a complex role for the miR-29 family in cartilage homeostasis and OA. [score:1]
Empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
Empty bars, pri-miR29a/b1; light grey bars, pri-miR29-b2/c; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle control. [score:1]
Fig. 1Identification of the miR-29 family in osteoarthritis. [score:1]
TGFβ1 is known to repress the miR-29 family in a number of cell types (e. g. [18, 47], and this is the same in primary chondrocytes. [score:1]
We pursued the relationship between these three factors and the miR-29 family in primary HACs since the literature suggests that this is cell-type specific. [score:1]
Expression of the miR-29 family was measured in human articular cartilage from hip replacement surgery for OA or fracture to the neck-of-femur (NOF, control). [score:1]
The MMP3 gene, which is responsive to NFκB, as well as other transcription factors, was induced by IL-1 and significantly repressed by miR-29 family mimics (Fig.   5b). [score:1]
Fig. 7 A schematic of the role of the miR-29 family in cartilage. [score:1]
The miR-29 family in human and mouse consists of miR-29a, miR-29b (b1 and b2 which are identical mature miRNAs) and miR-29c, with the mature microRNAs differing only in two or three bases. [score:1]
Several of these have been validated, showing the functional capability of miR-29 on this pathway in cartilage. [score:1]
Figure 7 shows the relationships, we have identified amongst cytokines, growth factors and signalling pathways with the miR-29 family. [score:1]
Striped bars, control; empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
The impact of TGFβ1 on miR-29 expression in chondrocytes was investigated in monolayer culture and in three-dimensional micromass culture. [score:1]
In human osteoblasts, miR-29 is induced by canonical Wnt signalling and miR-29 potentiates Wnt signalling, demonstrating the cell type-specific nature of miR-29 function [27, 56]. [score:1]
Empty bars, pri-miR-29a/b1; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle controlThe Wnt pathway has also been implicated in OA [35]. [score:1]
All seed sites of the miR-29 family were altered to non -binding sequences (number of sites shown) to create mutant constructs. [score:1]
However, in both cases, all three mature members of the miR-29 family were repressed. [score:1]
Comparing the operated knee with contralateral control showed two miRNAs increased by DMM surgery >1.5-fold at day 1 (miR-144-3p and miR-29b-3p) and two miRNAs at day 3 (miR-370-5p and miR-21-5p). [score:1]
Empty bars, pri-miR-29a/b1; light grey bars, pri-miR-29b2/c; dark grey bars, pre-miR-29; black bars, mature miR-29, horizontal line at 1, vehicle control. [score:1]
Since the replay of chondrogenesis and altered cell differentiation can contribute to OA [31], expression of the miR-29 family was investigated in appropriate mo dels. [score:1]
Empty bars, pri-miR-29a/b1; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle control The Wnt pathway has also been implicated in OA [35]. [score:1]
Measurement of the miR-29-3p family in this mo del showed a significant increase in expression at 12–48 h post-explantation of cartilage, with a trend to increase for miR-29a and c at 6 h (Fig.   1c). [score:1]
Data were normalised to U6 RNA expressionExpression of the miR-29 family was also measured across dedifferentiation of human articular chondrocytes upon serial passage in monolayer culture. [score:1]
[1 to 20 of 120 sentences]
7
[+] score: 356
In keeping with the findings in mice, ectopic expression of miR-29b inhibited the expression of α-SMA, collagen I, TIMP-1 and p-Smad3 in both HSC cell lines, suggesting that miR-29b negatively regulated fibrosis by targeting the process of collagen matrix synthesis through inhibiting the activation of HSCs. [score:12]
The signaling mechanism through which TGF-β1 regulates miR-29b expression was examined and we revealed that TGF-β1 downregulates miR-29b expression through the mechanism of Smad3. [score:9]
miR-29b inhibits liver fibrosis and suppresses the activation of HSCs through direct targeting PIK3R1 and AKT3. [score:8]
This was confirmed by the downregulation of protein expression of p-Smad3, α-SMA, collagen I and TIMP-1 (Figure 4C), inferring the suppressed activation of HSCs by miR-29b. [score:8]
Ectopic expression of miR-29b remarkably reduced protein expression of PIK3R1, AKT3 and phosphorylated AKT (p-AKT) in both cell lines (Figure 6C), suggesting that PIK3R1 and AKT3 are bona fide targets of miR-29b. [score:7]
miR-29b is downregulated in liver fibrosis and in activated hepatic stellate cells (HSCs) and down-regulation of miR-29b is mediated by Smad3. [score:7]
We found that TGF-β1 down-regulates miR-29b in HSC cells, which was associated with a marked upregulation of p-Smad3 and α-SMA. [score:7]
Introduction of miR-29b resulted in significant downregulation of α-SMA, collagen I and TIMP-1 expression, which is more likely the result of reduced activation of HSCs. [score:6]
Downregulation of miR-29 members has been reported to be implicated in various fibrotic diseases including cardiac fibrosis [17], lung fibrosis [18] and liver fibrosis [19]. [score:6]
In this study, we first determined whether aberrant expression of miR-29b exists in liver fibrosis, and found that miR-29b was significantly downregulated in fibrotic liver tissues from human and rodent mo del, and in activated HSCs. [score:6]
In addition, transduction of miR-29b was able to inhibit the activation of Smad3 both in vitro and in vivo, an important player in fibrogenic pathway, which indicated that miR-29b is not only a downstream target of TGF-β/Smad3 in liver fibrogenesis, but also a negative feedback-regulator of the TGF-β/Smad3 signaling axis in the pathogenesis of liver fibrosis. [score:6]
To verify whether miR-29b directly binds to the 3′-UTR of these candidate genes and causes translational inhibition, we constructed pMIR-report plasmids encoding a firefly luciferase transcript with either wild-type or mutant 3′-UTR of PIK3R1, AKT3, Col1A2 and Col3A1 (Figure 6B). [score:6]
miR-29b is expressed in primary quiescent HSCs, but down-regulated in activated HSCs. [score:6]
In conclusion, miR-29b was downregulated in liver fibrosis and was negatively regulated by Smad3 in vivo and in HSC cells. [score:5]
In particular, we demonstrated by a variety of in vitro and in vivo approaches that phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1) and protein kinase B (AKT3) are direct targets of miR-29b in HSCs responsible for signaling onset of HSCs activation and liver fibrosis. [score:5]
We then searched for the targets of miR-29b by in silico searches using two prediction algorithms miRanda and TargetScan. [score:5]
These results supported the specific inhibitory effect of miR-29b on PIK3R1 expression and AKT3 activation in liver fibrosis. [score:5]
These findings suggest a possible mechanism by which miR-29b suppresses liver fibrosis through negatively regulates PI3K/AKT signaling pathway via direct interaction with PIK3R1 and AKT3. [score:5]
Introduction of miR-29b significantly reduced protein expression of p-Smad3, collagen I, α-SMA and TIMP-1 (Figure 3D), inferring that the anti-fibrosis effect of miR-29b was mediated at least by suppressing genes involved in fibrogenesis (Figure 3E). [score:5]
However, the miR-29b expression showed a time -dependent decrease by TGF-β1 in LX1 cells (Figure 1F), indicating that miR-29b is a potential downstream target of TGF-β/Smad3 signaling. [score:5]
The potential miR-29b binding targets were predicted by TargetScan (www. [score:5]
In this study, we effectively delivered miR-29b plasmid into both normal and disease liver in which higher levels of miR-29b transgene were expressed as detected by in situ hybridization and by real-time PCR without any side effect (Figure 2). [score:5]
Similar down-regulation of miR-29b expression was also observed in activated primary HSCs isolated from the liver of rodent compared to their quiescent phenotype. [score:5]
Moreover, miR-29b dramatically decreased the protein expression of PIK3R1, AKT3 and p-AKT3 in HSC cells and in fibrotic animal mo dels, indicating the translational repression of PIK3R1 and AKT3 by miR-29b (Figure 6C-6D). [score:5]
Whist miR-133a had no inhibition effect on the reporter activity of the mutant 3′-UTR of PIK3R1 and AKT3 (Figure 6B), indicating the direct regulation of miR-29b at the 3′-UTR of PIK3R1 and AKT3 transcripts. [score:5]
Down-regulation of miR-29b is mediated by Smad3. [score:4]
Thus, miR-29b is a downstream target gene of Smad3 in liver fibrosis that is negatively regulated by TGF-β/Smad3 signaling. [score:4]
By chromatin immunoprecipitation (ChIP)-PCR assay, we revealed the directly binding of Smad3 to miR-29b promoter in LX1 cells with TGF-β1 treatment (Figure 1G), indicating that miR-29b is a direct transcriptional target of Smad3 in HSCs. [score:4]
miR-29b inhibits PIK3R1 and AKT3 by direct binding to their 3′-UTR regions. [score:4]
Introduction of miR-29b resulted in significant down-regulation of α-SMA, DDR2, FN1, ITGB1 and PDGFR-β mRNAs (Figure 4B). [score:4]
miR-29b is down-regulated in human fibrotic liver tissues. [score:4]
It has been reported that miR-29b suppresses progression of renal fibrosis by down -regulating tropomyosin 1 and COL2A1 [23]. [score:4]
These findings are consistent with our recent reports in pulmonary fibrosis [16] and in renal fibrosis [15] that Smad3 mediates TGF-β1 -induced downregulation of miR-29b by binding to miR-29b promoter. [score:4]
The molecular mechanisms by which miR-29b exerted its antifibrotic function was by directly inhibiting PIK3R1 and AKT3, causing inactivation of the PI3K/AKT signaling pathway, and ultimately inducting apoptosis of activated HSCs. [score:4]
The induction of apoptosis in HSCs by miR-29b was also observed concomitantly with the inhibition of cellular proliferation, whereby apoptosis was executed by the regulation of casepase-9 and PARP (Figure 5). [score:4]
We have previously reported that miR-29b is a downstream target gene of Smad3 and it is negatively regulated by TGF-β/Smad signaling in renal fibrosis [15]. [score:4]
To induce miR-29b transgene expression, Doxycycline hyclate (Sigma-Aldrich, St. [score:3]
To further define the effect of endogenous transactivation of miR-29b and to understand the functional consequences and molecular basis in liver fibrosis, we examined its direct regulation of HSC biology, a principal mechanism implicated in the antifibrotic effect of miR-29b. [score:3]
Having shown that miR-29b is a crucial mediator in repressing liver fibrosis through suppressing the activation of HSCs, we looked for the possible downstream effectors participating in its function. [score:3]
miR-29b suppresses genes involved in fibrogenesis. [score:3]
The effect of miR-29b on protein expression of PIK3R1, AKT3 and p-AKT was examined in vivo by. [score:3]
Increased expression of miR-29b activated caspase-9, triggering the proteolytic cleavage of the PARP leading to cellular disassembly and apoptosis. [score:3]
If miR-29b plays a key part in liver fibrogenesis, it would be important to establish that its overexpression ameliorated severity of liver fibrosis. [score:3]
Importantly, miR-29b was an antifibrotic factor and ultrasound-microbubble -mediated miR-29b tranduction has prodigious therapeutic potential for liver fibrosis by inhibition of collagen production, stimulation of matrix degradation and repression the activation of HSCs. [score:3]
These findings imply that miR-29b reduces liver fibrosis by mechanisms of reducing the number of HSCs via causing cell cycle arrest and suppressing cell proliferation. [score:3]
Figure 4(A) Ectopic expression of miR-29b in HSC cell lines LX1 and HSC-T6 was confirmed by RT-PCR. [score:3]
Over -expression of miR-29b was confirmed in miR-29b -transfected mice in the liver by real-time RT-PCR (Figure 2C) and by miR-29b in situ hybridization (Figure 2D). [score:3]
Given the crucial role of miR-29b in suppressing liver fibrosis in vivo, we examined whether miR-29b plays any part in modulation of the activation of HSC in vitro. [score:3]
This information highlights the potential therapeutic mechanism and benefit of miR-29b in inhibiting the PI3K/AKT pathway to prevent and treat liver fibrosis. [score:3]
As determined by real-time PCR, miR-29b expression level was significantly lower in fibrotic tissues comparing to the normal liver tissues (P = 0.002) (Figure 1A). [score:3]
In our pilot study, the efficacy of miR-29b delivery to the liver in mice was detected by real-time PCR and consistent miR-29b expression was detected at week 1 and week 2 (Figure 2B). [score:3]
We have recently reported that miR-29b, a negative regulator for the Smad3 and type I collagen is a key regulator in renal fibrosis [15] and pulmonary fibrosis [16]. [score:3]
analysis revealed that miR-29b suppressed the G1-S transition promoter cyclin D1 and induced the G1 gatekeeper P21 [Cip1] (Figure 4G), further confirming the effect of miR-29b in blocking the cell cycle at the G1/S checkpoint. [score:3]
Cell cycle arrest caused by the overexpression of miR-29b was associated with induction of cyclin D1 and p21 [cip1] (Figure 4). [score:3]
To determine the mechanism by which miR-29b inhibited HSC cells proliferation, we examined the effect of miR-29b on cell cycle distribution. [score:3]
The luciferase reporter activity of PIK3R1ang AKT3 was suppressed by wildtype miR-29b. [score:3]
To test this, we used an ultrasound-microbubble -mediated gene transfer to introduce miR-29b into the liver in mice treated with CCl [4. ] We have previously shown that the use of ultrasound-microbubble -mediated gene transfer is able to effectively deliver Dox-inducible miR-29b plasmid into kidney to block activation of TGF-β/Smad signaling, thereby inhibiting progressive renal fibrosis in rat mo del [15]. [score:3]
We first assessed the expression of miR-29b in 20 human liver fibrosis tissues and 13 normal human liver biopsies. [score:3]
In contrast, CCl [4] -treated mice supplemented with miR-29b showed significant reduced expression of PIK3R1, total AKT3 and p-AKT, which paralleled the improvement in histological severity of liver fibrosis (Figure 3A). [score:3]
miR-29b reduces the activation of hepatic stellate cells in vitroGiven the crucial role of miR-29b in suppressing liver fibrosis in vivo, we examined whether miR-29b plays any part in modulation of the activation of HSC in vitro. [score:3]
miR-29b inhibits PIK3R1 and AKT3 in liver fibrosis in mice. [score:3]
As high expression level of miR-29b was demonstrated to last for 3 weeks after a single dose injection in the pilot study, tail vein injection was performed at about 2 and half weeks for 3 times in total in 8 weeks duration. [score:3]
Ectopic expression of miR-29b in LX1 cells caused a significant increase of apoptotic cells (P < 0.05, Figure 5A). [score:3]
Ectopic expression of miR-29b in LX1 led to a significant increase in the G1 phase population (P < 0.01; Figure 4F), and a corresponding reduction in the S phase cells (P < 0.01; Figure 4F). [score:3]
Among the miRNAs predicted to target genes, we revealed for the first time that PIK3R1 and AKT3 act as critical effectors of miR-29b in liver fibrosis. [score:3]
Collectively, our in vitro findings served as a direct evidence for the regulatory role of miR-29b in HSC activation. [score:3]
The Doxycycline-inducible miR-29b expressing plasmids (pTRE2-miR-29b/pTet-on) were transfected into the liver through tail vein injection followed by ultrasound treatment transcutaneously at the liver location (Figure 2A). [score:3]
miR-29b inhibits HSCs proliferation by causing cell cycle arrest in G1 phase. [score:3]
miR-29b inhibits HSC proliferation and arrests cell cycle in G1 phase. [score:3]
As determined by cell viability assay, miR-29b significantly suppressed cell growth in LX-1 and HSC-T6 cells (P < 0.001) (Figure 4D). [score:2]
We evaluated whether the downregulation of miR-29b in liver fibrosis was mediated by Smad3 and their potential interaction. [score:2]
Therefore, the antifibrotic effect of miR-29b in vivo is at least in part due to a decreased accumulation of activated matrix producing HSCs, reduced collagen production as well as increased matrix degradation, thereby blocking fibrosis development (Figure 3E). [score:2]
Moreover, ectopic expression of miR-29b caused a growth arrest in both LX-1 and T6 HSCs as evidenced by cell viability and colony formation assays. [score:2]
To determine whether these findings reflect the regulation of endogenous PIK3R1 and AKT3 by miR-29b, we transiently reintroduced pre-miR-29b into two HSC lines LX1 and HSC-T6. [score:2]
To clarify this hypothesis, an in vitro study on cultured HSCs is warranted to determine the direct effect by which miR-29b protects against fibrosis. [score:2]
In this study, we found a significant decrease in the expression of miR-29b in human and rodent liver fibrotic tissues compared to normal liver tissues. [score:2]
The expression level of mature miR-29b was quantified by TaqMan microRNA assays (Applied Biosystems). [score:2]
The mechanism of miR-29b downregulation in liver fibrosis is therefore evaluated. [score:2]
In keeping with this, protein expression of the active forms of key apoptosis genes including cleaved caspase-9 and cleaved PARP was enhanced in LX-1 cells transfected with pre-miR-29b compared to pre-miR-control by (Figure 5C). [score:2]
The growth suppressive effect of miR-29b in HSC cells was further confirmed by a colony formation assay, which showed the colonies formed in LX1 and HSC-T6 cells transfected with miR-29b were significantly less than those of control cells (Figure 4E). [score:2]
We confirmed the direct interaction of miR-29b in negatively regulating PIK3R1 and AKT3 at their 3′-UTR regions in HSC cells by luciferase activity assay (Figure 6A-6B). [score:2]
We found that miR-29b was abundant in quiescent HSCs, but was significantly decreased in activated HSCs (Figure 1D). [score:1]
The numbers of mice in the different experimental groups were: Olive oil -treated group, 6; CCl [4] -treated group, 8; CCl [4] and empty vector -treated group, 8; and, CCl [4] and pTRE [2]-miR-29b -treated group, 8. was performed using Transcription Factor ChIP kit (Diagenode, Liège, Belgium). [score:1]
We further determined the interaction between Smad3 and miR-29b. [score:1]
LX-1 cells (1×105 cells/well) transiently transfected with pre-miR-29b (20 nM) or miR-control (20 nM) were seeded in 24-well plates. [score:1]
We transduced pre-miR-29b in activated human (LX-1) and rat (T6) HSCs. [score:1]
These data suggested that miR-29b may play a role in liver fibrogenesis and its repression may be associated with HSCs activation. [score:1]
Here we showed that transfection of miR-29b could significantly increase the susceptibility of HSCs to caspase -mediated apoptosis, indicating that apoptosis is an additional mechanism of anti-fibrotic effect of miR-29b in HSCs [22]. [score:1]
Separately, CCl [4] treated mice were introduced with miR-29b using pTRE2-miR-29b-Tet-on plasmid or control vector by tail vein injection, followed by 5 min ultrasound treatment (2W/cm2) transcutaneously on liver location as described in Materials and Methods. [score:1]
We next examined whether introduction of miR-29b by gene transfer could ameliorate CCl [4] -induced liver fibrosis in vivo. [score:1]
miR-29b induces apoptosis in HSCs. [score:1]
Figure 6(A) miR-29b potential binding sites on the 3′-UTR of four candidate genes, PIK3R1, AKT3, Col1A2 and Col3A1. [score:1]
To test this, two activated HSC cell lines (LX-1 and HSC-T6) were transfected with pre-miR-29b or pre-miR-control (Figure 4A). [score:1]
As shown in Figure 3A, significant bridging fibrosis, fibrous septa and cirrhotic nodules were observed in liver sections in mice treated with CCl [4] and transduced with control vector for 8 weeks by Picrosirius red-staining; whilst, transduction of miR-29b caused marked reduction in the distribution of collagen fibers. [score:1]
These findings indicate that miR-29b induces cell death and promotes subsequent proliferative activity in HSCs. [score:1]
Gene transfer of miR-29b prevents CCl4 -induced liver fibrosis in mice. [score:1]
We found that the 3′-UTR of PIK3R1, AKT3, Col3A1 and Col1A2 contain putative binding sites for miR-29b (Figure 6A). [score:1]
miR-29b prevents carbon tetrachloride (CCl4) -induced liver fibrosis in mice. [score:1]
miR-29b transfection in HSCs. [score:1]
LX-1 and HSC-T6 cells (5 × 10 [4]/well) were plated in a 24-well plate and transfected with pre-miR-29b or control RNA. [score:1]
Ultrasound -mediated miR-29b transfer in the liver. [score:1]
Figure 1 (A) Level of miR-29b was significantly lower in human fibrotic liver tissues (n = 20) than in normal liver tissues (n = 13). [score:1]
The functional role and therapeutic potential for miR-29b in liver fibrogenesis were therefore characterized in vivo using an ultrasound-microbubble -mediated miR-29b transfer, and in vitro by overexpression of miR-29b in HSCs. [score:1]
miR-29b reduces the activation of hepatic stellate cells in vitro. [score:1]
miR-29b induces HSC apoptosis. [score:1]
In order to determine whether the observed suppressive effect of cell growth by miR-29b was due to an induction of apoptosis, cell apoptosis was evaluated by Annexin V/7-AAD double staining and flow cytometry. [score:1]
miR-29b precursor (pre-miR-29b) and the miRNA Mimic Negative Control (pre-miR-control) (Ambion Life Technologies, Austin, TX) were transiently transfected into HSCs (LX-1, HST-T6) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) for 48 h and 72 h, respectively. [score:1]
We have previously reported that a Smad response element (TGTCAGTCT) is located at ~22kb upstream of miR-29b, a highly conserved region [15]. [score:1]
In the eight-week CCl [4] -induced liver fibrosis mo del, transduction of miR-29b significantly repressed the severity of hepatic fibrosis as evidenced by reduced collagen deposition and collagen content (Figure 3A-3C). [score:1]
miR-29b inhibited HSC cell growth as determined by cell viability assay, and (E) by colony formation assay. [score:1]
Ultrasound -mediated gene transfer of miR-29b in CCl -induced liver fibrosis in C57BL6 mice. [score:1]
LX1 cells transfected with pre-miR-29b or miR-control were fixed in 70% ethanol-PBS for 24 hours. [score:1]
A mixed solution that contained pTRE2-miR-29b and Tet-on plasmids/Sonovue (Bracco Diagnostics, Princeton, NJ) in the ratio of 1:1 (vol:vol) or the control empty vectors (pTRE2-Tet-on/Sonovue) in 200 μl [15], was co -transfected into the liver through tail vein injection followed by 5 min ultrasound treatment (2W/cm2) transcutaneously at liver location (THERASONIC 450, Electro-Medical Supplies, Greenham, England). [score:1]
However, the biological role of miR-29b in liver fibrosis and its possible contribution acting as a protective factor against liver fibrogenesis remain largely unclear. [score:1]
Two pairs of primers were designed to detect the Smad3-containing promoter region of miR-29b by ChIP-PCR (lower panel) and a direct interaction be Smad3 and miR-29b was demonstrated. [score:1]
We revealed that miR-29b prevents hepatic fibrogenesis in mice by attenuating HSCs activation and inducing HSCs apoptosis. [score:1]
[1 to 20 of 116 sentences]
8
[+] score: 314
In conclusion, we have uncovered 4 lines of evidence that miR-29 activation determines cellular senescence in muscle: 1) an increase in miR-29 significantly up-regulates the senescence marker, SA-βgal, in vivo and in vitro; 2) an increase in miR-29 stimulates the expression of mediators of cell growth arrest, p53, p16 [Ink4A] and pRB, in vivo and in vitro ; 3) an increase in miR-29 suppresses the expression of mediators of cell proliferation, IGF-1, P85α and B-myb; 4) expression of miR-29 in MPCs significantly suppresses their proliferation in vivo and in vitro. [score:14]
The pathway proceeds from activation of Wnt-3 to increase miR-29 expression which acts in a coordinated way to suppress the expression of proteins regulating muscle growth, IGF-1, p85, B-myb and possibly other factors. [score:8]
Expression of miR-29 suppressed the expression of IGF-1 and p85α and B-myb and led to induction of senescence in vivo. [score:7]
In addition, the increases in miR-29 upregulates the expressions of cell arrest proteins, p53 and p16 [Ink4A] in muscle. [score:6]
In the HeLa/E6 cells, miR-29 -induced inhibition of B-myb would block the inhibitor of senescence resulting in the development of cellular senescence [17]. [score:6]
In addition, expression of zip-miR-29 (an inhibitor of miR-29) significantly lowered miR-29 expression levels by about 60% (Figure 2D), and led to a 55% decrease in SA-βgal in zip-miR-29 containing-MPCs compared with miR-29 only (Figure 2C). [score:6]
Park et al. found that in HeLa cells, miR-29 directly binds to the mRNA of p85α, suppressing p85α protein expression [26]. [score:6]
This inhibition response was abolished when miR-29 binding site was mutated, since this mutation (pLuc-3URT [mutant]-p85) prevents miR-29 binding to targets in the mRNA (Figure 4A- black bar). [score:6]
Then they were treated with the empty virus (Ctrl), the miR-29 adenovirus to over-express miR-29 (miR-29) or miR-29 inhibitor (Zip29a or Zip29c). [score:5]
Our results indicate that the increase in miR-29 suppresses IGF-1, p85α or B-myb, resulting in decreased translation of these mediators of cell proliferation and muscle growth. [score:5]
When MPCs were transfected with these vectors, transduction with miR-29 caused an 86% decrease in target 1 luciferase activity; and a 61% decrease in luciferase in cells treated with the second target site vs. [score:5]
To block miR-29 expression in MPCs, vectors that express an antisense of Zip-miR29 (pmiRZip29a plus pmiRZip29c) were transfected into MPCs 4 hours before the Ad-miR-29 or Ad-empty viruses were added. [score:5]
The other bars all show the response of the cells to miR-29 or miR-29 inhibitor (Zip29a or Zip29c) expressed as a percent of the control level for each experiment. [score:5]
To block miR-29 expression in MPCs, vectors that express an antisense of miR-29a+c (pmiRZip29a plus pmiRZip29c) were transfected into MPCs 4 hours before the Ad-miR29 or Ad-empty (Ctrl) viruses were added. [score:5]
Similar to the responses in muscles of aged mice, treatment of MPCs with Ad-miR-29 decreased the expressions of B-myb and p85α but increased the expression of the cellular arrest proteins, p53, p16 and pRB (Supplement 5). [score:5]
miR-29 binds to the 3'-UTR of p85α, IGF-1 and B-myb in MPCs suppressing their translation (luciferase activity). [score:5]
Then they were treated with the empty virus (ctrl), the miR-29 adenovirus (miR29) to over-express miR-29 or miR-29 inhibitor (Zip29a or Zip29c). [score:5]
There was a 25% suppression of Ki67 in MPCs expression of exogenous miR-29 (Figure 2B). [score:5]
In addition, TGF-β reportedly down-regulates miR-29 transcription via an NF-κB pathway. [score:4]
We found that after 3 passages, increased miR-29 expression led to the development of flat cells resembling the “fried eggs” pattern that is indicative of cell senescence (Supplement 4). [score:4]
miR-29 promoter activity was up-regulated by Wnt-3a in MPCs. [score:4]
Our finding that an increase in miR-29 in muscles from aged rodents results in decreased levels of B-myb provides an explanation for the senescence occurring when there is up-regulation of p53 and RB (Figure 6). [score:4]
A decrease in IGF-1 resulting from miR-29 targeting of IGF-1 and the p85α regulatory subunit of phosphatidylinositide 3-kinase (PI3K) could cause an important senescence response in muscle. [score:4]
In addition, miR-29 is down-regulated in a mo del of delayed onset of aging, the Ames dwarf mouse [42]. [score:4]
miR-29 is up-regulated in the liver and muscles of Zmpste24-/- (Hutchinson-Gilford progeria syndrome) mice, a murine mo del of aging [18]. [score:4]
Notably, miR-29 has two binding sites on the 3'-UTR of IGF-1 and it has been determined in a murine osteoblastic cell line, MC3T3-E1, that miR-29 directly targets the 3'-UTR of IGF-1 mRNA during osteoblast differentiation [25]. [score:4]
miR-29 also can influence senescence processes: in HeLa/E6 cells, miR-29 was up-regulated during progression towards cellular senescence [17]. [score:4]
Thus, miR-29 subtypes in muscle are up-regulated by aging in both mice and rats. [score:4]
This would suggest there should be a lower level of miR-29 in muscle and possibly other tissues [51] but we and others have found that miR-29 is consistently up-regulated at least in muscle of aging rodents. [score:4]
For example, a microRNA identified as a regulator of p53 expression could be considered a senescence marker but there are reports that p53 can be regulated by microRNA-20 (miR-20) [13], miR-106a [14], miR-22 [15], miR-33 [16] and miR-29 [17]. [score:4]
We interpret this as an indirect upreglation of miR-29 expression, since Wnt-3a is a signaling protein rather than a transcription factor [52]. [score:4]
To determine if a microRNA can regulate the expression of senescence processes, we studied miR-29 because we and others find that miR-29 is increased in aging skeletal muscle [18, 19]. [score:4]
These observations indicate that Wnt-3a up-regulates miR-29 promoter activity and increase miR-29 production, but does not provide information about direst binding of wnt-3a to the miR-29 promoter [41]. [score:4]
Other recent information indicates that miR-29 can target Akt3 resulting in reduced proliferation with facilitated differentiation of myoblasts into skeletal muscle [50]. [score:3]
The miR-29 has 2 target sites in the 3'-UTR of the IGF-1 mRNA. [score:3]
On day 7 following the electroporation, IGf-1, p85α and B-myb were decreased in the muscles of mice that were over -expressing miR-29 (Figure 3B & C). [score:3]
miR-29 expression in muscles of mice decreases IGF-1, p85α, B-myb but increases cell cycle arrest proteins. [score:3]
Next, we examined the influence of longer term expression of miR-29 by transducing MPCs with the Ad-miR-29 adenovirus. [score:3]
The expression was boosted by adding fresh Ad-miR-29 or Ad-empty when the media was changed every 2 days and at each passage. [score:3]
Others report that c-Myc, Hedgehog and NF-κB transcription factors suppress miR-29 a/b1 promoter activity in cholangiocarcinoma cells [40]. [score:3]
To determine if expression of the IGF-1, p85α and B-myb are affected by miR-29, we examined changes in three firefly luciferase constructs, each containing the 3'-UTR mRNA sequence of IGF-1 or p85α or B-myb. [score:3]
miR-29 expression decreases muscle cell proliferation and induces cellular senescence in MPCs. [score:3]
These results demonstrate that an inhibition of endogenous miR-29 increases the luciferase activity of p85α. [score:3]
miR-29 expression in muscle increases cell cycle arrest proteins and cellular senescence. [score:3]
Left (white bars): the effect of miR-29 on B-myb 3'-UTR; middle (black bar): the effect of miR-29 on mutated B-myb 3'-UTR; right (gray bars): inhibited miR-29 effect on B-myb 3'-UTR. [score:3]
The bar graph shows cells that were positively stained for Ki67 in miR-29 treated cells and are expressed as a percent of the positive cells in the Ad-empty treated cells. [score:3]
Inhibition of endogenous miR-29 by antisense vectors Zip-miR29a or Zip-miR29c produced the increasing in IGF-1 luciferase activity (Figure 4B). [score:3]
However, in aging muscle, an increase in miR-29 results in inhibition of proliferation of muscle progenitor cells (Figure 2B). [score:3]
The other bars all show the response of the cells to miR-29 or zip-miR-29 (indicated below each bar) expressed as a percent of the control level for each experiment. [score:3]
The specificity of this result was confirmed by inhibition of endogenous miR-29 by antisense vectors of miR-29a (Zip-miR29a) or mir-29C (Zip-miR29C). [score:3]
After 7 days, miR-29 expression was increased 12-fold and after 30 days, it was 8-fold higher (Figure 3A). [score:3]
Thus, exogenous miR-29 not only suppresses components of the IGF-1/Akt pathway but also led to a 2.1-fold increase in p53 and a comparable increase in two other cell cycle arrest proteins, p16 [Ink4A] and pRB (Figure 3C). [score:3]
In addition, it was shown that miR-29 can target the 3'-UTR of the mRNA of B-myb (myelo blastosis-related protein B). [score:3]
miR-29 overexpressing muscle. [score:3]
Thus, miR-29 specifically interacts with the 3'-UTR of IGF-1, P85α and B-myb to decrease their expressions. [score:3]
We exposed MPCs to TGF-β or we express NF-κB by transfecting NF-κB p65 subunit into the cells and found 28% (by NF-κB) or 33% (by TGF-β) decrease in miR-29 promoter activity (Figure 5A). [score:3]
Left (white bars): the effect of miR-29 on p85α 3'-UTR; middle (black bar): the effect of miR-29 on mutated p85α 3'-UTR; right (gray bars): the effect of inhibited endogenous miR-29 on p85α 3'-UTR. [score:3]
We overexpressed Wnt-3a in MPCs using a recombinant adenovirus (Ad-Wnt-3a) or added (Methods) to determine if these would activate miR-29 promoter. [score:3]
Inhibition of miR-29 with the antisense vectors led to a 2.7-fold increase in luciferase activity (Figure 4C). [score:3]
Left (white bars): the effect of miR-29 on the two IGF 3'-UTR binding sites (IGF/a or IGF/b); middle (black bars): the effect of miR-29 on mutated (m-) IGF/a or IGF/b; right (gray bars): inhibited endogenous miR-29 effect on IGF/a or IGF/b. [score:3]
Second, we tested whether miR-29 will target IGF-1 in MPCs. [score:3]
Mutation of either of the two binding sites on the 3'-UTR of IGF-1 diminished the miR-29 activation. [score:2]
Notably, miR-29 was among the negative regulators of proliferation. [score:2]
First, we investigated two candidate proteins that have been reported to regulate miR-29 expression in other systems; TGF-β [39] and NF-κB [40]. [score:2]
To determine the impact of miR-29 on muscle metabolism and function in aging, we examined whether miR-29 influences the development of senescence in muscles of aging rodents. [score:2]
There are conflicting views concerning the regulation of miR-29 promoter activity. [score:2]
The proliferation rate was 28% decreased in MPCs cultured with miR-29 overexpressing cells compared to proliferation in cells treated with Ad-empty (P<0.05; Figure 2A). [score:2]
First, we found that the expression of miR-29 (induced by Ad-miR-29) was associated with a 66% decrease in p85α (pLuc-3UTR-p85) luciferase activity compared to results in cells treated with the Ad-empty virus (Figure 4A- white bar). [score:2]
We extended the results to determine if miR-29 acts through regulatory proteins such as IGF-1, p85, and B-myb. [score:2]
To determine what might impact the expression of miR-29 in muscle, we assayed mir-29 promoter activity. [score:2]
Finally, evidence that these responses reflect the development of senescence, we found that the increase in the muscle level of miR-29 at 30 days after electroporation of mmu-miR-29 and this accompanied by an increase in the level of the senescence marker, SA-β-gal (Figure 3E). [score:2]
In addition, miR-29 increases muscle cell senescence was supported by the finding that the senescence marker, SA-βgal. [score:1]
For electroporation, the mimic mmu-miR-29 was injected into the tibialis anterior (TA) muscle [55]. [score:1]
The miR-29 promoter activities were also increased by 2.8-fold in miR-29a/b1 and a 2.3-fold in miR-29c/b2 promoter when MPC cultured in wnt-3a conditional media. [score:1]
Wnt-3a induces miR-29 promoter activation. [score:1]
Second, Kapinas et al. found that Wnt signaling will induce miR-29a transcription activation via an interaction between two TCF/LEF1 (T-cell factor/lymphoid enhancer factor-1) transcription factors which can bind to sites in the miR-29 promoter [41]. [score:1]
By the parametric analysis miR-29b was also significantly increased (Supplement 2) but not when results were analyzed by the volcano plot-Benjamin method. [score:1]
miR-29 has three subtypes, miR29a, b and c. These subtypes are located at different position on the chromosomes. [score:1]
miR-29 was also found to be increased during spontaneous senescence in fibroblasts [17]. [score:1]
There also is a binding site for miR-29 on the 3'-UTR of p85α. [score:1]
Wnt-3a treatment increased miR-29a in time -dependent manner (Figure 5B) as were miR-29b and miR-29c (data not shown). [score:1]
That is, in aging muscle, miR-29 is constantly at a high level, so proliferation is decreased leading to lower MPC levels. [score:1]
These results indicate that miR-29 specifically interacts with the 3'-UTR of p85α and decreases its ability to produce p85α protein. [score:1]
We and others have found that miR-29 stimulates myoblast differentiation into myotubes [47, 48]. [score:1]
Along with miR-29, Wnt-3a is essential for myogenic differentiation. [score:1]
In primary cultured MPCs, miR-29 decreases myo-blast proliferation and induces cellular senescence. [score:1]
There was, however, a consistent increase in miR-29 in aging muscle vs. [score:1]
In addition, we find that miR-29 is maintained at a high level in muscles of aging rodents. [score:1]
How are miR-29 levels increased in muscle of aging rodents? [score:1]
Ad-miR-29). [score:1]
These data indicate miR-29 decreases MPCs proliferation. [score:1]
miR-29 and cellular arrest proteins are increased and IGF-1, p85 and B-myb are decreased in the muscles of aged rodents. [score:1]
This response was abolished when the miR-29 binding site was mutated. [score:1]
The next question is how does the increase in miR-29 that occurs in aging impair cell proliferation? [score:1]
In the current study we show that Wnt-3a stimulates the promoter activity of miR-29. [score:1]
To determine if these miR-29 -induced results in cultured cells occur in vivo, we electroporated tibialis anterior (TA) muscles of young mice with a miR-29 mimic, mouse miR-29 (mmu-miR-29a). [score:1]
In addition, miR-29 can cause apoptosis of cholangiocarcinoma and hepatocellular carcinoma cells [20, 21]. [score:1]
Thus, TGF-β and NF-κB are not responsible for miR-29 changes in aging muscle senescence. [score:1]
To study the impact of miR-29 on muscle cell growth, MPCs were transduced with the Ad-miR-29 adenovirus or Ad-empty (control) and cells cultured in normal growth medium. [score:1]
A recent study concluded that in the aged brain miR-29 was increased and correlates with the reduction of insulin-like growth factor-1 [19] In our study, we found that miR-29 were increased in aged muscle of rodents and related with sarcopenia. [score:1]
miR-29 levels and skeletal muscle mass in aged rodents (Table 1). [score:1]
In contrast, SA-βgal positive cells were sharply increased following transduction with Ad-miR-29 (Figure 2C). [score:1]
Finally, we examined whether Wnt-3a interacts with miR-29 by treating MPCs with and measured miR-29a, b and c expression by qPCR. [score:1]
Figure 4(A) MPCs were transfected with pLuc-ctrl, pLuc-p85α-3'-UTR or pLuc-mutant-p85α (p85α with a mutated 3'-UTR binding site for miR-29). [score:1]
Ad-miR29 only). [score:1]
Even though miR-29 increases differentiation, cell base for this differentiation is inadequate leading to muscle senescence. [score:1]
miR-29 binds to the 3'-UTR of IGF-1, p85α and B-myb. [score:1]
Figure 2(A) MPCs were transduced with Ad-miR-29 or the control adenovirus (Ad-empty). [score:1]
For the promoter construct of miR-29a/b1, the DNA sequence (-1530 to +165) flanking miR-29 transcriptional start site (+1) was ligated into the pGL3 reporter [40]. [score:1]
miR-29 was increased in muscles of both mice and rats and it was associated with the presence of higher levels of cellular arrest proteins and lower levels of cell proliferation. [score:1]
Does miR-29 change in aging senescence? [score:1]
miR-29a and miR-29b1 are clustered on human chromosome 7 and mouse chromosome 6. miR-29c and miR-29b2 are clustered on human and mouse chromosome 1. We used two luciferase reporter construct: PGL3-miR-29a/b1 (DNA sequence: -1530 to +165) and pGL3-miR-29c/b2 (DNA sequence: -4500 to +3) to test miR-29 promoter activity. [score:1]
[1 to 20 of 112 sentences]
9
[+] score: 294
Previous studies found that miR-29b can directly downregulate the translation of Mcl-1, thus inhibiting prostate cancer cells and extrahepatic bile duct cancer cell line tumor progression [16, 17]. [score:9]
Previous studies have found that miR-29b can directly downregulate the translation of Mcl-1; this results in the inhibition of prostate cancer cells and tumor progression in an extrahepatic bile duct cancer cell line [16, 17]. [score:9]
In this study, we have demonstrated that (1) miR-29b expression is downregulated in animal mo dels of PAH induced by hypoxia and (2) Mcl-1 and CCND2 are the target genes of miR-29b. [score:8]
Furthermore, miR-29b inhibits the proliferation and promotes the apoptosis of PASMCs by suppressing the expression of Mcl-1 and CCND2. [score:7]
Cushing et al. found that the miR-29 family is suppressed by transforming growth factor- (TGF-) β1 in human fetal lung fibroblast IMR-90 cells, and many fibrosis -associated genes upregulated by TGF- β1 are depressed by knocking down miR-29b [10]. [score:7]
An analysis of the miRNA expression profiles and target genes in Ewing's Sarcoma revealed that 58 out of the 954 analyzed miRNAs were significantly differentially expressed, including miR-29b [23]. [score:7]
Cushing et al. [10] demonstrated that the miR-29 family is suppressed by transforming growth factor- (TGF-) β1 in human fetal lung fibroblast IMR-90 cells and that many fibrosis -associated genes upregulated by TGF- β1 are depressed following a miR-29 knockdown. [score:7]
Together, these results suggest that miR-29b suppresses proliferation and promotes apoptosis in PASMCs by inhibiting the expression of Mcl-1 and CCND2. [score:7]
Reintroducing miR-29b expression was capable of inhibiting CCND and Mcl-1, which suppressed cellular proliferation and induced apoptosis in PASMCs, respectively. [score:7]
In addition, the expression of miR-29 in several types of cancer also appears to be downregulated. [score:6]
MiR-29b Targets 3′ UTR of Mcl-1 and CCND2 and Inhibits the Expression of Mcl-1 and CCND2. [score:6]
In addition, the expression of miR-29 in both gastric and rhabdomyosarcoma was also shown to be downregulated [11, 12]. [score:6]
A significantly lower expression of miR-29b and a higher expression of the potential target gene Mcl-1 were found in peripheral blood mononuclear cells from acute and chronic myeloid leukemia patients compared with a group of healthy individuals [36]. [score:6]
Hong et al. [19] found that miR-29b was involved in TLR -inhibited GC -induced pDC apoptosis by directly targeting Mcl-1. This supports the theory that miR-29b is a proapoptotic factor. [score:6]
Researchers have found that the introduction of miR-29b in Ewing's Sarcoma (ES) cells could inhibit the c-Myc -mediated up-regulation of CCND2, thus preventing the progression of the cell cycle [15]. [score:6]
For example, researchers found that the introduction of miR-29b in Ewing's Sarcoma cells could inhibit the c-Myc -mediated upregulation of CCND2, which resulted in the prevention of cell cycle progression [15]. [score:6]
In our study, the gene chip showed that miR-29b expression was downregulated in our PAH mice mo del. [score:6]
Merk et al. [38] showed that miR-29b expression was increased in the Marfan ascending aorta during early aneurysm development, and miR-29b oligonucleotide inhibitors prevented early aneurysm formation in Marfan mice. [score:6]
Therefore, miR-29b may have several target genes in PAH and could be involved in a wide range of cell signaling pathways through these target genes. [score:5]
MiR-29b is downregulated in a variety of diseases. [score:5]
MiR-29b has been found to be downregulated in a variety of diseases. [score:5]
The overexpression of miR-29b reduces collagen biosynthesis by inhibiting heat shock protein 47 during wound healing in the skin [14]. [score:5]
To examine whether miR-29b alters the expression of Mcl-1 and CCND2, we performed a Western blot analysis of the PASMCs transfected with the miR-29b mimic, inhibitor, or control. [score:5]
Our results demonstrated a significant downregulation of Mcl-1 and CCND2 in the PASMCs transfected with the miR-29b mimic (Figure 3(c)). [score:4]
However, in a study of spinal cord injury [37], miR-29b was shown to play a repressive role on apoptotic BH3-only genes including Puma, NOXA, Bid, and Bad, but not Mcl-1. The different roles exhibited by miR-29b regarding Mcl-1 expression between this previous study and our report (including previous work by other researchers) indicates a cell-specific regulation of miR-29b regarding apoptosis. [score:4]
We infer that miR-29b downregulates Mcl-1, thereby promoting apoptosis. [score:4]
Since miR-29b directly targets collagen mRNA, it was found to be consistently reduced in both partial nephrectomy and marinobufagenin-infused animals. [score:4]
In our PAH mice mo del, miR-328, miR-210, miR-342, and miR-125 were also downregulated in addition to miR-29b. [score:4]
Here, we performed in vitro and in vivo studies to demonstrate that miR-29b can regulate PASMC proliferation and G1/S transition through targeting CCND. [score:4]
To identify the effectors of miR-29b, a bioinformatic analysis was performed to search for potential regulatory targets of miR-29b. [score:4]
Future studies should focus on the upstream regulation points which influence the expression of miR-29b. [score:4]
Taken together, our work has demonstrated that miR-29b is downregulated in PAH. [score:4]
Moreover, miRNAs from the PA of the mice described above were isolated to analyze the expression of miR-29b. [score:3]
Many researchers have reported that target genes of miR-29b could activate JNK-GATA3, TGF- β, MAPK, and other signal transduction pathways [40– 42]. [score:3]
Previous studies have indicated that miR-29b has a therapeutic effect for many cardiovascular diseases. [score:3]
After silencing Mcl-1, the percentage of apoptosis between the miR-29b mimic, miR-29b inhibitor, and control was also very similar (Figures 4(a) and 4(c)). [score:3]
Results revealed that miR-29b targets 3′ UTR of Mcl-1 (Figures 3(d) and 3(e)) and CCND2 (Figures 3(f) and 3(g)). [score:3]
Among them, the expression of miR-29b was significantly decreased after three weeks (Figure 1(a)). [score:3]
And the percentages were the same as that observed between the miR-29b inhibitor and control. [score:3]
The cells were then transfected with miR-29b mimic, a miR-29b inhibitor, or the negative control (Biotend, Shanghai, China). [score:3]
An in silico analysis of the potential miR-29b targets (http://www. [score:3]
org) revealed that both Mcl-1 and CCND2 are possible targets of miR-29b. [score:3]
Therefore, miR-29b is often used as a tumor suppressor factor, particularly in cancer research [11, 12, 15]. [score:3]
These findings strongly indicate that miR-29b may function as a novel therapeutic target for patients with PAH. [score:3]
Moreover, we sought to elucidate whether miR-29b can influence the proliferation and apoptosis of PASMCs through targeting Mcl-1 and CCND2. [score:3]
A pGL3-luciferase plasmid (Biotend) and Renilla luciferase control plasmid were cotransfected into the cells using a Lipofectamine 2000 (Invitrogen, Waltham, MA) with the miR-29b mimic, inhibitor, or negative control as indicated. [score:3]
The bioinformatic algorithms of the present study predicted that Mcl-1 and CCND2 were the target genes of miR-29b. [score:3]
Furthermore, miR-29b expression was significantly decreased in the pulmonary artery tissues of mice exposed to hypoxia, respectively. [score:3]
Furthermore, after silencing CCND2 expression, the percentage of PASMCs transfected with the miR-29b mimic was 81.21% and 7.78% in the G1 and S phase, respectively (Figures 4(b) and 4(d)). [score:3]
The total apoptosis percentage of the PASMCs transfected with the miR-29b inhibitor was 4.51%, 7.73% lower than that of the control (Figures 2(c) and 2(d)). [score:3]
In the present study, we hypothesized that miR-29b might participate in the vascular remo deling of PAH by targeting Mcl-1 and CCND2. [score:3]
These data indicate that miR-29b inhibits PASMC proliferation by inducing cell cycle arrest at the G1/S phase and increases apoptosis. [score:3]
The percentage of PASMCs transfected with the miR-29b inhibitor in the G1 phase was 40.13%, a value 15.99% lower than that of the controls (Figures 2(e) and 2(f)). [score:3]
MiR-29b Is Downregulated in PAH. [score:3]
Then PASMCs were transfected with a miR-29b mimic or inhibitor, and the effect of miR-29b on the proliferation of PASMCs was examined 48 h and 72 h following the transfection. [score:3]
First, we found that the expression of miR-29b was significantly decreased in PASMCS after 48 h of hypoxia exposure (Figure 2(a)). [score:3]
Mature miR29 expression was normalized to the U6 snRNA. [score:3]
Toyono et al. [13] found that the overexpression of miR-29b decreased extracellular matrix protein production in human corneal endothelial cells. [score:3]
It is also found that miR-29b has an antifibrotic effect on the development of pulmonary fibrosis [39]. [score:2]
The ability of miR-29b to impede PASMC proliferation and apoptosis may be due to its ability to pleiotropically regulate genes in diverse aspects of these processes. [score:2]
In addition, the upstream gene regulation of miR-29b has not been studied. [score:2]
Further we did the luciferase assay to detect if miR-29b targets Mcl1 or CCDN2. [score:2]
A quantitative real-time polymerase chain reaction (qRT-PCR) assay was performed to confirm the expression of miR-29b in the pulmonary artery tissue in hypoxia PHA mice (Figure 1(b)). [score:2]
In contrast, the OD of the PASMCs transfected with the miR-29b inhibitor was significantly increased compared to the negative control -transfected cells (Figure 2(b)). [score:2]
The microarray profile revealed that several miRNAs, including miR-328a, miR-99b, miR-210, miR-342, miR-29b, miR-224, and miR-339, were regulated at different time points. [score:2]
Result revealed that overexpression of miR-29b significantly decreased the OD of the PASMCs compared to the negative controls. [score:2]
To determine if miR-29b regulates the proliferation and apoptosis of PASMCs through Mcl-1 and CCND2, we used siRNA interference against Mcl-1 and CCND2. [score:2]
However, since little is known regarding the mechanism of miR-29b in PAH, we investigated whether Mcl-1 and CCND2 are the direct targets of miR-29b. [score:2]
At that time, we can find a specifically regulated pathway with miR-29b as the center. [score:2]
To access the role of miR-29b in modulating biological functions in PAH, we used PASMCS to do the following study. [score:1]
The limitations of the present study include that we did not analyze the correlation between PAH cases and miR-29b in clinical samples. [score:1]
Therefore, miR-29 replacement therapy may be a novel treatment strategy for Fuchs endothelial corneal dystrophy, aimed at reducing the pathological production of extracellular matrix proteins in the Descemet membrane. [score:1]
If possible, further study of miR-29b changes in the peripheral blood of children with PAH may provide insight into the potential use of miR-29b for diagnosis and as a biomarker of PAH. [score:1]
After transfecting the cells for 48 h, flow cytometry revealed that the percentage of miR-29b mimics in the G1 phase was 73.34%. [score:1]
Figures 3(a) and 3(b) show the sequences of the 3′UTRs of Mcl-1 and CCND2 that represent the binding sites of miR-29b. [score:1]
In this study, we focused on whether miR-29b is capable of reducing PASMC proliferation and promoting apoptosis. [score:1]
The pathogenesis of miR-29b has remained largely unknown. [score:1]
However, studies regarding miR-29b in the pathogenesis of PAH are limited. [score:1]
Cells of same density were seeded into 96-well plates and treated with either the miR29b mimic, inhibitor, or negative control at a final concentration of 100 nM for 48 and 72 h. For the cell proliferation assay, the cells were covered with 100  μL fresh medium and 10  μL of the Cell Counting Kit-8 (CCK-8) Assay Kit reagent (Dojindo, Tabaru, Japan) was added. [score:1]
Taqman probes were used for measuring the mature miR29b and U6 snRNA expression. [score:1]
[1 to 20 of 80 sentences]
10
[+] score: 276
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, mmu-mir-29b-2
Based on the fact that miR-29b target genes were upregulated in 231-S100A7 and downregulated in MCF7-S100A7 cells, we hypothesized that S100A7 differentially regulates miR-29b expression which subsequently affects cell proliferation in MDA-MB-231 and MCF7 cells through modulation of miR-29b target genes. [score:14]
In order to verify this, we first analyzed the expression levels of both mature miR-29b and its two primary microRNAs on chromosome 7 and 1. In agreement with our GFE analysis, we observed that S100A7 overexpression significantly downregulated miR-29b expression in MDA-MB-231 cells and upregulated miR-29b in MCF7 cells, in both mature (miR-29b) and primary (pri-mir-29b-1 and pri-mir-29b-2) forms (Figure  1B, C). [score:13]
Importantly, in agreement with our in vitro cell line data (Figure  1B, C), analysis of TCGA invasive breast cancer patient data [24] showed that S100A7 overexpression in ER [+] patients is more likely to correlate with miR-29b upregulation than ER [−] patients; and S100A7 overexpression in ER [−] patients is more likely to correlate with miR-29b downregulation than ER [+] patients (Additional file 1: Figures S1, S2 and S3). [score:11]
In the present study, we show that S100A7 significantly downregulates the expression of miR-29b in Estrogen Receptor (ER) -positive breast cancer cells (represented by MCF7), and significantly upregulates miR-29b in ER -negative cells (represented by MDA-MB-231). [score:9]
As shown in Figure  1A, miR-29b target genes were significantly enriched in the genes upregulated in 231-S100A7 and also in those downregulated in MCF7-S100A7 cells. [score:9]
miR-29b governs numerous genes’ expression by targeting their 3′ UTRs, leading to both translational suppression and instability of mRNAs. [score:9]
NF-κB has been shown to either directly or indirectly inhibit the expression of miR-29b, which is transcribed from mir-29b-1 on chromosome 7 and mir-29b-2 on chromosome 1 [18, 19]. [score:7]
Hence, with the discovery of S100A7 - miR-29b regulatory route, miR-29b may be potential to serve as an alternative target for S100A7 overexpression in breast cancer treatment. [score:6]
S100A7 downregulates PI3K p85α and CDC42 via targeting of miR-29b to activate and stabilize p53 in MCF7. [score:6]
Transient knockdown of miR-29b with miR-29b inhibitor (antagomir) partially rescued the expression of p85α and CDC42 (Figure  3C, D). [score:6]
By ChIP assay and qRT-PCR, we observed that S100A7 overexpression differentially altered the binding of NF-κB to the promoter of pri-mir-29b-1 and/or the expression of pri-mir-29b-2 suppressor, YY1, in MDA-MB-231 and MCF7 cells (Figure  2D-F). [score:6]
The anti-cancer effect of miR-29b has been shown to be related to its targeting of the 3′ UTRs of multiple key cancer regulators, thus suppressing the growth and metastasis of breast cancer. [score:6]
When we orthotopically injected these cells into nude mice mammary fat pad, miR-29b overexpression repressed S100A7 induced tumor growth of MDA-MB-231 cells (Figure  6A-C), whereas miR-29b knockdown rescued tumor growth from S100A7 suppression in MCF7 cells (Figure  6D, E). [score:6]
The clinical relevance of this was supported by patient data of the TCGA cohort, which showed that S100A7 upregulation is more likely to be associated with increased miR-29b expression in ER [+] breast cancer patients than ER [−] patients and vice versa. [score:6]
We first verified that, in breast cancer cells, inhibiting NF-κB activation with its inhibitor, QNZ, significantly enhanced the transcription of pri-mir-29b-1 and pri-mir-29b-2 (Figure  2A). [score:5]
Moreover, the differential regulation of miR-29b expression was associated with differential regulation of NF-κB activation by S100A7. [score:5]
Interestingly, we observed differential regulation of NF-κB activity by S100A7, which is similar to the differential regulation of miR-29b expression in MDA-MB-231 and MCF7 cells. [score:5]
Reversing the S100A7-caused changes of miR-29b expression by transfecting exogenous miR-29b or miR-29b-Decoy can inhibit the effects of S100A7 on in vitro cell proliferation and tumor growth in nude mice. [score:5]
Both direct and indirect transcriptional regulations by NF-κB led to the differential regulation of miR-29b levels by S100A7, in MDA-MB-231 and MCF7 cells. [score:5]
miR-29b expression has been shown to be inhibited by NF-κB in non-breast cancer cells [18, 19, 25]. [score:5]
It was shown that miR-29b targets p85α and CDC42 and consequently inhibits p53 activation and cell proliferation [22]. [score:5]
In the present study, we showed that S100A7 enhanced NF-κB activity in MDA-MB-231 and inhibited NF-κB activity in MCF7, which then directly and/or indirectly influences miR-29b transcription. [score:5]
S100A7 overexpression induced differential miR-29b expression changes in MDA-MB-231 and MCF7 cells. [score:5]
Moreover, other than regulation of cell proliferation, miR-29b has also been shown to inhibit breast cancer metastasis [16]. [score:4]
We showed that S100A7 induced upregulation of miR-29b in MCF7 cells was able to reduce the level of p85α and CDC42 proteins (Figure  3B). [score:4]
The distinct modulations of the NF-κB – miR-29b – p53 pathway make S100A7 an oncogene in ER -negative and a cancer-suppressing gene in ER -positive breast cancer cells, with miR-29b being the determining regulatory factor. [score:4]
The differential regulation of miR-29b by S100A7 in ER -positive and ER -negative breast cancer is supported by the gene expression analysis of TCGA invasive breast cancer dataset. [score:4]
Among the targets of miR-29b, PI3K p85α and CDC42 have been shown to regulate p53 activation [22]. [score:4]
In addition, we reversed the effects of S100A7 on cell proliferation and tumor growth by overexpressing miR-29b in 231-S100A7 cells and knocking down miR-29b in MCF7-S100A7 cells, which reflected that miR-29b is not only sufficient but also necessary for determining the differential effects of S100A7 in breast cancer cells. [score:4]
In these different types of breast cancer cells, S100A7 differentially regulates NF-κB activation, which then differentially affects miR-29b expression and p53 functions. [score:4]
The binding of NF-κB to the promoter directly suppresses pri-mir-29b-1 transcription (Figure  2B). [score:4]
miR-29b transcription is inhibited by NF-κB, and NF-κB activation is differentially regulated by S100A7 in ER -positive and ER -negative breast cancer cells. [score:4]
We then compared the GFE analysis outcomes of these four sets and discovered a common imprint between MDA-MB-231 and MCF7 that is associated with opposite changes of genes: the expression changes of miR-29b targets. [score:4]
Since large portions of these regulated genes are associated with cell proliferation, miR-29b has been considered as a tumor suppressor in various cancers [14, 15, 19, 27], including breast cancer [16, 17]. [score:3]
Using MCF7, whose miR-29b was more significantly affected by S100A7, we showed that miR-29b targeted PI3K p85α and CDC42, which consequently increased p53 level by enhancing its activation and nuclear translocation. [score:3]
miR-29b is encoded by two genes, mir-29b-1 on chromosome 7 and mir-29b-2 on chromosome 1. It has been shown that NF-κB binds to the promoter of mir-29b-1 and inhibits its transcription [18]. [score:3]
Through bioinformatic analysis and in vitro assays, we found that miR-29b expression was reduced by S100A7 in ER [−] MDA-MB-231 and increased by S100A7 in ER [+] MCF7 cells, which at least partly explained the different roles of S100A7 in regulating proliferation of different types of breast cancer cells. [score:3]
S100A7 can either promote or suppress breast cancer cell proliferation through distinct modulation of the NF-κB – miR-29b – p53 pathway in ER [−] MDA-MB-231 and ER [+] MCF7 cells, respectively (summarized in Figure  7). [score:3]
Among the targets of miR-29b, PI3K p85α and CDC42 have been shown to be closely related to cancer growth [22, 31, 32]. [score:3]
And reversing miR-29b changes can suppress the effects of S100A7 in these cells. [score:3]
It has been reported that miR-29b activates p53 through targeting the 3′ UTR of the oncogenes, PI3K p85α and CDC42 [22] (Figure  3A). [score:3]
Figure 3 miR-29b targets p85α and CDC42, and determines the effects of S100A7 on p53 activation and stability in different cells. [score:3]
Training sets from microarray data are indicated by heat maps, and percentage of miR-29b targets are indicated with pie charts with significance of enrichment analysis. [score:3]
Directly, NF-κB can bind to the promoter of mir-29b-1 to block its transcription. [score:2]
Prolonged knock down of miR-29b by miR-29b-Decoy transfection reduced p53 activation in MCF7-S100A7 (Figure  3E). [score:2]
S100A7 induced differential regulation of miR-29b is important for its differential effects on cell proliferation of MDA-MB-231 and MCF7 in vitro and their tumor growth in vivoTo verify the importance of miR-29b in determining the differential effects of S100A7, we stably transfected 231-S100A7 and MCF7-S100A7 cells with exogenous miR-29b and miR-29b-Decoy, respectively, to reverse the changes of miR-29b caused by S100A7 (Figure  5A, C). [score:2]
To our knowledge, the distinct regulation of NF- κB - miR-29b by S100A7 is shown for the first time. [score:2]
Figure 1 S100A7 differentially regulates miR-29b transcription and NF-κB activation in MDA-MB-231 and MCF7 cells. [score:2]
In the present study, we described a novel role of the NF-κB – miR-29b – p53 pathway, which defines the distinct effects of S100A7 on regulating cell proliferation and tumor growth of ER [−] and ER [+] breast cancer. [score:2]
Figure 2 S100A7 differentially regulates miR-29b transcription in MDA-MB-231 and MCF7 cells. [score:2]
miR-29b has been considered a strong tumor suppressor in multiple cancers. [score:2]
miR-29b real-time PCR assay kit and miR-29b inhibitor were purchased from Life Technologies (Carlsbad, CA). [score:2]
miR-29b transcription is differentially regulated by S100A7 via NF-κB in MDA-MB-231 and MCF7. [score:2]
S100A7 induced differential regulation of miR-29b is important for its differential effects on cell proliferation of MDA-MB-231 and MCF7 in vitro and their tumor growth in vivo. [score:2]
miR-29b is considered to be a tumor suppressor in multiple types of cancers [14, 15], including breast cancer [16, 17]. [score:2]
Figure 7 Proposed mechanism of differential regulations of NF-κB – miR-29b – p53 pathway by S100A7 in different types of breast cancer cells. [score:2]
We intended to find out whether S100A7 affected miR-29b transcription via regulating NF-κB activation in MDA-MB-231 and MCF7. [score:2]
These data showed that S100A7 differentially regulates miR-29b transcription in ER [−] and ER [+] breast cancers. [score:2]
Figure 6 miR-29b determines the effects of S100A7 on tumor growth of MDA-MB-231 and MCF7 cells. [score:1]
Brian Brown (Mount Sinai School of Medicine) for sharing their miR-29b plasmids, thank the Division of Biomedical Informatics Cincinnati Children’s Hospital Medical Center for providing their bioinformatic engine “ToppGene”, thank Grace Amponsah for experimental assistance. [score:1]
Figure 5 Manipulating miR-29b could counteract the effects of S100A7 on cell proliferation in MDA-MB-231 and MCF7. [score:1]
231-S-miR-29b cell was generated by stably transfecting pcDNA3-miR29b plasmid shared by Dr. [score:1]
This showed that NF-κB activity was inversely correlated with miR-29b transcription in breast cancer cells. [score:1]
miR-29b-Decoy. [score:1]
231-V and 231-S-miR-29b are not significantly different. [score:1]
pri-mir-29b-1 promoter contains three NF-κB binding sites. [score:1]
The S100A7 induced proliferation increase in MDA-MB-231 was repressed by exogenous miR-29b (Figure  5B), and the decrease of proliferation in MCF7 was also partially rescued by miR-29b-Decoy (Figure  5D, 1: Figure S5). [score:1]
231-V and 231-S-miR-29b are not significantly different, neither are MCF7-V and MCF7-S-miR-29b-Decoy. [score:1]
This dramatic rise of miR-29b led to a significant increase of p53 phosphorylation, nuclear translocation (Figure  3E-G, 1: Figure S4) and total p53 protein level (Figure  3H) in MCF7-S100A7 cells. [score:1]
To verify the importance of miR-29b in determining the differential effects of S100A7, we stably transfected 231-S100A7 and MCF7-S100A7 cells with exogenous miR-29b and miR-29b-Decoy, respectively, to reverse the changes of miR-29b caused by S100A7 (Figure  5A, C). [score:1]
This demonstrated that miR-29b functions downstream of S100A7 and is important in determining the differential effects of S100A7 in breast cancer cells. [score:1]
Thus, it is suggested that miR-29b may be paired with S100A7 to serve as more accurate biomarkers for breast cancer diagnosis and prognosis. [score:1]
Breast cancer Cell proliferation S100A7 miR-29b p53 The inflammatory protein S100A7 (Psoriasin) was discovered as a marker of human psoriasis lesion [1, 2]. [score:1]
Thus, we confirmed that miR-29b is the determining factor of the differential effects of S100A7 in ER [−] and ER [+] breast cancer cells. [score:1]
MCF7-S-miR-29b-Decoy cell was generated by stably transfecting AB. [score:1]
[1 to 20 of 75 sentences]
11
[+] score: 259
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Klotho expression in elderly ICR miceThe upregulation of miR-29 members was seen in elderly ICR mice as well as klotho(−/−) mice lacking klotho expression; this raised the question of whether klotho might influence the expression of the miR-29 members, although klotho is predominantly expressed in kidney, and hardly expressed in other tissues including heart, lung and liver. [score:14]
The upregulation of miR-29 members was seen in elderly ICR mice as well as klotho(−/−) mice lacking klotho expression; this raised the question of whether klotho might influence the expression of the miR-29 members, although klotho is predominantly expressed in kidney, and hardly expressed in other tissues including heart, lung and liver. [score:12]
Taken together, the miR-29 upregulated in elderly tissues may work as a mediator in RNA degradation of target transcripts as well as in translation inhibition, which is the primary function of miRNAs. [score:10]
Target genes of miR-29 Target genes controlled by the miR-29 upregulated in elderly mice may be also involved in natural aging. [score:8]
The target sequences synthesized in the construction were as follows: For the target of miR-29a; Sense-strand; 5′- TCGAGTAACCGATTTCAGATGGTGCTATTACTAGT-3′ Antisense-strand; 5′- ACTAGTAATAGCACCATCTGAAATCGGTTAC-3′ For the target of miR-29b; Sense-strand; 5′- TCGAGAACACTGATTTCAAATGGTGCTATTACTAGT-3′ Antisense-strand; 5′- ACTAGTAATAGCACCATTTGAAATCAGTGTTC-3′ The reporter plasmid and the pSV-β-Galactosidase control vector (Promega) as a control were administered to young (5-week-old) and elderly (8∼18-month-old) ICR mice by a hydrodynamic delivery method. [score:7]
Interestingly, the upregulation of miRNAs was seen in major tissues of elderly ICR as well as klotho(−/−) mice except for the klotho(−/−) brain [10]; thus, miR-29 upregulation may be a common event associated with aging. [score:7]
Accordingly, it is conceivable that the miR-29 members spontaneously upregulated in elderly mice may have gradually contributed to such gene silencing (regulation) of target genes. [score:7]
The miR-29 upregulated in elderly individuals may be closely related to natural aging, and this raises the possibility that upregulation of miR-29 may be encoded as a genetic program associated with aging. [score:7]
Previous in vitro studies using cultured mammalian cells indicated that miR-29 is associated with cellular senescence: the miR-29 members were upregulated during cellular senescence in cultured mammalian cells [21], and appeared to be directly and indirectly engaged in gene regulation of cellular senescence-related B-Myb and p53 genes, respectively [22]– [25]. [score:7]
The target sequences synthesized in the construction were as follows:For the target of miR-29a;Sense-strand; 5′- TCGAGTAACCGATTTCAGATGGTGCTATTACTAGT-3′ Antisense-strand; 5′- ACTAGTAATAGCACCATCTGAAATCGGTTAC-3′ For the target of miR-29b;Sense-strand; 5′- TCGAGAACACTGATTTCAAATGGTGCTATTACTAGT-3′ Antisense-strand; 5′- ACTAGTAATAGCACCATTTGAAATCAGTGTTC-3′ The reporter plasmid and the pSV-β-Galactosidase control vector (Promega) as a control were administered to young (5-week-old) and elderly (8∼18-month-old) ICR mice by a hydrodynamic delivery method. [score:7]
In the current study using outbred ICR mice, we found that the miR-29 members were upregulated in elderly ICR mice although there were more or less individual differences in the degree of their upregulation. [score:7]
Target genes controlled by the miR-29 upregulated in elderly mice may be also involved in natural aging. [score:6]
To examine the knockdown potencies of endogenous miR-29a and miR-29b in vivo, we constructed reporter genes with the psiCheck2 vector (Promega): the Renilla luciferase gene carrying the complementary (target) sequence of miR-29a or miR-29b in the 3′ untranslated region was constructed as described previously [14]. [score:6]
Together with the results of Figs. 1 and 3, the findings suggest that the introduced synthetic miR-29b can enhance in vivo gene silencing against its target genes such as Col4α, Dnmt1 and Cabin1 even in young (5-week-old) ICR mice in which the endogenous miR-29 is expressed at a low level. [score:5]
To further confirm the effects of miR-29 on the expression of its target genes in vivo, we administered a synthetic miR-29b duplex or siControl duplex to 5-week-old (young) ICR mice. [score:5]
To address this, the luciferase reporter genes carrying the complementary (target) sequences of miR-29a and miR-29b, respectively, in their 3′ untranslated regions (3′UTRs) were constructed (Fig. 2), and administered to elderly and young ICR mice by a hydrodynamic delivery method. [score:5]
In vivo gene silencing mediated by synthetic miR-29b To further confirm the effects of miR-29 on the expression of its target genes in vivo, we administered a synthetic miR-29b duplex or siControl duplex to 5-week-old (young) ICR mice. [score:5]
Therefore, miR-29 expression is probably unaffected by klotho expression levels. [score:5]
The constructed reporter plasmid carrying the miR-29a or miR-29b target sequence (Fig. 2A) and the β-galactosidase expression plasmid as a control were systemically administrated to young (5-week-old: 5w) and elderly (8∼18-month-old: ≈1 y) ICR mice by a hydrodynamic delivery method. [score:5]
The normalized expression levels of the reporter gene carrying either the miR-29a or miR-29b target sequence was markedly decreased in elderly kidney than in young kidney (Fig. 3). [score:5]
We searched for candidate gene targets of miR-29 using the TargetScan program (http://www. [score:5]
In vitro gene silencing mediated by synthetic miR-29 To verify whether the gene silencing mediated by miR-29 could influence the regulation of type IV collagen gene expression, we introduced synthetic miR-29a (miR-29a mimic) or miR-29b (miR-29b mimic) into mouse Neuro2a (N2a) cells and examined their effects on gene silencing against endogenous type IV collagen and other genes (Fig. 6A). [score:4]
Upregulation of miR-29 in elderly ICR mice. [score:4]
To verify whether the gene silencing mediated by miR-29 could influence the regulation of type IV collagen gene expression, we introduced synthetic miR-29a (miR-29a mimic) or miR-29b (miR-29b mimic) into mouse Neuro2a (N2a) cells and examined their effects on gene silencing against endogenous type IV collagen and other genes (Fig. 6A). [score:4]
Therefore, miR-29 upregulation in elderly kidney may result in the enhancement of gene silencing mediated by it. [score:4]
In this study we examined miRNAs in normal elderly ICR mice as well as in klotho(−/−) mice, a senescence-mo del animal, and the findings revealed that the miR-29 members were upregulated in both elderly and senescence-mo del mice. [score:4]
Upregulation of miR-29 in elderly ICR miceTo see if normal aged-mice, like klotho(−/−) mice, have a similar increase in the expression of miR-29, we measured miR-29a and miR-29b in outbred ICR mice at age 14 or 18 months (14 m, 18 m; elderly mice) and 1 month (1 m; young mice) by means of RT-qPCR; note that five different individual ICR mice in each group were examined to account for individual differences. [score:4]
From the FC analysis, the miR-29 members (miR-29a, -29b and -29c) appear to be commonly upregulated in klotho(−/−) mice (Table 1). [score:4]
As with previous studies, our current study indicate that the type IV collagen (Col4α1–α6) genes are potential targets of miR-29. [score:3]
Statistically significant decrease in the expression of genes in the miR-29b -treated mice is indicated by * (p<0.05). [score:3]
miR-29a and miR-29b expression in young and elderly ICR mice. [score:3]
A similar decreasing tendency of the expression of Dicer1 and Lamc1 in liver and kidney of the miR-29b -treated ICR mice was also detected (Fig. 6C). [score:3]
Gene expression profiles in miR-29 -treated N2a cells and young ICR mice. [score:3]
Figure S3 Gene expression profiles in miR-29 -treated HEK293 cells. [score:3]
The target sequences of miR-29a and miR-29b are indicated in the 3′UTRs. [score:3]
The miR-29a, miR-29b and snoRNA202 (as a control) expressions were examined and analyzed by the delta- delta Ct method. [score:3]
Target genes of miR-29. [score:3]
If the results are positive, the miR-29 members and also their target Col4α1–α6 genes could become useful molecular markers of general senescence. [score:3]
We further investigated whether the upregulated miR-29 members in elderly mice enhanced their mediated knockdown activities. [score:3]
0048974.g001 Figure 1 miR-29a and miR-29b expression in young and elderly ICR mice. [score:3]
The normalized miR-29a and miR-29b expression levels in the young (gray bars) and elderly (red bars) groups in each tissue were further examined by Student's t-test, and significant differences between the two groups in all the tissues examined were detected (* P<0.05, ** P<0.01). [score:3]
While, the transcription attenuation of Col4α1–α6 may be a major cause of the reduction of type IV collagen in elderly tissues, our findings suggest another contribution of miR-29 to the suppression of type IV collagen. [score:3]
The psiCheck2-backbone reporter plasmid encoding the Renilla luciferase gene carrying the target sequence of miR-29a (psiCheck2-miR29a) or miR-29b (psiCheck2-miR29b) was constructed. [score:3]
Taken together, multiple senescence -associated genes may be regulated by the miR-29 members, and a gene regulatory network may participate in the progression or signs of aging. [score:3]
0048974.g006 Figure 6Gene expression profiles in miR-29 -treated N2a cells and young ICR mice. [score:3]
Therefore, these findings indicate that the gene silencing mediated by miR-29 suppressed type IV collagen, Dicer1 or Lamc1, each of which carries a putative binding site(s) of miR-29, and that RNA degradation may partially contribute to the gene silencing. [score:3]
0048974.g003 Figure 3 In vivo knockdown potency mediated by endogenous miR-29a or miR-29b. [score:2]
In vivo knockdown potency mediated by endogenous miR-29a or miR-29b. [score:2]
RT-qPCR analyses indicated a significant decrease in the expression of some of the Col4α genes in liver and kidney of the miR-29b -treated mice compared with the siControl -treated mice (Fig. 6B). [score:2]
RT-qPCR analyses indicated that: (i) levels of Col4α1 and Col4α2 were significantly reduced by introduction of either miR-29a mimic or miR-29b mimic relative to the negative control, (ii) levels of calcineurin binding protein 1 (Cabin1) and DNA methyltransferase 1 (Dnmt1) genes carrying no putative binding sequence of miR-29 remained almost unchanged, and (iii) levels of Dicer1 and laminin, gamma 1 (Lamc1) genes carrying a putative binding site for miR-29 decreased in the presence of the miR-29 mimic. [score:1]
Figure S4 Cell viability of HEK293 cells treated with miR-29 mimics. [score:1]
Further studies on the relationship between miR-29 and the aging process need to be carried out. [score:1]
To each well, 20 nM (final concentration) of each MISSION microRNA mimic of has-miR-29a, has-miR-29b, or negative control miRNA (Sigma-Aldrich) was transfected into the cells using Lipofectamine2000 transfection reagent (Invitrogen) according to the manufacturer's instructions. [score:1]
To see if normal aged-mice, like klotho(−/−) mice, have a similar increase in the expression of miR-29, we measured miR-29a and miR-29b in outbred ICR mice at age 14 or 18 months (14 m, 18 m; elderly mice) and 1 month (1 m; young mice) by means of RT-qPCR; note that five different individual ICR mice in each group were examined to account for individual differences. [score:1]
MISSION microRNA Mimic (Sigma-Aldrich) has-miR-29a (mimic_29a), has-miR-29b (mimic_29b) or negative control miRNA (negative_miR) was transfected into N2a cells. [score:1]
The miR-29 mimics (mimic_29a and mimic_29b) and a negative control miRNA (negative_miR) were transfected into N2a cells as in Fig. 6A. [score:1]
Systemic administration of the synthetic miR-29b duplexThe synthetic miR-29b duplex and siControl (non-silencing siRNA; QIAGEN, Venlo, Netherlands) were each prepared with atelocollagen (AteloGene Systemic Use; KOKEN, Tokyo, Japan) according to the manufacturer's instructions. [score:1]
In the current study, the miR-29-administered N2a and HEK293 cells appeared to be weakened (Fig. 8 and Fig. S4); this might reflect cellular senescence triggered by an increase in the amount of miR-29 in the cells. [score:1]
Systemic administration of the synthetic miR-29b duplex. [score:1]
Thus, miR-29 appears to be involved in the reduction of type IV collagen transcripts and other gene transcripts carrying putative binding sites for miR-29. [score:1]
Additionally, previous studies with cultured mammalian cells suggest a significant association between miR-29 members and the type I or type IV collagen genes [18]– [20]. [score:1]
The miR-29 mimics (mimic_29a and mimic_29b) and a negative control miRNA (negative_miR) were transfected into HEK293 cells as in Figure S3. [score:1]
The sequences of the synthetic miR-29b duplexes were as follows: Sense- strand; 5′- UAGCACCAUUUGAAAUCAGUGUU-3′ Antisense-strand; 5′- CACUGAUUUCAAAUGGUGUUAUU-3′ Neuro2a (N2a), a mouse neuroblastoma cell line originally established by RJ Kleber and FH Ruddle (1969) [15], was used in this study. [score:1]
Normal ICR mice (5-week-old) were subjected to four systemic administrations (Day 1, 4, 8, and 12) of miR-29b duplex or siControl (as a negative control). [score:1]
0048974.g008 Figure 8Cell viability of N2a cells treated with miR-29 mimics. [score:1]
In vitro gene silencing mediated by synthetic miR-29. [score:1]
The synthetic miR-29b duplex and siControl (non-silencing siRNA; QIAGEN, Venlo, Netherlands) were each prepared with atelocollagen (AteloGene Systemic Use; KOKEN, Tokyo, Japan) according to the manufacturer's instructions. [score:1]
Cell viability of N2a cells treated with miR-29 mimics. [score:1]
The results of the qPCR analysis consistently indicated that the levels of either miR-29a or miR-29b were significantly higher in elderly mouse tissues than in young tissues (Fig. 1). [score:1]
For assessment of the knockdown potency of miR-29a or miR-29b, the constructed reporter plasmids (see above) together with or without synthetic miR-29 duplexes were transfected into N2a cells, and 24 hour after transfection the dual luciferase assay was carried out as described previously [14]. [score:1]
The type IV collagen gene family is composed of the Col4α1, Col4α2, Col4α3, Col4α4, Col4α5 and Col4α6 genes, encoding the α1, α2, α3, α4, α5 and α6 chains of type IV collagen, respectively; and the genes carry putative binding sequences of the miR-29 members in their 3′UTRs. [score:1]
The reporter plasmids indicated were transfected together with synthetic miRNA mimics of miR-29a (mimic_29a), miR-29b (mimic_29b) or a negative control miRNA (negative_miR) into N2a cells. [score:1]
Finally, miR-29 may be a common miRNA coupled to the progression of aging in various tissues, and may have a key role in senescence. [score:1]
In vivo gene silencing mediated by synthetic miR-29b. [score:1]
Plasma samples were prepared from young (5-week-old; 5w) and elderly (8∼18-month-old: ≈1 y) ICR mice and also from miR-29b- and siControl (siCont) -treated ICR mice (5-week-old), and then subjected to plasma biochemical tests. [score:1]
[1 to 20 of 75 sentences]
12
[+] score: 258
miR-29b inhibitor decreased miR-29b expression level without affecting miR-29a and miR-29c expressions (Fig. 4a), which suggests that the miR-29b inhibitor used in this study is specific to miR-29b. [score:9]
We provide direct evidence that miR-29b is commonly upregulated in five different mo dels of skeletal muscle atrophy, including muscle atrophy induced by denervation, Dex, fasting, ageing and cancer cachexia, indicating that upregulation of miR-29b might be a common driver of muscle atrophy. [score:8]
In addition, in myotubes differentiated from C2C12, treatment with TNF-α or H [2]O [2] neither decreased myotube diameter or creatine kinase activity, nor induced the expression of Atrogin-1 and Murf-1, when miR-29b expression was inhibited (Supplementary Fig. 4). [score:7]
Similarly, decreased miR-29 was reported to suppress myogenesis in chronic kidney disease by targeting YY1 (ref. [score:7]
Besides that, to explore if the upregulation of miR-29b in denervation was specific in gastrocnemius muscles or it was a more generalized process, we checked miR-29b expression level in other muscles after denervation including tibialis anterior (TA), soleus and extensor digitorum longus (EDL), and found that it was consistently elevated in all these denervated muscles (Supplementary Fig. 1g). [score:6]
To further assess if IGF-1 and PI3K(p85α) mediate the pro-atrophy effect of miR-29b, either IGF-1 or PI3K(p85α) overexpression plasmid was used to upregulate IGF-1 or PI3K(p85α) in the presence of miR-29b mimic. [score:6]
To exclude the possibility that the above results achieved by miR-29b mimic might not be physiologically relevant, we also used miR-29b overexpression plasmid that increased miR-29b expression by 3.39-fold, and found that myotube diameter was reduced while Atrogin-1 and Murf-1 were elevated (Supplementary Fig. 3). [score:5]
A single intramuscular injection of miR-29b sponge in gastrocnemius muscle significantly inhibited miR-29b expression (Supplementary Fig. 9e). [score:5]
The mimic negative control, miR-29b mimic, inhibitor negative control and miR-29b inhibitor were bought from RiboBio. [score:5]
miR-29b mimic increased miR-29b expression level by 157-fold, without affecting miR-29a and miR-29c expressions (Fig. 3a), which confirms that the miR-29b mimic used in this study is specific to miR-29b. [score:5]
miR-29b sponge was able to decrease miR-29b expression level in the gastrocnemius without affecting miR-29a and miR-29c expressions (Fig. 9a). [score:5]
miR-29b overexpression reduced myotube diameter, elevated Atrogin-1 and Murf-1, decreased MHC and induced expressions of some autophagy-related genes (Map1-lc3b, Atg7, Atg12, Bnip3, Gabarapl1, Cathepsinl, Bnip3l and Vps34) and other ubiquitin ligases-related genes (Mul1, Traf6, Znf216, Cblb and Nedd4) (Fig. 3b–e). [score:5]
Conversely, transfection with miR-29b inhibitor resulted in increased expression of IGF-1 and PI3K(p85α) (Fig. 5b). [score:5]
We found that IGF-1 or PI3K(p85α) overexpression could attenuate the pro-atrophy effect of miR-29b, as determined by myotube diameter and the expression levels of Atrogin-1 and Murf-1 (Fig. 6). [score:5]
In conclusion, miR-29b contributes to multiple types of muscle atrophy via targeting of IGF-1 and PI3K(p85α), and that suppression of miR-29b may represent a therapeutic approach for muscle atrophy induced by different stimuli. [score:5]
miR-29 has been reported to function as a positive regulator of myogenesis through feedback inhibition of the transcription factor YY1 (ref. [score:4]
Thus, YY1 might probably trigger the upregulation of miR-29b and contribute to muscle atrophy. [score:4]
This suggests that IGF-1 and PI3K(p85α) are both direct targets of miR-29b. [score:4]
We thus investigated if miR-29b upregulation in denervation was specific in gastrocnemius muscles or it was a more generalized process, and we found that miR-29b was consistently elevated in all tested muscles including gastrocnemius, TA, soleus and EDL, further demonstrating that miR-29b is a common target for muscle atrophy. [score:4]
Together, these data suggest that miR-29b is ubiquitously upregulated in muscle atrophy mo dels both in vitro and in vivo, indicative of a potential functional role of miR-29b in this process. [score:4]
Moreover, the other relevant targets of miR-29b in regulating atrogenes, fibre type and autophagy pathways should also be identified in the future. [score:4]
In fully differentiated C2C12 myotubes, miR-29b inhibitor was used to determine its role in regulating muscle size. [score:4]
To further explore the regulation of miR-29b in muscle atrophy, we examined its expression level in myotubes differentiated from C2C12 or primary myoblasts treated with Dex. [score:4]
Yin Yang 1 triggers the upregulation of miR-29b. [score:4]
Mutation in the miR-29b target site was generated by PCR from the plasmid PGL3-3′UTR of IGF-1 or PI3K (p85α). [score:4]
Knockdown of IGF-1 by siRNAs did not change the expression level of miR-29b (Fig. 7a), indicating that the synergistic pathway is unlikely existent. [score:4]
Besides that, we also confirmed that the upregulation of miR-29b in immobilization -induced muscle atrophy was a generalized process as it was consistently increased in TA, soleus, and EDL (Supplementary Fig. 9d). [score:4]
These results suggest that miR-29b can regulate endogenous IGF-1 and PI3K(p85α) expression levels in skeletal muscle cells. [score:4]
In addition, in myotubes differentiated from primary myoblasts, miR-29b overexpression also elevated Atrogin-1 and Murf-1, and decreased myotube diameter (Fig. 3f–h). [score:3]
IGF-1 and PI3K(p85α) are identified as two target genes of miR-29b. [score:3]
To investigate the time course of miR-29b expression in denervated muscles, we checked its expression level at 3, 5, 7 and 14 days after denervation and found that miR-29b was induced at day 5 and maintained at higher levels after (Supplementary Fig. 1f). [score:3]
miR-29b contributes to muscle atrophy in vivoTo characterize the in vivo relevance of overexpressing miR-29b, we used miR-29b agomir to increase the expression level of miR-29b in mouse gastrocnemius muscles (Fig. 8 and Supplementary Fig. 7). [score:3]
Based on bioinformatics analysis and further experimental validation, IGF-1 and PI3K(p85α) were identified as two target genes of miR-29b in myotubes. [score:3]
Besides that, the downstream effectors (from IGF-1) were determined and we found that the phosphorylations of AKT (Ser-473), FOXO3A (Ser-253), mTOR and P70S6K were decreased by miR-29b mimic while all these phosphorylations were increased by miR-29b inhibitor, though the phosphorylations of AKT (Thr-308), FOXO3A (Thr-32) and 4EBP1 were not modulated (Fig. 5c,d). [score:3]
Of note, miR-29b decreased phosphorylation of FOXO3A at serine-253 and thus induced Atrogin-1 and Murf-1 expressions, leading to muscle atrophy. [score:3]
In addition, we determined miR-29b expression level in two other in vitro mo dels of muscle atrophy, including treatment of myotubes differentiated from C2C12 with TNF-α and H [2]O [2], in which miR-29b was increased (Supplementary Fig. 2). [score:3]
Our functional experiments in myotubes confirmed that suppression of IGF-1 and PI3K(p85α) was responsible for the pro-atrophy effect of miR-29b in myotubes. [score:3]
Similarly, miR-29b inhibitor also attenuated Dex -induced atrophy in myotubes differentiated from primary myoblasts (Fig. 4d). [score:3]
To investigate the mechanism by which miR-29b promotes muscle atrophy, we used the bioinformatic tool TargetScan to identify putative targets of miR-29b. [score:3]
Inhibition of miR-29b was not able to promote muscle hypertrophy in basal conditions, while it could abrogate the pro-atrophy effect of Dex stimulation (Fig. 4b,c). [score:3]
Using this approach, we could increase miR-29b level by 2.5-fold without affecting miR-29a and miR-29c (Fig. 8a), with corresponding decrease in the targets as noted above (Supplementary Fig. 7h,i). [score:3]
Despite that investigators have demonstrated the presence of common atrophy genes that are coordinately regulated in several mo dels of atrophy, few studies have examined the role of miRNAs that were ubiquitously altered, and perhaps played a central role in mo dels of atrophy 1. Here we report that miR-29b is commonly upregulated in multiple types of muscle atrophy. [score:3]
Most importantly, miR-29b was able to induce muscle atrophy in vivo while inhibition of miR-29b attenuated denervation- and immobilization -induced muscle atrophy. [score:3]
These results indicate that controlling IGF-1 and PI3K(p85α) expression is at least partly responsible for how miR-29b promotes muscle atrophy. [score:3]
miR-29 has also been demonstrated to impair muscle progenitor cell proliferation, increase cell cycle arrest protein levels, and induce cellular senescence in ageing muscle by targeting PI3K(p85α), IGF-1 and B-myb 44. [score:3]
In addition, we found that the phosphorylations of AKT (Ser-473), FOXO3A (Ser-253), mTOR and P70S6K were decreased by miR-29b mimic while all these phosphorylations were increased by miR-29b inhibitor. [score:3]
Similarly, the decrease in gastrocnemius weight, diameter of muscle fibres and increase in Atrogin-1 and Murf-1 expression levels in denervated muscles were also attenuated in mice injected with miR-29b sponge (Fig. 9c,e,f). [score:3]
These data demonstrate that suppression of miR-29b has anti-atrophy effect and could at least partly attenuate muscle atrophy. [score:3]
To characterize the in vivo relevance of overexpressing miR-29b, we used miR-29b agomir to increase the expression level of miR-29b in mouse gastrocnemius muscles (Fig. 8 and Supplementary Fig. 7). [score:3]
IGF-1 and PI3K(p85α) are target genes of miR-29b. [score:3]
As immobilization of limbs is a common clinical procedure for orthopaedic medicine, we also explored the role of miR-29b inhibition in muscle atrophy induced by immobilization of limbs. [score:3]
Interestingly, in denervation mice injected with miR-29b sponge, expression levels of IGF-1, PI3K(p85α) and the downstream (from IGF-1) effectors in gastrocnemius muscles were increased compared to control (Supplementary Fig. 8). [score:2]
YY1 negatively regulates miR-29b in muscle atrophy. [score:2]
To explore what triggers the upregulation of miR-29b, we firstly investigated whether a synergistic pathway that was controlled by the same IGF-1–AKT signalling was existent in a feed-forward loop to enhance protein degradation. [score:2]
Interestingly, in mice injected with miR-29b agomir, expression of IGF-1, PI3K(p85α) and the downstream (from IGF-1) effectors in gastrocnemius muscles were decreased compared to control (Supplementary Fig. 7h,i). [score:2]
We found that knockdown of Yy1 by siRNAs increased miR-29b level in C2C12 myotubes (Fig. 7b). [score:2]
Collectively, our findings illustrate that miR-29b is both necessary and sufficient for muscle atrophy in vitro. [score:1]
miR-29b agomir (2′OME+5′chol modified) and negative control agomir (2′OME+5′chol modified) (RiboBio) were used. [score:1]
miR-29b controls muscle atrophy in vitro. [score:1]
In comparison, miR-29b sponge injections led to a 44.8% reduction in denervation -induced muscle atrophy as determined by the ratio of gastrocnemius weight to body weight (Fig. 9c,d). [score:1]
miR-29b is necessary for muscle atrophy in vitro. [score:1]
In a parallel manner, transfection of miR-29b mimic into C2C12 myotubes resulted in decreased protein levels of IGF-1 and PI3K(p85α) (Fig. 5b). [score:1]
Nevertheless, it would be highly interesting to investigate in vivo therapeutic roles for miR-29b targets individually or together based on gain-of-function and loss-of-function experiments. [score:1]
Here we observed that miR-29b was necessary and sufficient to promote muscle atrophy in in vitro mo dels of muscle atrophy, including myotubes differentiated from C2C12 treated with Dex, TNF-α and H [2]O [2] and from primary myoblasts treated with Dex. [score:1]
miR-29b controls muscle atrophy in vitroIn fully differentiated C2C12 myotubes, miR-29b mimic was used to determine its role in promoting muscle atrophy. [score:1]
miR-29b sponge injections in mice. [score:1]
miR-29b is increased in multiple types of muscle atrophy. [score:1]
How to cite this article: Li, J. et al. miR-29b contributes to multiple types of muscle atrophy. [score:1]
miR-29b is increased in multiple types of muscle atrophy in vivo. [score:1]
To investigate whether inhibiting miR-29b attenuates muscle atrophy, we treated mice with intramuscular injection of miR-29b sponge, followed by denervation of the right sciatic nerve. [score:1]
The sequence of pre-miR-29b was obtained from the NCBI, and the gene fragment was obtained by PCR. [score:1]
miR-29b is sufficient to induce muscle atrophy in vivo. [score:1]
Collectively, our data suggest that miR-29b is sufficient and necessary for multiple types of muscle atrophy. [score:1]
The corresponding base pairs for miR-29b sponge regions (forward: 5′-GATCCAACATGATTTTTTATGGTGCTACCGAACATGATTTTTTATGGTGCTAGCGAACATGATTTTTTATGGTGCTAC-3′; reverse: 5′-TCGAGTAGCACCATAAAA AATCATGTTCGCTAGCACCATAAAAAATCATGTTCGGTAGCACCATAAAAA ATCATGTTG-3′) for miRNA interference were designed and cloned into the FUGW cloning vector. [score:1]
miR-29b is increased in multiple types of muscle atrophy in vitro. [score:1]
We further explored the atrophic fibre-type induced by miR-29b agomir, and consistently found that all types of fibres underwent atrophy as determined by SDH staining and qRT–PCR analysis of Myh7, Myh2, Myh4, Myh1 encoding myosin isoforms MyHC-I, MyHC-IIa, MyHC-IIb and MyHC-IIx/d (refs 29, 30) (Fig. 8f,g). [score:1]
In fully differentiated C2C12 myotubes, miR-29b mimic was used to determine its role in promoting muscle atrophy. [score:1]
Besides that, although denervation significantly increased denervation markers including Musk, Achra, Achre, Achrg, Cpla2, Ncam and Runx1, miR-29b agomir only slightly elevated Achre and Cpla2 while other denervation markers were at largely unaffected (Supplementary Fig. 7f,g). [score:1]
Importantly, we found that IGF-1, PI3K(p85α) and the downstream (from IGF-1) effectors were all decreased in the in vitro muscle atrophy mo dels and miR-29b agomir could decrease them in vivo, providing some insights of their potential roles in muscle atrophy in vivo. [score:1]
It is interesting that miR-29b can induce senescence and atrophy. [score:1]
These results support the hypothesis that miR-29b is necessary for muscle atrophy. [score:1]
miR-29b is necessary for muscle atrophy in vivo. [score:1]
The sequences of pre-miR-29b were ligated into Fugw. [score:1]
All mice were euthanized 5 days later and miR-29b sponge significantly decreased miR-29b level (Fig. 9b). [score:1]
miR-29b contributes to muscle atrophy in vivo. [score:1]
miR-29b is sufficient to induce muscle atrophy in vitro. [score:1]
Of the four validated miRNAs in denervated muscles, only miR-29b was found to be elevated in each of the in vivo atrophy mo dels (Fig. 1f–i). [score:1]
In the absence of miR-29b sponge, denervation decreased the ratio of gastrocnemius weight to body weight by 20.6%. [score:1]
Thus, these data indicate that the increase of miR-29 is able to induce muscle atrophy in vivo. [score:1]
Among them, miR-212, miR-29b, miR-21 and miR-221 were confirmed to be increased in both rat and mouse denervated gastrocnemius muscles (Fig. 1e). [score:1]
IGF-1 and PI3K(p85α) reduce miR-29b -induced muscle atrophy. [score:1]
Muscle atrophy was induced by immobilization of limbs as evidenced by decreased gastrocnemius weight and gastrocnemius weight/body weight ratio, and elevated Atrogin-1 and Murf-1, accompanied with an increase of miR-29b (Supplementary Fig. 9a–c). [score:1]
Notably, miR-29b was increased in both mo dels (Fig. 2). [score:1]
miR-29b agomir injections in mice. [score:1]
Thus, miR-29b appears to be sufficient to promote muscle atrophy in vitro. [score:1]
[1 to 20 of 95 sentences]
13
[+] score: 258
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Concomitantly, DR3 siRNA treatment resulted in an inhibition of TNFSF15-stimulated miR-29b up-regulation (Figure 4C), as well as the inability of TNFSF15 to inhibit VEGF gene expression at mRNA level (Figure 4D). [score:10]
These findings indicate that miR-29b down-regulation of VEGF expression leads to inhibition of angiogenesis in this animal mo del. [score:8]
Carrying out computational miRNA target analysis, we identified sequences in the 3'-untranslated region of the VEGF gene (VEGF3′UTR) that are complementary to the sequences of miR-29b, suggesting that VEGF be a molecular target for miR-29b. [score:7]
DR3 mediates TNFSF15- stimulate activation of GATA3, up-regulation of miR-29b and down-regulation of VEGF. [score:7]
DR3 mediates TNFSF15-stimulated activation of GATA3, up-regulation of miR-29b and down-regulation of VEGF. [score:7]
The experimental data from this study indicate that DR3 is also involved in mediating TNFSF15 activity in miR-29b up-regulation and VEGF down-regulation through the activation of JNK signaling pathway, offering a mechanism underlying the promotion of miR-29b by TNFSF15. [score:7]
Involvement of JNK signaling pathway in TNFSF15-facilitated GATA3 and miR-29b up-regulation and VEGF down-regulation. [score:7]
In summary, the results of this study bring forward insights into a mechanism through which the down-modulation of VEGF gene expression can be achieved via TNFSF15-DR3 -mediated activation of the JNK-GATA3 signaling pathway that leads to miR-29b upregulation. [score:6]
TNFSF15 up-regulates GATA3 expression, which promotes miR-29b production to silencing VEGF. [score:6]
These findings indicate that DR3 is responsible for mediating TNFSF15 activities that lead to the activation of GATA3, the up-regulation of miR-29b and, consequently, the down-modulation of VEGF gene expression in bEnd. [score:6]
TNFSF15 up-regulates VEGF -targeting miR-29b in bEnd. [score:6]
Additionally, we demonstrate that DR3, the cell-surface receptor for TNFSF15, mediates the stimulation of miR-29b expression by activating the JNK signaling pathway, which leads to the activation of transcription factor GATA3 that promotes miR-29b expression. [score:5]
We also show that TNFSF15 activates the JNK signaling pathway to promote the activation of transcription factor GATA3, which drives the expression of miR-29b, thus the inhibition of VEGF production. [score:5]
These findings support the view that TNFSF15 activates JNK signaling pathway to promote the expression of GATA3, which drives the expression of miR-29b. [score:5]
These data, which are in good agreement with those obtained with JNK inhibitor SP600125, demonstrated an critical role for JNK in the modulation of TNFSF15-stimulalted expression of GATA3 and miR-29b. [score:5]
To determine whether miR-29b directly targeted to VEGF 3′UTR, we constructed luciferase reporter with WT and point mutations VEGF 3′UTR (WT3′UTR and Mut3′UTR) for miR-29b. [score:5]
3 with GATA3 siRNA (160 pmol/mL) prior to TNFSF15 treatment, and found that GATA3 gene silencing prevented the TNFSF15-stimulation of up-regulation of miR-29b (Figure 3D). [score:4]
For transient down-regulaton of miR-29b, cells were transfected with 100 nM anti-miR-29b or anti-Ctr, according to the manufacturer's instructions. [score:4]
MicroRNA-29b is known to be involved in the down-regulation of VEGF [30, 31], We found that miR-29b level in bEnd. [score:4]
3 cells also led to an up-regulation of miR-29b (Figure 2D). [score:4]
To determine whether the up-regulation of GATA3 and miR-29b was mediated by DR3, the cell surface receptor for TNFSF15, we treated bEnd. [score:4]
JNK signaling is involved in TNFSF15-stimulated GATA3 and miR-29b up-regulation. [score:4]
As an alternate approach to examine the significance of JNK for TNFSF15-stimulated GATA3 and miR-29b up-regulation, we silenced the JNK gene by using a siRNA molecule that recognizes a common sequence in both JNK1 and JNK2 from both mice and humans [37]. [score:4]
We also found that JNK siRNA effectively prevented TNFS15 -induced miR-29b up-regulation (Figure S1B). [score:4]
The lentivector stably knockdown miR-29b (Zip-miR-29b) expression contained the following shRNA sequence: 5'- GATCCGTAGCACCATGAAATCAGTGTTTCAA GAGAACACTGATTTCAAATGGTGCTACTTTTTTG- 3'. [score:4]
Additionally, SP600125 treatment effectively prevented TNFS15 -induced miR-29b up-regulation (Figure 5E). [score:4]
3-miR-29b cell line and up-regulated in bEnd. [score:4]
These data indicate that miR-29b directly interact with VEGF 3′UTR, repressing VEGF expression. [score:4]
These findings indicate that GATA3 activation by TNFSF15 is necessary in miR-29b up-regulation. [score:4]
We then generated stable miR-29b overexpression cells with lentivirus encoding miR-29b or a scrambled miRNA control and miR-29b knockdown cells using miR-Zip29b lentivirus (Figure 2I). [score:4]
3 cells in order to inhibit miR-29b, we found that the cells were more capable of tubule formation (Figure 6C, 6D). [score:3]
3 cells with miR-29b mimics, and found that the miR-29b mimics markedly inhibited bEnd. [score:3]
F. Relative expression of miR-29a, miR-29b and miR-29c in vehicle- or TNFSF15 -treated bEnd. [score:3]
showed a significant decrease in VEGF protein level after treatment with the miR-29b mimic, while inhibition of miR-29b by anti-miR-29b increase VEGF protein levels (Figure 2H). [score:3]
To determine whether GATA3 was required for miR-29b expression, we treated bEnd. [score:3]
miR-29b inhibits angiogenesis in vitro and in vivo. [score:3]
On the other hand, when we overexpressed anti-miR-29b in bEnd. [score:3]
Since it is known that transcription factor GATA3 promotes miR-29b expression in other types of cells [30], we treated bEnd. [score:3]
This is achieved by TNFSF15-stimulated expression of miR-29b, which marks VEGF mRNA for destruction. [score:3]
TNFSF15 enhances GATA3 expression to promote miR-29b production. [score:3]
The results indicated that miR-29b overexpression led to a marked reduction of bEnd. [score:3]
Analysis of blood vessel densities of the three groups by counting the number of red blood cell-containing blood vessels confirmed the ability of miR-29b to inhibit angiogenesis in this mo del (Figure 6H). [score:3]
3 cells, miR29b overexpressing cells were much less capable of forming blood vessel, whereas removal of miR-29b by Zip-miR-29b facilitated blood vessel growth (Figure 6J). [score:3]
The transduction efficiency was monitored by qPCR for the miR-29b expression. [score:3]
For transient overexpression of miR-29b, cells was transfected with 50 nM miR-29b or miR-Ctr using Lipofectamine 2000 (#11668-019, Invitrogen, Carlsbad, CA, USA). [score:3]
The GFP -expressing lentivectors encoding miR-29b or Zip-miR-29b, miR-control and polybrene were purchased from GenePharma (Shanghai, China). [score:3]
Furthermore, inhibition of miR-29b by Zip-miR-29b led to more than a doubling of the ability of bEnd. [score:3]
We report here that TNFSF15 is able to stimulate in endothelial cell the production of a microRNA, miR-29b, whose targets include VEGF mRNA. [score:3]
MiR-29b inhibits angiogenesis in vitro and in vivo. [score:2]
We therefore reasoned that TNFSF15 regulates VEGF through miR-29b. [score:2]
For 3'-untranslated region (3'-UTR) assays, human embryonic kidney cell line 293T cells were co -transfected with miR-Ctrl or miR-29b mimics (50 nM final concentration), firefly luciferase reporter constructs containing WT or mutated 3'-UTR of VEGF using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA), and a renilla luciferase reporter vector to normalize the transfection efficiency. [score:2]
We found that co-transfection of miR-29b and WT3′UTR in human embryonic kidney cell line 293T cells resulted in repressed luciferase activity; co-transfection of an unrelated miRNA had little effect (miR-Ctr). [score:1]
E. Sequences of miR-29a, miR-29b, and miR-29c; Seed sequence and the complementary binding sites are in green. [score:1]
3-Zip-miR-29b (c, f); scale bar for images of Matrigel plugs (a, b, and c): 2 mm; scale bar for H&E-stained cross-sections: 5 μm (d, e and f). [score:1]
3 cells transfected with miR-Ctrl or miR-29b mimics on Matrigel in 24 hrs after seeding; scale bar, 100 μm. [score:1]
3 cells transfected with anti-Ctrl or anti-miR-29b mimics in 24 hrs after seeding; scale bar, 100 μm. [score:1]
3-miR-29b cells, bEnd. [score:1]
Presence of 4-3H in the culture media prevented TNFSF15 from stimulating miR-29b levels (Figure 2C). [score:1]
In addition, to determine the impact of miR-29b on the ability of bEnd. [score:1]
3 cells infected with lentivirus encoding miR-ctr, miR-29b or miR-Zip29b. [score:1]
3 cells transduced with lentivirus encoding miR-ctr, miR-29b or Zip-miR-29b, respectively, were resuspended on ice in phenol red-free Matrigel solution and implanted into female C57BL/6J mice by s. c. injection (200 μL) in the abdominal region. [score:1]
Values are normalized to β-actin D. Changes of miR-29b levels in response to TNFSF15 treatment in the presence or absence of GATA3 siRNA (160 pmol/mL), determined by RT-PCR. [score:1]
H. Quantitative analysis of blood vessel densities in H&E-stained sections of miR-control or miR-29b or Zip-miR-29b plugs. [score:1]
3-miR-29b cell line and bEnd. [score:1]
C. Changes in miR-29b levels in TNFSF15 -treated bEnd. [score:1]
D. Average lengths and areas of the capillary-like tubules formed by anti-Ctrl or anti-miR-29b mimics -transfected cells. [score:1]
C. Changes of miR-29b levels in response to TNFSF15 treatment in the presence or absence of DR3 siRNA (40 pmol/mL). [score:1]
B. Changes in miR-29b levels following TNFSF15 treatment at indicated concentrations. [score:1]
3 cells increased by 2-times within 24 hrs of TNFSF15 treatment (Figure 2A), and the increase of miR-29b was dose -dependent (Figure 2B). [score:1]
Co-transfection of miR-29b and Mut3′UTR, abolished the repression of luciferase activity (Figure 2G). [score:1]
3-Zip-miR-29b group increased by 2.5-fold by the same comparison (Figure 6K, 6L). [score:1]
3 cell to migrate, we infected the cells with Lentivirus-linked miR-29b vector. [score:1]
3 transfected with miR-29b and anti-miR-29b mimics. [score:1]
3-Zip-miR-29b cell line. [score:1]
E. Changes of miR-29b levels following TNFSF15 treatment (24 hrs) in the presence or absence of SP600125 (50 μM). [score:1]
I. Relative levels of miR-29b in bEnd. [score:1]
The miR-29 family consists of three members, miR-29a, -29b and -29c, with the same seed sequence (Figure 2E) [30]. [score:1]
F. Quantitative analysis of the numbers of migrated cells transfected with miR-control, miR-29b or Zip-miR-29b. [score:1]
In agreement with a previous report that GATA3 is able to induce the production of miR-29b by enhancing the activity of the miR-29b promoter [30], we demonstrate in this study that silencing the GATA3 gene results in an abrogation of TNSF15 -induced miR-29b up-modulation and subsequent VEGF down-modulation. [score:1]
3 cell were seeded in six-well plates (2×10 [5] cells per well) and incubated overnight, then transduced with lentiviral supernatants containing lentiviral vectors coding for the miR-29b, Zip-miR-29b, or miR-control, respectively, and 5μg/mL polybrene at room temperature for 24 hrs. [score:1]
To further demonstrate the impact of miR-29b on VEGF, we transfected miR-29b and anti-miR-29b mimics into bEnd. [score:1]
G. Regulation of VEGF by miR-29b was confirmed by luciferase reporter and mutagenesis assays. [score:1]
In addition to that of miR-29b, intracellular levels of miR-29a in bEnd. [score:1]
I. Fluorescent confocal microscopic images of frozen sections of Matrigel plugs from miR-control or miR-29b or Zip-miR-29b groups; red, CD31; green, GFP; blue, DAPI; yellow, CD31-GFP double positive; scale bar, 25 μm. [score:1]
3 cells stably transfected miR-control or miR-29b mimics, anti-control or anti-miR-29b mimics were seeded (3×10 [4] cells/well) on top of the solidified Matrigel and incubated at 37°C for 24 hrs. [score:1]
3 infected with lentivirus encoding miR-ctr, miR-29b or miR-Zip29b, determined by RT-PCR. [score:1]
Scramble miRNA mimics (miR-Ctr, #24), miR-29b mimics (miR-29b, #miR10000127), scramble anti-miRNA mimics (anti-Ctr, #22) and anti-miR-29b mimics (anti-miR-29b, #miR20000127) were purchased from Ribobio (Guangzhou, China). [score:1]
3-Zip-miR-29b cells, or bEnd. [score:1]
3-miR-29b (b, e), or bEnd. [score:1]
MiR-29b inhibits angiogenesis in vitro and in vivoTo investigate the effect of miR-29b modulation on angiogenesis, we transfected bEnd. [score:1]
B. Average lengths and areas of the capillary-like tubules formed by miR-Ctrl or miR-29b mimics transfected cells. [score:1]
[1 to 20 of 91 sentences]
14
[+] score: 255
Conversely, inhibition of mTORC1 signaling resulted in up-regulation of miR-29 expression and suppressed MCL-1 expression in cardiomyocytes. [score:12]
Moreover, since DM is associated with either insulin deficiency or a lack of insulin signaling, we also posited that insulin would suppress the expression of the miR-29 family in cardiomyocytes and up-regulate MCL-1 expression. [score:10]
Data presented here shows that insulin down-regulates the expression of diabetic marker miR-29 family miRNAs in mouse cardiomyocytes and preserves the expression of cardioprotective MCL-1. Consistent with this insulin effect, 11-week old hyperinsulinemic ZDF rats only had a mild loss of MCL-1 expression and did not show any damage in myocardium. [score:10]
Conversely, inhibition of mTORC1 signaling by Rap or inhibitors of mTORC1 substrates significantly increased expression of miR-29 family miRNAs and suppressed cardioprotective MCL-1 in mouse cardiomyocytes. [score:9]
Since MCL-1 is a target of miR-29 family miRNAs, and Rap treatment increases miR-29 expression, we investigated whether a miR-29 inhibitor cocktail (inhibitors of miR-29a, b and c) would improve MCL-1 expression in Rap treated HL-1 cells. [score:9]
Since miR-29 suppresses MCL-1 and the miR-29 family miRNAs are elevated in DM we hypothesized that one of the mechanisms by which DM promotes heart disease is by causing dysregulation of the miR-29-MCL-1 axis and suppressing MCL-1 levels in cardiomyocytes that can lead to cardiomyocyte disorganization. [score:8]
B) Expression of miR-29 family miRNAs (miR-29a, b and c) in mouse cardiomyocyte HL-1 cells is suppressed by treatment with INS (100 nM; 12 h) and up-regulated by treatment with Rap (10 nM; 12 h). [score:8]
Transfection of HL-1 cells with miR-29 inhibitor cocktail reversed Rap -mediated suppression of MCL-1 expression. [score:7]
analysis using anti-MCL-1 antibody showed that Rap treatment substantially suppressed MCL-1 expression in HL-1 cells transfected with Allstars negative control siRNA, but not in HL-1 cells transfected with miR-29 inhibitor cocktail (Fig. 2D). [score:7]
We have shown in vitro that a miR-29 inhibitor cocktail could reverse Rap -mediated suppression of MCL-1 protein expression in cardiomyocytes. [score:7]
Since increased expression of different members of miR-29 family is associated with DM, we tested the effects of insulin that attenuates the progression of DM, and rapamycin (Rap) that promotes the progression of DM, on the expression of miR-29 family miRNAs in HL-1 cells. [score:5]
We undertook this study to uncover the role of microRNA miR-29 family and its target MCL-1, a pro-survival molecule that is critical for cardiomyocyte survival under stress, in the myocardium damage seen in diabetic heart disease. [score:5]
However, suppression of hyperinsulinemia by Rap in the absence of regulation of hyperglycemia as seen in Rap -treated ZDF rat promotes severe dysregulation of cardiac miR-29-MCL-1 axis that leads to disruption and loss of myofibril bundle organization. [score:5]
This would have led to the up-regulation of all miR-29 family miRNAs in their heart tissues that resulted in the severely dysregulated miR-29-MCL-1 axis in Rap -treated ZDF rats. [score:5]
Since Rap-treatment increased miR-29 levels and suppressed MCL-1 mRNA levels in mouse HL-1 cardiomyocytes, we tested whether Rap-treatment would increase cardiac miR-29 family miRNAs and suppress cardiac MCL-1 mRNA even further in young ZDF rats. [score:5]
Further studies are needed to also confirm that in in vivo rodent mo dels a miR-29 inhibitor cocktail would improve cardiac MCL-1 protein expression. [score:5]
Insulin treatment strongly suppressed miR-29a, b and c in cardiomyocytes whereas Rap treatment significantly enhanced expression levels of all three miR-29 family members in HL-1 cardiomyocytes (Fig. 1B). [score:5]
20 nM of miR-29 inhibitor cocktail (mirVana miRNA inhibitors for miR-29a, b and c) or 20 nM Allstars negative siRNA (Qiagen) was used for transfection. [score:5]
Though rapamycin has well-established cardioprotective effects, an additional increase in miR-29 family miRNAs due to mTORC1 inhibition in the heart tissues of DM patients can potentially suppress MCL-1 and exacerbate cardiomyocyte disorganization and cardiac damage. [score:5]
D) staining with anti-MCL-1 antibody and nuclear stain DAPI in HL-1 cells transfected with either (a) Allstars negative siRNA and (b) Allstars negative siRNA and treated with Rap (10 nM), or (c) miR-29 inhibitor cocktail (mirVana miRNA inhibitors for miR-29a, b and c) and treated with Rap (10 nM). [score:5]
Since insulin suppressed miR-29 in HL-1 cardiomyocytes, we posited that insulin would improve expression of MCL-1 in these cells. [score:5]
In brief, the suppression of miR-29 expression by insulin could be a previously unidentified cardioprotective mechanism in hyperglycemia. [score:5]
Regulation of miR-29 target MCL-1 by insulin and rapamycin in mouse cardiomyocytes. [score:4]
This observation implied that miR-29 family miRNAs regulate MCL-1expression in HL-1 cardiomyocytes. [score:4]
Though 11-week old ZDF rats had a mild dysregulation of miR-29-MCL-1 axis that resulted in about 45% suppression of MCL-1, no visible differences were observed in the histopathology of the RV tissues between ZL and ZDF rats. [score:4]
These data suggested that a miR-29-MCL-1 axis, similar to that seen in mouse and human pancreatic β-cells [15] exists in mouse cardiomyocytes and it is regulated by insulin and rapamycin, an mTORC1 inhibitor. [score:4]
We only observed a mild dysregulation of miR-29–MCL-1 axis at this stage and a 45% suppression of MCL-1 mRNA (Figs. 3I and 3J). [score:4]
Therefore, dysregulation of miR-29-MCL-1 axis caused by loss of insulin and mTORC1 inhibition is a major factor in promoting myocardial damage in DM in ZDF rats. [score:4]
Collectively, our data shows the steps in the dysregulation of miR-29-MCL-1 axis in heart tissues during the progression of DM as shown in Fig. 6. Briefly, at the age of 11 weeks, healthy ZL rats show basal level expression of miR-29 and MCL-1 and their myocardium is well organized. [score:4]
miR-29 family miRNA expression pattern. [score:3]
RAP for miR-29 a, b, and c. The role of the miR-29-MCL-1 axis in the progression of DM -associated heart disease is not known. [score:3]
Since we observed that insulin could suppress miR-29 family miRNAs in cardiomyocyte HL-1 cells, it is conceivable that the lack of significant increase in miR-29c in the myocardium of 11-week old ZDF rats despite severe hyperglycemia could be due to their compensatory hyperinsulinemia (a 14-fold increase in plasma insulin). [score:3]
Expression of all three miR-29 family miRNAs (a, b and c) were significantly higher (at least 2 fold for each miRNA) in ZDF myocardium. [score:3]
Though insulin treatment could induce phosphorylation of S6K1 rapidly, in this study we chose a 12 hr treatment to be consistent with the treatment time used for determining the changes in miR-29 and an MCL-1 mRNA expression in response to insulin in HL-1 cells. [score:3]
Cardiac tissues of 15-week old Rap treated ZDF-rats (Rap treatment from 9-weeks to 15-weeks) displayed a ∼2-fold increase in miR-29 family miRNAs and a 4-fold suppression of MCL-1 mRNA. [score:3]
Since insulin is an activator of the nutrient sensor kinase mammalian target of rapamycin complex 1 (mTORC1), we further posited that mTORC1-signaling mediates insulin's effects on miR-29-MCL-1 axis. [score:3]
However, qRT-PCR showed that Rap treated ZDF rats had at least a 2-fold increase in the expression of all miR-29 family members (miR-29a, b and c) (Fig. 4E). [score:3]
This observation may have important clinical relevance given the fact that patients with DM are reported to have an increase in miR-29 expression [8], [44]. [score:3]
Increased expression of diabetic marker miR-29 family miRNAs is seen in rodent mo dels of DM and in young and adult diabetic patients with T1DM or T2DM. [score:3]
Therefore, we conclude that regulation of miR-29-MCL-1 axis by insulin is a cardioprotective mechanism and compensatory hyperinsulinemia in conditions of hyperglycemia would regulate miR-29-MCL-1 axis in diabetic heart and prevent significant myocardial damage in young (11- and 15-week) ZDF rats. [score:3]
Suppression of miR-29 by anti-miR-29 oligomers protects against myocardial ischemia-reperfusion injury, abdominal aortic aneurism and diabetic nephropathy [9]– [13]. [score:3]
HL-1 cells were transfected with either Allstars negative control siRNA or miR-29 inhibitor cocktail and after 8 hours of transfection subjected to treatment with Rap (10 nM) overnight. [score:3]
Progressive dysregulation of cardiac miR-29-MCL-1 axis in DM and its correlation with cardiac damage. [score:2]
Based on the data presented here, we contend that the normal functioning of miR-29-MCL-1 axis is an important cardioprotective mechanism regulated by insulin that exists in female mouse atrial cardiomyocytes and male ZDF rat heart tissue. [score:2]
In contrast Rap -treated ZDF rats have very low INS, severe hyperglycemia, and severe dysregulation of miR-29-MCL-1 axis. [score:2]
These data suggest that cardiac miR-29-MCL-1 axis is mildly dysregulated in 11-week old ZDF rats that suffer from DM. [score:2]
Increase in miR-29b leads to the development of aortic aneurisms [10]. [score:2]
I: qRT-PCR analysis data showing the comparative expression levels of miR-29 family miRNAs in myocardium of ZDF rats compared to that in the myocardium of ZL rats. [score:2]
To our knowledge this is the first report that shows insulin is a regulator of miR-29 family miRNAs. [score:2]
For this study, we focused on the RV of ZDF rat heart since RV dysfunction from structural and functional perspectives has been described previously in young ZDF rats [5], [6] and therefore the baseline parameters were easy to compare in the context of regulation of the miR-29-MCL-1 axis. [score:2]
Our in vitro studies on mouse cardiomyocyte HL-1 cells showed that insulin regulates miR-29 family miRNAs (mir-29a, b and c) and improves cardioprotective MCL-1 levels in cardiomyocytes. [score:2]
Mild dysregulation of cardiac miR-29-MCL-1 axis in a hyperinsulinemic DM background (ZDF rat) does not show significant cardiac myofibril disorganization or loss. [score:2]
These observations suggest that Rap treatment causes severe dysregulation of the miR-29-MCL-1 axis in cardiac tissues of ZDF rat. [score:2]
Moreover, Rap treatment of young hyperinsulinemic ZDF rats caused severe dysregulation of cardiac miR-29-MCL-1 axis and myofibril bundle disorganization indicative of myocardial damage. [score:2]
These observations suggest that the myocardium of Rap -treated ZDF rats that had a further increase in miR-29 a, b and c miRNAs and further suppression of MCL-1 (Fig. 4E and 4F) compared to age-matched control rats, exhibited significant disorganization of myofibril bundles that reflect tissue damage. [score:2]
Regulation of diabetic marker miR-29 by insulin and rapamycin in mouse cardiomyocytes. [score:2]
They have mild to moderate dysregulation of miR-29-MCL-1 axis. [score:2]
These observations revealed that a miR-29-MCL-1 axis exists in cardiomyocytes. [score:1]
QTLs associated with the rat (rno)-miR-29 a/b cluster located on chromosome 4: 58,107,760-58,107,847 are shown (Taken from Rat RGSC3.4. [score:1]
Thus, the miR-29-MCL-1 axis is a major contributor to pancreatic dysfunction and T1DM. [score:1]
In this context, the diabetic marker microRNA miR-29 family that plays a role in increasing cell death is particularly noteworthy. [score:1]
RAP for miR-29 a, b, and c. The cardiac muscle cell line HL-1 (a generous gift from Dr. [score:1]
To determine how DM progression (natural or advanced by Rap treatment) caused dysregulation of cardiac miR-29-MCL-1 axis and promoted cardiomyocyte disorganization, we used male ZDF rats, a well-established rodent mo del for advanced DM [5], [6], [26], [27] and evaluated the correlation between regulation of miR-29-MCL-1 axis and disorganization of myofibril bundles in cardiac right ventricle. [score:1]
miR-29 is also one of the several miRNAs associated with inflammatory microvesicles [14]. [score:1]
In this study we used mouse atrial cardiomyocyte HL-1 cells and right ventricular tissues of ZDF rats to investigate how Rap modulates expression of miR-29-MCL-1 axis. [score:1]
The miR-29 family consists of miR-29 a, b (b1 and b2) and c that are located on two different chromosomes (chromosomes 4 and 13 in rat, 1 and 6 in mouse and 1and 7 in human) [7]. [score:1]
Further studies with primary cultures of cardiomyocytes from rat atrium and ventricle are needed to confirm that INS -mediated modulation of miR-29-MCL-1 axis is similar in atrial and ventricular cells. [score:1]
This study was undertaken to investigate whether insulin regulated the miR-29-MCL-1 axis in cardiomyocytes and if conditions that lead to progressive loss of insulin promote dysregulation of cardiac miR-29-MCL-1 axis and disorganization of cardiomyocytes. [score:1]
[1 to 20 of 68 sentences]
15
[+] score: 240
Mechanistically, miR-29 binds to seed regions in the 3′-untranslated region of HIV-1 mRNA and targets it to cellular P bodies resulting in viral mRNA degradation and suppression of translation 18. [score:9]
The mechanism of miR-29 downregulation in activated and memory CD4 T cells might involve nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) as stimulation with anti-TCR/CD28 antibodies (which downregulated miR-29) activates NF-κB, a repressor of miR-29 gene expression in myoblasts 47. [score:9]
Together, these results from human subjects are consistent with a protective role for miR-29 in HIV-1 control and suggest that downregulated miR-29 expression could represent a signature of progressive HIV-1 disease. [score:8]
Interestingly, we found that CD4 T cells from HIV-1-infected HLACs showed a marked downregulation of all miR-29 species (Fig. 4a), suggesting that virus -induced mechanisms downregulated miR-29 transcription. [score:7]
Importantly, the ability of IL-21 to overcome HIV-1 -induced miR-29 downregulation was consistent with its ability to also suppress HIV-1 infection when added to HLACs after CD4 T cells have been infected with HIV-1 (Fig. 1e). [score:6]
While splenic CD4 T cells activated with plate-bound anti-CD3 and anti-CD28 antibodies downregulated miR-29, IL-21 treatment still promoted miR-29 expression in these cells (Supplementary Fig. 6a). [score:6]
Using miRNA species-specific quantitative PCR, we detected markedly upregulated expression of all mature miR-29 species in CD4 T cells in IL-21 -treated splenic CD4 T cells from HIV-1 -negative donors (Fig. 2a). [score:6]
Abrogation of IL-21 -mediated miR-29 induction on STAT3 blockade coupled with enriched STAT3 binding to putative regulatory sites within MIR29 genes support STAT3 as a positive regulator of miR-29 expression in CD4 T cells during HIV-1 infection. [score:5]
Intracellular delivery of miR-29 antagomir LNA and inhibition of miR-29 activity in CD4 T cells was confirmed by the enhanced expression of TBX21 and IFNG, two miR-29-repressed genes 31 (Supplementary Fig. 8). [score:5]
Evidence that not all ECs express protective human leucocyte antigen (HLA) class I alleles 32 and that expression of classical HIV-1 restriction factors are indistinguishable between Progs and ECs 46 suggests that an IL-21–miR-29 axis might represent a non-classical HIV-1 restriction mechanism in these individuals. [score:5]
Pharmacological inhibition of STAT3 with the inhibitor WP1066 but not other downstream IL-21R signalling pathways abrogated IL-21 -mediated induction of miR-29, implicating STAT3 in MIR29 gene induction (Fig. 2c and Supplementary Fig. 7b). [score:5]
Similar to CD4 T cells from HIV-1-infected HLACs (Fig. 4a), we detected marked downregulation of miR-29b expression in CD4 T cells from untreated HIV-infected Progs compared with uninfected and ECs subjects (Fig. 5a). [score:5]
Conversely, using the human CD4 T-cell line CEM-GXR25 that expresses GFP driven by HIV-1 LTR in a Tat -dependent manner 25, we confirmed that constitutive inhibition of endogenous miR-29 by lentivirus-encoded antisense ‘miR-29-ZIP' enhanced infection with CXCR4-tropic HIV-1 [NL4-3] (Supplementary Fig. 5b). [score:5]
IL-21 did not modulate expression of miR-142-5p, which is expressed in haematopoietic cells 26 (Fig. 2a), indicating that it acted selectively on the miR-29 locus and not on miRNAs generally. [score:5]
Consistent with its reported ability to inhibit HIV-1 production and infectivity in HEK293T and HeLa cell lines 17 18, we found that overexpression of miR-29b in human Jurkat T-cell lines using lentiviral vectors significantly inhibited infection of HIV-1 [NL4-3]-luciferase as measured by enzymatic luciferase activity 24 (Supplementary Fig. 5a). [score:5]
MicroRNA-29 also downregulates HIV nef transcripts and nef protein expression which, as nef is essential for optimal HIV-1 production, compromises overall HIV-1 production 17. [score:5]
We quantified miR-29 expression in peripheral blood CD4 T cells from uninfected, treatment naïve HIV-infected progressors (Prog) and EC who suppress HIV in the absence of antiretroviral drugs 32. [score:5]
Indeed, as we report here, severely reduced miR-29 expression is a hallmark of progressive HIV-1 disease 43 45. [score:5]
Consequently, we wondered whether IL-21 regulated expression of the HIV-1-restrictive miR-29 family 17 18, a cluster of highly conserved and co-regulated miRNA that includes miR-29b1/29a and miR-29b2/29c on human chromosome 7 and 1, respectively 23. [score:5]
Relationship between miR-29 expression and HIV-1 disease in humans. [score:5]
These results indicate that IL-21 is able to overcome miR-29 downregulation during HIV-1 infection and that HIV-1 infection did not impair IL-21R signalling in CD4 T cells. [score:4]
IL-21 reverses HIV-1 -induced miR-29 downregulation. [score:4]
Because IL-21 impaired HIV-1 infection when administered before or after viral exposure, we asked whether it can reverse HIV-1 -associated downregulation of miR-29. [score:4]
Taken together, these results implicate an IL-21–miR-29 axis in direct HIV-1 suppression in CD4 T cells and suggest that pretreatment with IL-21 can limit the magnitude of the initial HIV-1 infection in vivo. [score:4]
These results demonstrate that endogenous miR-29 critically regulates the extent of HIV-1 infection of CD4 T cells and suggest that miR-29 likely inhibits early HIV-1 replication steps. [score:4]
On binding to its heterodimeric receptor composed of IL-21Rα and γ [c]-chain, IL-21 activates STAT3, PI3-kinase as well as the MAPK/Erk pathways 3. Thus, to elucidate how IL-21 regulated miR-29 expression, we blocked individual signalling pathways downstream of IL-21R in IL-21 -treated splenic CD4 T cells. [score:4]
The molecular details of miR-29 gene regulation are not well defined but appear to be disease and cell-type specific and likely involves proximal and long-range distal acting cis elements 23. [score:4]
Indeed, we confirmed that splenic CD4 T cells from an HIV-1-infected subject significantly upregulated miR-29 in response to IL-21 treatment (Fig. 4b). [score:4]
These results identify IL-21 as a regulator of miR-29 biogenesis and suggest that IL-21 -mediated inhibition of primary HIV-1 infection was effected through miR-29. [score:4]
By contrast, TCR/CD28 activation of CD4 T cells, which promotes HIV infection 1, downregulated miR-29 (Supplementary Fig. 6a). [score:4]
To address this question, we compared miR-29 expression in purified CD4 T cells isolated from untreated or IL-21 -treated HLACs that were equally infected with HIV-1. As shown in Fig. 4a, treatment with IL-21 completely restored expression of all miR-29 species. [score:4]
To elucidate how IL-21 promoted miR-29 expression, we assessed whether it regulated early steps in miR-29 biogenesis. [score:4]
HLACs were particularly invaluable to our study because mitogen-activated CD4 T cells not only downregulated miR-29 but typically also produce cytokines including IL-2 and IL-15, which promote lentivirus entry 50, potentially obscuring the antiviral effect of IL-21. [score:4]
The oligonucleotides utilized to target miR-29b were: 29bZIP-F: 5′-CCGGTAGCACCTTTAGAAATCATTG-CTCTCGAGAACACTGATTTCAAATGGTGCTATTTTTG-3′; 29bZIP-R: 5′-AATTCAAAA-ATAGCACCATTTGAAATCAGTGTTCTCGAGA-GCAATGATTTCTAAAGGTGCTA-3′. [score:3]
Quantification of pri-miR-29 transcripts revealed that IL-21 promoted the first step in the miR-29 biogenesis pathway as stimulation with IL-21 increased expression of pri-miR-29 transcripts peaking at about 4 h (Fig. 2b and Supplementary Fig. 7a). [score:3]
Even though memory CD4 T cells contained lower levels of miR-29 compared with naïve T cells, they significantly upregulated miR-29 in response to IL-21 (Supplementary Fig. 6b). [score:3]
Interestingly, we found that humanized mice treated with exogenous IL-21 were largely protected from early HIV-1 infection and reduced viral load in these animals correlated with higher miR-29 expression in splenic CD4 T cells. [score:3]
Notably, among untreated HIV-infected Progs, miR-29b expression inversely correlated (Spearman correlation coefficient (r)=−0.5080; P=0.0314) with plasma HIV titres (Fig. 5b). [score:3]
Not only did IL21 mRNA levels correlate with miR-29 in splenic CD4 T cells (Fig. 7e), we observed a significant inverse correlation between miR-29 expression and plasma HIV-1 titres (Fig. 7f). [score:3]
In further support of its STAT3 dependency, the STAT3-activating cytokines IL-6 and IL-10 also promoted miR-29 expression. [score:3]
Consistent with their ability to activate STAT3, IL-6 and IL-10 also induced miR-29 and suppressed HIV-1 infection in HLACs (Supplementary Fig. 9b). [score:3]
To understand the contribution of miR-29 to IL-21 -mediated suppression in early HIV-1 protection in BLT humanized mice, we evaluated the expression of miR-29 and IL-21 in splenic CD4 T cells from IL-21 -treated and HIV-1-infected animals. [score:3]
We similarly assessed miR-29 expression in total, naïve and memory CD4 T cells, which include highly HIV-1-permissive CD4 T cells 27 28. [score:3]
d. of duplicate wells) of mature miR-29a, miR-29b, miR-29c and miR-142-5p in purified total human splenic CD4 T cells from untreated (medium) or IL-21 -treated HLACs after 12 h. (b) Kinetics of expression (average±s. [score:3]
To determine whether IL-21 -mediated suppression of HIV-1 infection required miR-29, purified splenic CD4 T cells were nucleofected with synthetic miR-29 ‘antagomir' locked nucleic acids (LNA). [score:3]
In this study, we report a novel antiviral activity of IL-21 that is mediated by miR-29 and results in suppressed HIV-1 infection in primary lymphoid CD4 T cells. [score:3]
Collectively, these findings demonstrate a novel and rapid miR-29 -mediated antiviral activity of IL-21 that acts through STAT3 in target CD4 T cells to limit initial HIV-1 infection. [score:3]
IL-21 -mediated HIV-1 suppression requires miR-29. [score:3]
Of note, in contrast to interferon-α (IFNα) that suppressed HIV-1 replication through classical cell-intrinsic restriction factors 22, the antiviral activity of IL-21 coincided with its ability to induce miR-29 compared with other Th1 and Th17 effector cytokines (Supplementary Fig. 9a). [score:2]
Our study is the first to describe an IL-21/STAT3 axis as a regulator of miR-29 transcription. [score:2]
Mir-29 is required for IL-21 -mediated viral suppression. [score:2]
Compared with control-LNA antagomirs, mir-29-LNA antagomirs significantly abrogated the ability of IL-21 to inhibit HIV-1 infection in CD4 T cells (Fig. 3a), indicating that the antiviral activity of IL-21 was at least in part mediated by miR-29. [score:2]
MicroRNA-29 is associated with control of HIV-1 disease. [score:2]
Quantitative PCR analysis with primers across an ∼15 kb upstream of MIR29 showed significantly enriched STAT3 binding to two putative regulatory regions upstream of MIR29B1/29A after IL-21 treatment (Fig. 2d). [score:1]
Together, these results strongly suggest that the IL-21-activated STAT3 transcription factor contributes to the induction of miR-29 genes in CD4 T cells. [score:1]
Given the ability of IL-21 to promote HIV-1 resistance in CD4 T cells through miR-29, it is likely that depletion of IL-21-producing T cells compromises this line of defense against HIV-1, which would suggest that higher pre-infection levels of IL-21-producing cells would indicate better HIV-1 prognosis. [score:1]
Our preceding results strongly supported a significant contribution of an IL-21–miR-29 axis in HIV-1 control prompting us to next determine the relationship between miR-29 and HIV-1 infection in human subjects. [score:1]
To determine specifically whether STAT3 regulates miR-29 transcription, we performed chromatin immunoprecipitation (ChIP) assay with anti-STAT3 antibody on untreated or IL-21 -treated primary human splenic CD4 T cells (Figs 2d,e). [score:1]
Notably, the STAT3 -binding regions we identified overlapped with highly conserved sequences and predicted DNase I hypersensitivity sites in MIR29 genes 47. [score:1]
Pri-miR-29 induction preceded the accumulation of mature miR-29 species, which peaked at about 12 h (Fig. 2b). [score:1]
IL-21 promotes antiviral miR-29 biogenesis. [score:1]
In uncovering an antiviral IL-21–miR-29 axis that impairs early HIV-1 infection, our present study suggests that endogenous IL-21 and strategies that exogenously augment IL-21 or induce pre-existing cellular sources of IL-21 would be beneficial in not only promoting adaptive antiviral immunity but also contribute to limiting the magnitude of the initial HIV-1 infection. [score:1]
Because IL-21 was administered 2 weeks after SIV infection at peak viremia in that study 51, it is possible that already established lentiviral infections escape protective mechanisms induced by IL-21 (including miR-29) rendering this cytokine ineffective at curbing virus dissemination. [score:1]
d. of duplicate wells) of pri-miR-29 (normalized to ACTB) and mature miR-29 (normalized to U6) species in purified CD4 T cells isolated from IL-21 -treated splenocytes. [score:1]
For microRNA depletion, total splenic CD4 T cells were purified using the untouched human CD4 T cell isolation kit (Miltenyi Biotec, #130-096-533) and then nucleofected using the unstimulated human T-cell protocol (VPA-1002; programme U-014; Nucleofector II) with 30 pmol of pooled antagomir LNA against miR-29 (Exiqon #4101448-101, #4100754-101) or control antagomir (Exiqon #199006-101), rested for 4–6 h and re-combined with the CD4 -depleted (Miltenyi Biotec, #130-045-101) splenic HLAC fraction. [score:1]
These results are significant as they demonstrate induction of miR-29 by IL-21 in HIV-1 permissive CD4 T cells that account for productive HIV-1 infection. [score:1]
How to cite this article: Stanley, A. et al. IL-21 induces antiviral microRNA-29 in CD4 T cells to limit HIV-1 infection. [score:1]
Induction of miR-29 by IL-21 is STAT3 dependent. [score:1]
Similarly, fewer HIV-1 late reverse transcripts (RT) and integrated HIV-1 DNA were detected in IL-21 -treated samples (Figs 3c,d), suggesting that the IL-21–miR-29 axis interfered with early HIV-1 replication steps. [score:1]
IL-21 induces antiviral miR-29 through STAT3. [score:1]
[1 to 20 of 70 sentences]
16
[+] score: 225
Heat map cluster analysis of expression levels of these genes during early preimplantation development (DBTMEE database) showed that expression levels of Zbtb40, Hbp1, Ccdc117, Ypel2, Klf4, and Tmed9 normally increase between the 2-cell stage and the 4-cell stage (Figure 4B), whereas miR-29b expression levels decrease at this stage of development [12]. [score:9]
Candidate miR-29b target genes with significant upregulation after miR-29b inhibition. [score:8]
Quantitative PCR analysis confirmed significant downregulation of transcripts levels of 6 predicted miR-29 target genes in morula-stage embryos after miR-29b inhibition (Figure 4C). [score:8]
Because we have identified only a few candidate miR-29b target genes using known sequence features predicting interactions with miRNAs, it is likely that many of the observed changes in the transcriptomes in response to miR-29b inhibition occur secondary to changes in direct target genes such as Klf4. [score:8]
The network of miR-29-regulated targeted genes in the early embryo remains has not been explored, and the identity of target genes linked to the developmental arrest of miR-29b depleted embryos remains unknown. [score:7]
It has previously been shown that Sox2 directly regulates endogenous miR-29b expression during iPSC generation and that miR-29b expression is required for OSKM (Oct4, Sox2, Klf4, and c-Myc) and OSK (Oct4, Sox2 and Klf4) -mediated reprogramming [11]. [score:7]
Our study validated differentially expressed genes and indicates that regulatory activity of miR-29b in the early embryo includes direct interaction with the 3' UTR of select target transcripts. [score:7]
In summary, a comparative transcriptome analysis of the miR-29b inhibition group and the control group revealed the regulatory network of miR-29b, which comprises reprogramming factors and molecular regulators of the post-transcriptional modification processes that occur during mouse early embryonic development. [score:6]
To suppress miR-29b activity during preimplantation development, we injected zygote stage embryos with a commercially miR-29b inhibitor. [score:6]
During preimplantation development, miR-29b is highly expressed at the 2-cell stage, concomitant with genomic activation, whereas 4-cell, 8-cell, morula and blastocyst stage embryos express only low levels [12]. [score:6]
NC, (B) Zbtb40, (C) Hbp1, (D) Ccdc117, (E) Ypel2, (F) Klf4 and (G) Tmed9; To suppress miR-29b activity during preimplantation development, we injected zygote stage embryos with a commercially miR-29b inhibitor. [score:6]
Quantitative PCR -based analysis validated that Pomt2, Nanog, Dpagt1, Mixl1, Cyr61, and Ctgf transcripts were downregulated in morula-stage embryos response to miR-29b inhibition (Supplementary Figure S5C). [score:6]
Among genes with expression changes in response to miR-29b inhibition in the early embryo, we identified 30 genes that were significantly decreased and associated with abnormal embryonic phenotypes reported in knockout mouse mo dels. [score:6]
To explore whether miR-29b may directly interact with any of the target candidate genes, we evaluated the 3'-untranslated region (3' UTR) sequences of candidate mRNAs and found that Zbtb40, Hbp1, Ccdc117, Ypel2, Klf4, and Tmed9 transcripts contained predicted miR-29b target sequences according to the miRNA database (miRNA. [score:6]
Sequences illustrate predicted base pairing between miR-29b and the 3'UTR of target genes, and absence of complementarity of miR-29b with mutant target sequences used as negative controls. [score:5]
These genes may not be direct targets of miR-29b, but they may still be key components of the miR-29b regulatory network. [score:5]
Normalized FPKM values are represented from blue to yellow; C. Relative expression of 6 UDEGs in morula stage embryos that had been injected with miR-29b inhibitor (red) or mock control (blue) at the zygote stage. [score:5]
Morula-stage embryos that had been subject to miR-29b inhibition throughout preimplantation development exhibited significant expression changes in 870 genes compared with controls. [score:5]
To identify putative target genes of miR-29 in preimplantation stage embryos, we next performed micro -RNA target prediction analyses of the coding regions of UDEG transcripts. [score:5]
These expression patterns may be subject to transcriptional and or post-transcriptional regulation, and miR-29b may contribute to this regulation. [score:5]
Glycosylation Mix1 homeobox-like 1 (Xenopus laevis) Mixl1 Mostly arrested by E9, abnormal morphology Transcription factor Cysteine rich protein 61 Cyr61 Arrest around E10.5, defects in chorioallantoic fusion Extracellular matrix binding Connective tissue growth factor Ctgf Perinatal lethal with respiratory failure Fibronectin binding, growth factor activity To identify putative target genes of miR-29 in preimplantation stage embryos, we next performed micro -RNA target prediction analyses of the coding regions of UDEG transcripts. [score:5]
Inhibition of miR-29b alters the expression of 870 genes in mouse preimplantation stage embryos. [score:5]
This developmental arrest may in part be due to disruption of DNA methylation-related reprogramming events in the early embryo, which are regulated by miR-29b: Alterations in miR-29b activity affect expression levels of DNMT (DNA (cytosine-5-)-methyltransferase), resulting in altered global methylation levels [12]. [score:5]
These findings indicate that the 3' UTR sequences of Zbtb40, Hbp1, Ccdc117, Ypel2, and Klf4 transcripts are direct targets of miR-29b. [score:4]
A. Schematic depiction of preimplantation development following microinjection of miR29b inhibitor or vehicle control. [score:4]
NC, (B) Zbtb40, (C) Hbp1, (D) Ccdc117, (E) Ypel2, (F) Klf4 and (G) Tmed9; We have previously shown that inhibition of miR-29b during preimplantation development leads to early embryonic arrest [12]. [score:4]
Inhibition of miR-29b during early embryogenesis causes developmental delay before the blastocyst stage without visible morphological changes at earlier preimplantation stages [12]. [score:4]
Zbtb40, Hbp1, Ccdc117, Ypel2 and Klf4 transcripts are direct targets of miR-29b. [score:4]
Figure 1 A. Schematic depiction of preimplantation development following microinjection of miR29b inhibitor or vehicle control. [score:4]
These data suggest that miR-29b participates in early embryonic reprogramming events by regulating the expression of multiple reprogramming factors. [score:4]
Identification of DEGs between morula-stage embryos subject to miR-29b inhibition and mock -injected controls. [score:3]
A commercially available mirVana [®] miRNA Inhibitor (Applied Biosystems, California, US) specific for mmu-miR-29b (mouse miR-29b), was microinjected into the cytoplasm of zygotes as previously described [12, 29]. [score:3]
We identified 19 candidate genes that were predicted targets of miR-29b (Table 2). [score:3]
Moreover, one of the miR-29b candidate targets—Klf4—is also a known reprogramming factor. [score:3]
Interestingly, another reprogramming factor—Sox2—binds to the miR-29b promoter and stimulates miR-29b expression in iPSCs. [score:3]
As observed previously [12], zygotes injected with miR-29b inhibitor or mock negative control developed into morphologically similar morula stage embryos when cultured in vitro. [score:3]
Here, we used RNA-seq to identify changes in the transcriptome of mouse preimplantation stage in response to miR-29b inhibition. [score:3]
Following validation of the negative control, comparison of transcriptomes of the miR-29b inhibition group with the mock -injected negative control group yielded a total of 870 DEGs that met criteria for significance. [score:3]
Confirming the validity of our experimental approach, UDEGs were highly enriched for predicted target genes of the miR-29 cluster (Figure 4A). [score:3]
Predicted targets of miR-29b include reprogramming factors. [score:3]
Microinjection of miR-29b inhibitor or mock control into zygotes. [score:3]
For global transcriptome analysis using RNA-seq, 10 morula stage embryos were collected per experimental group, which included miR-29b inhibitor -injected, mock negative control -injected, and untreated embryos (Figure 1A). [score:3]
Luciferase reporter analysis of miR-29b targets. [score:3]
Correlations across biological replicates were high in both the miR-29b inhibition group and in the control group (Pearson's product moment correlation=0.992 and 0.981; Figure 2A). [score:3]
Mmu-miR-29b mimics reduced luciferase expression from reporter constructs containing the 3' UTR sequences of Zbtb40, Hbp1, Ccdc117, Ypel2, or Klf4 (Figure 5B-5F) but not Tmed9 (Figure 5G) or any construct with 3'UTR sequences modified to abolish putative binding (Figure 5B-5F). [score:3]
Outcomes of previous studies have indicated that miR-29b not only regulates protein glycosylation but also blocks the actions of the Plk1 and Aurka protein kinases thus promoting embryonic lethality before implantation [26, 27]. [score:2]
These results indicate that the miR-29b regulatory network affects various post-transcriptional modifications including glycosylation and phosphorylation. [score:2]
Thus, miR-29b plays a major role in the regulation of DNA methylation-related reprogramming events in the early embryo and iPSCs. [score:2]
Thus, miR-29b appears to play a role predominantly during early embryonic development, prior to the first cell fate decision in the embryo, which occurs during the 5- to 8-cell stage [13]. [score:2]
Here we have unraveled global changes in the transcriptome of early mouse embryos following disrupting miR-29b function in vivo. [score:1]
Plasmids were co -transfected into 293T cells with either miR-29b mimics or negative control. [score:1]
B-G. Normalized reporter activity at 48 hours after co-transfection of constructs with mmu-miR-29b mimic or mock negative control (NC). [score:1]
[1 to 20 of 52 sentences]
17
[+] score: 220
Taken together, the present study shows that bladder outlet obstruction, such as that seen in elderly men with enlarged prostate glands, leads to reduced expression of miR-29b and miR-29c in the bladder and that this is associated with increased expression of miR-29 targets, including the matrix proteins elastin and Sparc. [score:7]
Human detrusor cells were transfected with miR-29c inhibitor and eight validated miR-29 targets, most of which were represented among the top 50 predicted targets in Figure 3A, were examined using western blotting. [score:7]
We also demonstrate that genetic depletion of miRNAs, including miR-29, increases bladder elastin expression and stiffness independently of outlet obstruction and that miR-29 inhibitor transfection in vitro replicates several of the expression changes associated with miR-29 repression in outlet obstruction. [score:7]
Together, these circumstances may well explain the more widespread apparent impact of miR-29 repression in outlet obstruction (8/8 examined target proteins increased) compared to inhibitor transfection (4/8 examined target proteins increased). [score:6]
Four of the eight selected miR-29 targets, including Eln (elastin or tropoelastin), Fos (also known as c-Fos), Sparc (osteonectin) and sprouty homolog 1 (Spry1), were significantly increased following inhibitor transfection (Figure 3D, left row). [score:5]
To address the functional impact of miR-29, we transfected a miR-29 inhibitor and mimic in vitro and conditionally deleted Dicer in vivo [5] and examined the effect of these interventions on tropoelastin expression and on tissue mechanical properties. [score:5]
Currently, we can only speculate on the role of these proteins in outlet obstruction, but it is of considerable interest that the miR-29 target Spry1 [14], which is an established ERK1/2 inhibitor [49], increases after prolonged outlet obstruction. [score:5]
For tropoelastin, whose mRNA correlated inversely and significantly with miR-29 in outlet obstruction, we found that transfection of a miR-29c inhibitor resulted in increased tropoelastin expression. [score:5]
Of the 30 miRNAs that are highly expressed in the mouse detrusor [5, 41] none except miR-29 is predicted to target tropoelastin. [score:5]
Some predicted and confirmed miR-29 targets, including Fbn1, which is an integral part of the elastic fiber meshwork, and Lamc1, a protein present in the basement membrane, were increased in outlet obstruction but were not significantly affected at the protein level following inhibitor transfection (not shown). [score:5]
To address whether reduced miR-29b/c following outlet obstruction was associated with altered expression of target mRNAs we did an mRNA microarray experiment. [score:5]
Additional regulatory inputs on miR-29 expression include c-Myc and NF-κB [11], and recent work has provided considerable insight into c-Myc -mediated repression, which appears to depend on a repressor complex consisting of c-Myc, histone deacetylae 3 (Hdac3) and enhancer of zeste homologue 2 (Ezh2) [18]. [score:4]
Detrusors from smooth muscle-specific Dicer knockout mice were used to examine if reduction of miR-29 in vivo increases tropoelastin expression. [score:4]
We found that Dicer knockout reduced miR-29b and miR-29c by about half and increased tropoelastin expression. [score:4]
The extracellular matrix molecule elastin is one of the best established targets of miR-29, and its message has 14 binding sites dispersed over the coding sequence and the 3’UTR [12]. [score:3]
The initial association found for miR-29b/c is illustrated in Figure 3A which shows that miR-29b/c targets were elevated at 10 days (vs. [score:3]
MiR-29b and miR-29c were among the 63 differentially expressed miRNAs in outlet obstruction (q=0; n=6−8; GEO accession number GSE47080). [score:3]
MiR-1 (not shown), miR-29b, and miR-29c returned significant associations with target mRNA levels. [score:3]
Time courses of expression for miR-29c and miR-29b from the microarray experiment are depicted in Figure 2A and 2B. [score:3]
Real-time quantitative PCR for miR-29c and miR-29b (Figure 2C and D) confirmed reduced expression of both miRNAs at 10 days. [score:3]
Repression of miR-29 after outlet obstruction is associated with increased levels of miR-29 target proteins. [score:3]
Outlet obstruction and transforming growth factor β (TGF-β1) stimulation leads to reduced expression of miR-29. [score:3]
0082308.g005 Figure 5(A) Western blots for eight miR-29 targets in sham-operated control bladders and at 6 weeks of obstruction. [score:3]
We also examined if the reduction of miR-29 correlated with altered miR-29 target mRNAs, including tropoelastin and Sparc. [score:3]
6 weeks) of the top 50 mRNA targets of miR-29 when miR-29 was repressed at 10 days and when miR-29 recovered after de-obstruction (c. f. Figure 2A and B). [score:3]
Stimulation with TGF-β1 for 48h led to reduced expression of miR-29c and miR-29b (Figure 2E and F). [score:3]
The experimental support for an impact of miR-29 on protein synthesis in the bladder following outlet obstruction extends well beyond a significant correlation between miR-29b/c and target mRNAs. [score:3]
Expression of (E) miR-29c and (F) miR-29b in vehicle -treated (control) and TGF-β1 -treated human urinary bladder smooth muscle cells. [score:3]
sham) of miR-29 target messenger RNAs (mRNA; black circles) and proteins (white circles). [score:3]
Considerably more time was moreover allowed for de-repression of miR-29 targets in the in vivo setting (6 wk vs. [score:3]
We first examined expression of miR-29b and miR-29c following 5 weeks of Dicer deletion and found both miRNAs to be reduced (Figure 6A, B). [score:3]
It may be argued that a miRNA other than miR-29 is responsible for altered tropoelastin expression in Dicer KO bladders. [score:3]
Outlet obstruction and TGF-β reduce miR-29 expression. [score:3]
0082308.g002 Figure 2Time courses of (A) miR-29c and (B) miR-29b expression following rat bladder outlet obstruction. [score:3]
This revealed a pronounced increase around individual cells and around muscle bundles in obstructed bladders, consistent with its increased mRNA level and with the fact that it is a miR-29 target [48]. [score:3]
We next set out to determine miR-29 expression. [score:3]
Real-time quantitative PCR to confirm reduced expression of miR-29. [score:3]
We next tested whether TGF-β1 reduces miR-29 expression using cultured smooth muscle cells from human bladder. [score:3]
Repression of miR-29 during outlet obstruction is associated with increased levels of miR-29 target messenger RNAs (mRNAs). [score:3]
The matricellular protein Sparc is a confirmed miR-29 target [13] that influences collagen fibril morphology and function [47]. [score:3]
Bladder outlet obstruction increases miR-29 target protein levels. [score:3]
Type I and type III collagens are however established targets of miR-29 [10], and their mRNAs were largely unchanged at 10 days and at 6 weeks (Col1a1 at 10 days: up by 15%, q=2.7, p=0.05; Col3a1 at 10 days: up by 12%, q=8.7, p=0.12). [score:3]
Unlike other miRNAs, miR-29 also targets a large battery of collagens, including collagens I and III [10]. [score:3]
This would repress miR-29, and hence it would be more difficult to see an effect of miR-29 inhibition. [score:3]
Our studies support a mo del in which multiple signaling pathways converge on repression of miR-29 in outlet obstruction, facilitating matrix protein expression and leading to altered mechanical properties of the urinary bladder. [score:3]
Time courses of (A) miR-29c and (B) miR-29b expression following rat bladder outlet obstruction. [score:3]
MiR-29 target mRNAs change in outlet obstruction. [score:2]
Thus, several independent lines of evidence support a regulatory role of miR-29 in tropoelastin synthesis in the bladder, consistent with the large number of miR-29 binding sites in its mRNA [10, 12]. [score:2]
Several of the miR-29 targets that we studied, including Col15a1, Tdg and Spry1, have not been considered previously in the context of hypertrophic growth and remo deling of the bladder. [score:2]
Taken together these findings strongly support the view that the aforementioned repressor complex, assembled upon accumulation of c-Myc/Ezh2 in outlet obstruction, regulates miR-29b in the detrusor. [score:2]
SMAD proteins belong to a conserved family of TGF-β signal transducers that are regulated by phosphorylation [17], and the repression of miR-29 by TGF-β was shown to involve SMAD3 [16]. [score:2]
The matricellular protein Sparc has three miR-29 binding sites clustered in its proximal 3’ UTR, and, similar to elastin, this protein is effectively regulated by miR-29 in vitro [13]. [score:2]
Real-time quantitative polymerase chain reaction (n=5-7) for miR-29b (A), miR-29c (B) and elastin (Eln, C) in control (Ctrl) and Dicer knockout (KO) mouse bladders. [score:2]
A correlation between the c-Myc mRNA and miR-29b was moreover seen, and we directly demonstrate accumulation of c-Myc and Ezh2 using western blotting. [score:2]
Our starting hypothesis was that TGF-β/SMAD3 signaling would repress miR-29 in outlet obstruction. [score:1]
Figure S2 Flow chart showing the mo del proposed for miR-29 repression in outlet obstruction and for miR-29 -mediated matrix remo deling and altered passive mechanical properties. [score:1]
The reduced level of miR-29 leads to increased levels of mRNAs encoding extracellular matrix proteins (3), including elastin and Sparc (osteonectin), but possibly also collagens and fibrillin-1. The resulting protein synthesis and matrix deposition (4) leads to increased detrusor stiffness (5) (and increased elastic modulus) which counteracts (6) further distension. [score:1]
Together, these findings support the view that repression of miR-29, independent of surgical obstruction of the urethra, leads to matrix remo deling. [score:1]
We therefore hypothesized that outlet obstruction leads to SMAD3 phosphorylation repressing miR-29, and that this in turn has an impact on protein synthesis and mechanical properties of the bladder. [score:1]
Studies using cultured cells support the idea that transforming growth factor-β (TGF-β), a central mediator in fibrogenesis, represses miR-29 [16]. [score:1]
Therefore, reduction of miR-29b and miR-29c could well promote collagen production at an unchanged mRNA level at these times. [score:1]
sham), a time point when miR-29 was reduced (c. f. Figure 2A and B). [score:1]
The miR-29 cluster has gained recognition as a modulator of extracellular matrix production [7- 10]. [score:1]
This hypothesis was based on a handful of prior studies demonstrating increased mRNA levels for different TGF-β isoforms shortly after outlet obstruction (e. g. 24), and on the documented repression of miR-29 by TGF-β/SMAD3 [11]. [score:1]
Eln correlated significantly with miR-29c (Figure 3E) and with the mean of miR-29b and miR-29c (not shown). [score:1]
Thus we measured the eight validated miR-29 target proteins (the same ones measured after inhibitor transfection) at 6 weeks of obstruction. [score:1]
When miR-29b/c increased on de-obstruction (vs. [score:1]
c-Myc and NF-κB are also known to repress miR-29 [11, 18], and both pathways have previously been shown to be activated in outlet obstruction and by mechanical distension [37- 39]. [score:1]
The proposed mo del fits the data presented in this article, but alternative interpretations are possible and steps upstream of miR-29 repression need in vivo corroboration. [score:1]
SMAD3 activation, which is known to be involved in TGF-β -mediated repression of miR-29, was not significantly increased at 10 days when miR-29b and miR-29c appeared to be maximally repressed. [score:1]
The Myc mRNA declined below the control level on de-obstruction, resulting in a significant and inverse correlation with miR-29b (Figure 4B). [score:1]
c-Myc -mediated repression of miR-29 involves a complex consisting of c-Myc (Myc), histone deacetylase 3 (Hdac3) and enhancer of zeste homolog 2 (Ezh2) which binds to conserved sequences in the promoters of the miR-29a/b1 and miR-29b2/c genes [18]. [score:1]
MiR-29 -mediated extracellular matrix remo deling has been demonstrated in the infarcted heart [10] and during aortic aneurysm progression [7- 9], but miR-29 also plays roles in cell proliferation, muscle differentiation and apoptosis [11]. [score:1]
This in turn (2) activates multiple signaling pathways including c-Myc, NF-κB and TGF-β/SMAD3 that in turn repress miR-29. [score:1]
We therefore propose that c-Myc/Hdac3/Ezh2 and NF-κB are jointly responsible for repression of miR-29b and miR-29c at 10 days and that SMAD3 is responsible for the sustained repression of miR-29c. [score:1]
Combined, these findings provide support for our hypothesis that miR-29 reduction contributes to increased protein synthesis in the bladder following outlet obstruction and that this in turn influences matrix properties and stiffness (Figure S2). [score:1]
We hypothesized that miR-29 repression may contribute to increased detrusor stiffness in outlet obstruction. [score:1]
We propose that bladder distension leads to repression of miR-29 via three distinct mechanisms and that this has an impact on tropoelastin and Sparc synthesis and on tissue mechanical properties. [score:1]
To address this hypothesis we examined if SMAD proteins are phosphorylated and whether miR-29 is reduced in outlet obstruction. [score:1]
Sparc correlated with the mean of miR-29b and miR-29c (Figure 3F). [score:1]
De-repression of Sparc may thus also contribute to a miR-29 -mediated change of detrusor stiffness in outlet obstruction. [score:1]
It comprises three miRNAs (miR-29a, miR-29b, and miR-29c) derived from two independent genes [10]. [score:1]
Our lack of evidence for SMAD2/3 activation at 10 days, when miR-29b and miR-29c appeared maximally repressed, forced us to consider alternative mechanisms. [score:1]
In view of this outcome we tested if Eln and Sparc mRNAs were individually correlated with miR-29 in outlet obstruction. [score:1]
Added to the correlation between miR-29c and Col4a1 mRNA this favors a causal relationship between the repression of miR-29 and the increase of Col4a1 in outlet obstruction. [score:1]
Independent confirmation of reduced (C) miR-29c and (D) miR-29b in the obstructed bladder by real-time quantitative polymerase chain reaction (n=6). [score:1]
This supported the possibility that c-Myc and NF-κB, but not SMAD3, might be involved in the repression of miR-29b and miR-29c at 10 days. [score:1]
The impact of miR-29 in outlet obstruction is likely underestimated by measuring levels of mRNAs because an important mechanism of miRNAs is translational repression. [score:1]
[1 to 20 of 88 sentences]
18
[+] score: 217
Since ectopic expression of miR-29b suppressed hPGRN expression, we used locked nucleic acid (LNA) -mediated miRNA silencing to determine whether loss of endogenous miR-29b activity enhances hPGRN expression in stably transfected hPGRN-3T3 cells. [score:9]
Expression of pre-miR-29b-1 or pre-miR-29b-2 suppressed the expression of luciferase with hPGRN 3′UTR (Fig. 2B), suggesting that both genes indeed can produce functional mature miR-29b to regulate hPGRN 3′UTR. [score:8]
With such mutations present in hPGRN 3′UTR, luciferase expression failed to be regulated by miR-29b produced from the vector expressing its precursor (Fig. 3D). [score:7]
MiR-29b regulates several other mRNA targets as well [33], [34], [36], [37], consistent with the notion that each miRNA targets many mRNAs in different cellular and developmental settings [27]. [score:7]
Both overexpression and locked nucleic acid (LNA) knockdown experiments demonstrated a role for miR-29b in regulating progranulin expression through its 3′UTR. [score:7]
We also confirmed that miR-29b interacts directly with the hPGRN 3′UTR and regulates the expression level of endogenous hPGRN. [score:5]
Thus, miR-29b is a good candidate miRNA that may directly regulate progranulin expression. [score:5]
We cloned mPGRN 3′UTR into the luciferase reporter construct and found that indeed miR-29b also suppressed luciferase expression through mPGRN 3′UTR (Fig. 2C). [score:5]
As expected, the effect of miR-29b on progranulin expression is not as dramatic as that of transcription factors, consistent with the notion that in many cases, miRNAs fine tune gene expression [20], [27]. [score:5]
MiR-29b is downregulated in several types of tumor cells [32]– [34], which is in reverse correlation with the increased progranulin expression in tumor cells [35]. [score:5]
Firefly luciferase expression vectors (PGL3; 200 ng), miR-29b-pSuper or pSuper empty vector (200 ng), and Renilla luciferase expression vector (50 ng) were cotransfected into the cells with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. [score:5]
We identified miR-29b with a miRNA target prediction program that takes into account the secondary structures of target mRNAs and seed region complementarity [28]. [score:5]
These experiments demonstrate that miR-29b interacts directly with the binding site in hPGRN 3′UTR to regulate luciferase reporter expression. [score:5]
miR-29b also suppressed the expression of luciferase with mPGRN 3′UTR. [score:5]
miR-29b Suppresses Expression of the Luciferase Reporter Containing the hPGRN 3′UTR. [score:5]
In addition to vector -based expression of pre-miR-29b-1, which produces mature miR-29b after being transfected into HEK293 cells, we also used miRNA mimics, which are double-stranded RNA oligonucleotides that are chemically modified with Dharmacon ON-TARGET (Themo Scientific Dharmacon). [score:5]
Moreover, miR-29b mimics were unable to suppress luciferase expression with a different mutant hPGRN 3′UTR in which GTG in the miR-29b binding site was mutated to CAC (Fig. 3C, D). [score:5]
Cotransfection of normal but not the mutant pre-miR-29b-1 suppressed luciferase reporter expression (Fig. 3B). [score:5]
of miR-29b and its putative target site in hPGRN 3′UTR was carried out with the QuickChange Multi Site-Directed kit (Stratagene) according to the manufacturer's instructions. [score:4]
Thus, hPGRN expression can be regulated by manipulating the activity of endogenous miR-29b. [score:4]
MiR-29b suppresses the expression of the luciferase reporter with hPGRN 3′UTR. [score:4]
miR-29b directly targets hPGRN 3′UTR through the seed region. [score:4]
Thus, miR-29b is novel regulator of progranulin expression, raising the possibility of manipulating the activities of miR-29b and other miRNAs in the adult brain to treat FTD associated with progranulin deficiency. [score:4]
Mutagenesis of miR-29b and its putative target site in hPGRN 3′UTR was carried out with the QuickChange Multi Site-Directed kit (Stratagene) according to the manufacturer's instructions. [score:4]
To examine whether the interaction between miR-29b and hPGRN 3′UTR is direct or indirect, we generated mutations in miR-29b. [score:4]
Thus, miR-29b-1 acts through hPGRN 3′UTR to regulate luciferase expression. [score:4]
As expected, an increased level of miR-29b led to a lower level of hPGRN in the medium (Fig. 5B), correlating with the decreased expression in hPGRN-3T3 cells. [score:3]
Cotransfection of miR-29b-1 and the luciferase vector without hPGRN 3′UTR did not affect luciferase expression (data not shown). [score:3]
Indeed, we found that indeed the expression levels of endogenous intracellular hPGRN (Fig. 5D) and secreted hPGRN (Fig. 5E) were decreased by miR-29b mimics. [score:3]
In the case of progranulin, the potential effects of miR-29b knockdown on other mRNA targets and biological processes must be considered. [score:3]
miR-29b Suppresses the Production and Secretion of hPGRN. [score:3]
Moreover, miR-29b is highly expressed in adult brains and in postmitotic neurons [29]. [score:3]
0010551.g004 Figure 4(A) The relative levels of mature miR-29b in hPGRN-3T3 cells were increased by transient expression of the miR-29b precursor or miR-29b mimic. [score:3]
Transfection of miR-29b but not miR-9 mimics decreased luciferase reporter expression (Fig. 2D). [score:3]
Identification of a miR-29b target site in the 3′UTR of hPGRN mRNA. [score:3]
In the nervous system, miR-29b is developmentally regulated, with the highest level in adult mouse brain [29]. [score:3]
For mutagenesis of the miR-29b target site in hPGRN 3′UTR, 5′-GACCCTGTGGCCAGACACTTTTCC CTATCCACAG-3′ was used. [score:3]
Here we provide multiple lines of experimental evidence to demonstrate that miR-29b is a novel regulator of hPGRN production. [score:2]
The level of secreted hPGRN increased to a similar extent after miR-29b knockdown (Fig. 6B). [score:2]
The next day, the medium was changed to fresh Dulbecco's modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS), and the cells were transfected 2 h later with 100 pmol of control or miR-29b miRNA mimics (Dharmacon) using Lipofectamine 2000 (Invitrogen) as directed by the manufacturer. [score:2]
Knockdown of endogenous miR-29b led to increased production and secretion of hPGRN. [score:2]
Thus, the regulatory interaction between miR-29b and hPGRN may exist during tumorigenesis as well. [score:2]
To examine whether miR-29b also regulates the expression of endogenous hPGRN, we transfected the human cell line HEK293 cells with miR-29b mimics and measured the levels of intracellular and secreted hPGRN. [score:2]
Although 3′UTR sequences tend to drift more rapidly during evolution [27], the putative binding sites for miR-29b in PGRN 3′UTRs are also highly conserved in mammals, with only one nucleotide difference between humans and rodents (Fig. 1D), suggesting an evolutionarily conserved miRNA–mRNA interaction with potentially important regulatory functions. [score:2]
miR-29b Knockdown Increases the Levels of Intracellular and Secreted hPGRN. [score:2]
Next, we examined the regulation of endogenous hPGRN by miR-29b. [score:2]
miR-29b Directly Interacts with the Predicted Binding Site in the hPGRN 3′UTR. [score:2]
The 3′UTR of hPGRN mRNA Contains a Predicted miR-29b Binding Site. [score:1]
In pre-miR-29b-1, we mutated two nucleotides in the miR-29b seed region from CC to GG (Fig. 3A). [score:1]
The decrease in the level hPGRN protein as we observed is likely due to a decrease in hPGRN mRNA stability since we found by quantitative RT-PCR that the level of hPGRN mRNA was also decreased by miR-29b mimics (Figure 5C). [score:1]
Mutant 2 was used for experiment with the miR-29b mimic. [score:1]
To validate the interaction between miR-29b and the hPGRN 3′UTR, we cloned hPGRN 3′UTR into the reporter vector to serve as the 3′UTR of the luciferase coding region (Fig. 2A). [score:1]
Luciferase activity was reduced by miR-29b but not by mutant miR-29b. [score:1]
Since hPGRN and mPGRN mRNAs contain conserved binding sites for miR-29b (Fig. 1D), and the effects of miRNAs depend on the secondary structures of surrounding mRNA sequences, we also examined whether miR-29b could also interact with mPGRN mRNA. [score:1]
Moreover, we also mutated the miR-29b binding site in hPGRN 3′UTR in which GTG was changed to ACA (Fig. 3C). [score:1]
This program predicted a putative binding site for miR-29b in the hPGRN 3′UTR, which contains about 300 nucleotides (Fig. 1A, B). [score:1]
Transfection of hPGRN-3T3 cells with the pre-miR-29b-1 vector significantly increased the level of mature miR-29b (Fig. 4A). [score:1]
The miR-29b seed sequences and their predicted binding sites in the hPGRN 3′UTR are shown underlined. [score:1]
0010551.g006 Figure 6(A) qRT-PCR confirmed that mature miR-29b level was decreased by about 80% in hPGRN-3T3 cells transfected with miR-29b-specific LNA. [score:1]
0010551.g003 Figure 3(A) The seed region of miR-29b and the opposite strand in the stem-loop in the precursor were mutated. [score:1]
MiR-29b precursors were amplified from HEK293FT genomic DNA using 5′-GTCGA CCTGACTGCCATTTG-3′ and 5′-ATCGA TGCTCTCCCATCAATA-3′ for pre-miR-29b-1 on chromosome 7 and 5′-GTCGACT GTGTTTATTTTAAACACAA-3′ and 5′-ATCGATTGAATCTCCCTTCT TTCTT-3′ for pre-miR-29b-2 on chromosome 1. SalI and ClaI restriction enzyme sites were placed at the ends of the PCR products for subcloning into the pSuper basic vector (OligoEngine). [score:1]
Again, miR-29b significantly reduced the level of intracellular hPGRN in hPGRN-3T3 cells (Fig. 4D). [score:1]
Transfection of miR-29b-specific LNA probes reduced endogenous miR-29b levels by about 80% (Fig. 6A). [score:1]
Mutant 1 was used for experiment with the miR-29b vector. [score:1]
Mature miR-29b can be produced from two precursors encoded by two genes located on chromosomes 7 and 1, respectively. [score:1]
To ensure that mutant pre-miR-29b-1 maintains its stem loop structure so that it can be properly processed to produce mature miR-29b, we also mutated GG in the opposite strand of the stem into CC (Fig. 3A). [score:1]
0010551.g005 Figure 5(A, B) hPGRN-3T3 cells were transfected with miR-29b or negative control mimics, and the relative hPGRN levels in total cell lysates (A) and medium (B) were determined by ELISA. [score:1]
n = 4. (A) qRT-PCR confirmed that mature miR-29b level was decreased by about 80% in hPGRN-3T3 cells transfected with miR-29b-specific LNA. [score:1]
We also used miR-29b mimics to increase the level of mature miR-29b (Fig. 4A). [score:1]
We also cloned the 421-nucleotide genomic fragment that contains pre-miR-29b-1 into the pSuper vector (Fig. 2A). [score:1]
For mutagenesis of miR-29b, 5′-CCCAAGA ACACTGATTTCAAATCCTGCTAGAC AATCAC-3′ and 5′-AATCTA AACCAGG ATATGAAACCAGCTTCCTGAAGAA GC-3′ were used. [score:1]
These findings raise the possibility that miR-29b may specifically interact with hPGRN 3′UTR. [score:1]
In this study, we identified a miR-29b binding site in the 3′UTR of hPGRN mRNA. [score:1]
miR-29b levels were normalized to miR-126 or U6 levels. [score:1]
hPGRN 3′UTR was cloned into the luciferase vector containing the SV40 promoter, which was cotransfected with the vector encoding pre-miR-29b-1 and H1 promoter. [score:1]
0010551.g001 Figure 1(A) Schematic representation of hPGRN mRNA (NM_002087.2 showing with the predicted miR-29b binding site in the 3′UTR. [score:1]
[1 to 20 of 76 sentences]
19
[+] score: 215
Recently, altered expression of miRNAs has been shown to mediate myocardial fibrosis post-MI [3], [8], which suggest that use of miR-29b, as a fibroblast-enriched miRNA [11], is a potential anti-fibrosis target therapy based on its ability to directly target mRNAs that encode ECM proteins involved in fibrosis. [score:8]
Furthermore, other ECM proteins including Elastin and fibrillin 1, as the predicted targets of miR-29b, were significantly down-regulated in miR-29b overexpressing group (data not shown). [score:8]
We discovered that overexpression of miR-29b significantly down-regulated collagen synthesis during anoxia through inhibited pERK activity as well as MRTF-A, a serum response factor (SRF) serving as a cofactor that responds to TGF-β in fibroblasts, contributing to SMA-enriched myofibroblasts [22]. [score:8]
Recently, van Rooij, et al. [8] reported that miR-29b targets and inhibits a group of mRNAs that encode cardiac fibroblast proteins involved in fibrosis, and that the down-regulation of miR-29b after MI correlated with increased collagen types I and III, and fibrillin 1 in the peri-infarct and remote normal heart regions. [score:8]
Importantly, the effect of miR-29b overexpression on the fibrotic related genes MRTF-A, collagen I, and collagen III was abolished in CFb in presence of the selective inhibitor of pERK, PD98059 (Fig. 1D1–3). [score:5]
Among myocardial infarction-regulated miRNA members, the miR-29 family (miR-29a, miR-29b copy 1 and copy 2, and miR-29c) is down-regulated in the peri-infarct region of the heart [8], which is associated with collagen production by fibroblasts, subsequent collagen deposition, and eventually leads to heart failure [11]. [score:5]
In this study we hypothesized an alternative strategy wherein overexpression of microRNA-29b (miR-29b), inhibiting mRNAs that encode cardiac fibroblast proteins involved in fibrosis, would similarly facilitate progenitor cell migration into infarcted rat myocardium. [score:5]
There are three major findings of this study: 1) Overexpression of miR-29b, by blocking the activation of the p42/44 MAPK-MRTF signaling pathway, inhibits myofibroblast formation and attenuates collagen synthesis. [score:5]
Since miRNAs target not only single genes but also functionally related gene networks, the paracrine effect of miR-29b overexpressing fibroblasts may contribute to increased iPSC [NCX1+] migration and survival. [score:5]
miR-29 overexpression in combination with the Tri-P may facilitate iPSC [NCX1+] migration and survival, as well as permit neovascularization of the infarct, leading to improvements in LV functional performance after the occurrence of ischemic heart disease. [score:5]
This study demonstrated that miR-29b overexpression is an emerging supplement to iPSC -based cell therapy for ischemic heart disease. [score:5]
Conversely, down-regulation of miR-29b with anti-29b in vitro and in vivo induced interstitial fibrosis and cardiac remo deling. [score:4]
4 weeks post-MI, slight down-regulation of miR-29b was detected in the infarct areas, but was not statistically different from the Sham group (Fig. 2A). [score:4]
Rats were assigned to experimental groups, as follows: 1) Sham operated rats had a loose suture placed around the left anterior descending (LAD) coronary artery (Sham group), 2) negative mimic pretreated rats with MI operation followed by Tri-P graft (Ctrl+MI+Tri-P), 3) miR-29b overexpression pretreated rats with MI operation followed by Tri-P graft (miR-29b+MI+Tri-P), 4) miR-29b knockdown pretreated rats with MI operation followed by Tri-P graft (Anti-29b+MI+Tri-P). [score:4]
These suppressive effects were reversed in miR-29b knockdown cells (CFb [Anti-29b]), which exhibited significant increases in pERK, MRTF-A, collagen I, and III levels (p<0.05). [score:4]
Taken together, these findings suggest that miR-29b and its downstream target genes, as supplements to cell -based therapies, serve as a promising therapeutic regulator to retard, limit or reverse fibrosis post-MI. [score:4]
To further explore the in vivo findings, several regions of the infarcted rat hearts including the infarcted region (IF), border region (B) and remote region (R) were harvested to analyze the effect of miR-29b overexpression or knockdown on cardiac fibrosis. [score:4]
Sham, sham operated group with loose suture around LAD; Ctrl, intramyocardial gene delivery with control; miR-29b, intramyocardial gene delivery with miR-29b-1 mimic; Anti-29b, intramyocardial gene delivery with miR-29b-1inhibitor. [score:3]
The negative mimic, rno-miR-29b mimic (Dharmacon) or rno-miR-29b inhibitor (Exiqon) were added at the required final concentration (200 nmol/L for each well) after mixing with DharmaFECT Duo Transfection Reagent according to the manufacturer's instructions. [score:3]
A tiny 32 gauge catheter containing 50 µl of concentrated negative mimic, miR-29b mimic, or inhibitor (25 µM) was advanced from the apex of the left ventricle to the aortic root. [score:3]
Sham, sham operated group with loose suture around LAD; Ctrl, intramyocardial gene delivery with control mimic; miR-29b, intramyocardial gene delivery with miR-29b-1 mimic; Anti-29b, intramyocardial gene delivery with miR-29b-1inhibitor. [score:3]
2) Reduced collagen deposition associated with miR-29b overexpression in scar tissue after MI facilitates iPSC [NCX1+] penetration from the Tri-P into the infarcted area, and results in restoration of LV function after MI. [score:3]
The aim of this study was to determine if miR-29b overexpression in the rat heart in vivo would effectively reduce barrier formation (collagen deposition) after MI and thereby enhance the efficacy of the iPSC-derived Tri-P based cell therapy in improving heart function after regional MI. [score:3]
In vivo experimental design: negative mimic (Ctrl), miR-29b mimic (miR-29b), and miR-29b inhibitor (Anti-29b) were delivered into the rat hearts before MI as described previously [18]. [score:3]
To probe the miR-29b-triggered downstream signal pathway involved in cardiac fibrosis in vitro, we isolated cardiac fibroblasts and transfected them with negative mimic (Ctrl), or miR-29b mimic (miR-29b), or miR-29b inhibitor (Anti-29b). [score:3]
0070023.g001 Figure 1Effect of miR-29b overexpression in vitro on cardiac fibrosis. [score:3]
Effect of miR-29b overexpression in vitro on cardiac fibrosis. [score:3]
Thus, we speculated that miR-29b overexpression might reduce heart tissue collagen and thereby lower the barrier to progenitor cell engraftment and survival. [score:3]
This favorable anti-fibrotic effect of miR-29b on fibrosis was reversed by the pERK inhibitor, PD98059, suggesting the crucial role of ERK signaling pathway in fibroblast proliferation, and myofibroblast differentiation [2], [23], [24]. [score:3]
Sham, sham operated group with loose suture around LAD; Ctrl, control mimic pretreatd rat with Tri-cell patch graft; miR-29b, miR-29b mimic pretreaed rat with Tri-cell patch graft; Anti-29b, miR-29b inhibitor pretreated rat with Tri-cell patch graft. [score:3]
In vivo: Nude rat hearts were administered mimic miRNA-29b (miR-29b), miRNA-29b inhibitor (Anti-29b), or negative mimic (Ctrl) before creation of an ischemically induced regional myocardial infarction (MI). [score:3]
Compared with sham operated hearts (Sham group), a significant down-regulation of miR-29b was observed in the hearts 3 days post-MI (p<0.05) (Fig. 2A), which was most prominent in the infarcted area (Fig. 2B). [score:3]
In combination with the Tri-P, overexpression of miR-29b was accompanied by enhanced angiomyogenesis in the underlying infarct region and functional restoration of the LV after MI. [score:3]
To further study the molecular signaling pathway involved in fibrosis, CFb were transfected with negative mimic (CFb [Ctrl]), miR-29b mimic (CFb [miR-29b]), or miR-29b inhibitor (CFb [Anti-29b]). [score:3]
To elucidate how miR-29b modulated molecular mechanisms involved in cardiac fibrosis modulated by assigning cardiac fibroblasts (CFb), the subjects were divided into the following treatment groups, 1) negative mimic (CFb [Ctrl]) served as control, 2) mimic microRNA-29b-1 (CFb [miR-29b]), or 3) miRCURY LNA™ microRNA-29b-1 inhibitor (CFb [Anti-29b]). [score:3]
Overexpression of miR-29b significantly reduced scar formation after MI and facilitated iPSC [NCX1+] penetration from the cell patch into the infarcted area, resulting in restoration of heart function after MI. [score:3]
To further analyze whether miR-29b overexpression interfered with post-MI collagen deposition in vivo, intramyocardial gene delivery was performed (Fig. 2C-1). [score:3]
However, no obvious anti-apoptosis effect of miR-29b overexpression was observed in comparison to Ctrl group and Anti-29b group. [score:3]
Effect of miR-29b in vivo on cardiac fibrotic gene related expression. [score:3]
0070023.g002 Figure 2Effect of miR-29b in vivo on cardiac fibrotic gene related expression. [score:3]
MiR-29b has been reported to directly target mRNAs that encode various ECM proteins involved in fibrosis [3]. [score:3]
3) Overexpression of miR-29b enhances new vessel formation from the cell patch and these vessels connect to the native coronary circulation. [score:3]
However, under anoxia CFb overexpressing miR-29b (CFb [miR-29b]) exhibited a significant decrease (p<0.05) in pERK (Fig. 1C1–2), myocardin-related transcription factor-A (MRTF-A, Fig. 1D-1), collagen type I (Fig. 1D-2), and collagen type III (Fig. 1D-3). [score:3]
To analyze the role of miR-29b on cardiac fibrosis, the total mRNA of rat neonatal cardiomyocytes (neoCM) and CFb were isolated respectively, and qPCR revealed that miR-29b was expressed significantly more in CFb than in neoCM (p<0.05, Fig. 1A). [score:3]
Ctrl, control mimic pretreatd rat with Tri-cell patch graft; miR-29b, miR-29b mimic pretreated rat with Tri-cell patch graft; Anti-29b, miR-29b inhibitor pretreated rat with Tri-cell patch graft. [score:3]
Ctrl+MI+Tri-P, control pretreated rat with Tri-cell patch graft; miR-29b+MI+Tri-P, miR-29b mimic pretreated rat with Tri-cell patch graft; Anti-29b+MI+Tri-P, miR-29b inhibitor pretreated rat with Tri-cell patch graft. [score:3]
Quantitative data for fibrosis related genes including exprression of TGF-β1 (C-2), SDF-1α (C-3), MRTF-A (C-4) collagen I (C-5), and collagen III (C-6) in infarcted heart 3 days after intramyocardial gene delivery of control mimic (Ctrl), miR-29b1 mimic (miR-29b), or miR-29b1 inhibitor (Anti-29b). [score:3]
MiR-29b overexpression reduces the barrier (collagen deposition) to iPSC engraftment from epicardial apposed myocardial tissue progenitor cell patches. [score:2]
Furthermore, an increased number of newly formed blood vessels, identified by GFP expression, were detected in miR-29b pretreated hearts compared with the other two groups 4 weeks after Tri-P application (Fig. 4E and 4F-2). [score:2]
Quantitative RT-PCR showed that the expression of miR-29b was significantly increased in CFb [miR-29b] group (p<0.01), and was significantly reduced in CFb [Anti-29b] group as compared with CFb [Ctrl] group (p<0.05, Fig. 1B). [score:2]
The number of green fluorescent protein positive (GFP [+]) cells, capillary density, and heart function were significantly increased in hearts overexpressing miR-29b as compared with Ctrl and Anti-29b groups. [score:2]
miR-29b -mediated fibrotic size facilitates mobilization of iPSC [NCX1+] and angiomyogenesis. [score:1]
Effect of miR-29b on fibrotic size, iPSC migration, and angiogenesis in the infarcted heart 4 weeks after Tri-P graft. [score:1]
With regard to the function in cardiac fibroblasts, miR-29b may attenuate scar barriers to progenitor cell infiltration thereby facilitating iPSC [NCX1+] penetration from the Tri-P into the infarcted area. [score:1]
To analyze the effect of anti-fibrosis treatment on heart function, additional infarcted hearts treated with negative mimic, or miR-29b mimic or miR-29b inhibitor were evaluated by echocardiography. [score:1]
Effect of miR-29b in vivo on cardiomyocyte apoptosis. [score:1]
However, a complex vascular network was detected in the cell patch at 4 weeks after patch transplantation, which was collateral with native coronary arteries (Fig. 5A) and exhibited greater vessel volume and vessel number (Fig. 5C-1), the hallmarks of the dynamic angiogenic process that was much more robust in the miR-29b pretreated group than in other groups (Fig. 5C-2). [score:1]
Fluorescence microscopy demonstrated newly formed vessels confirmed by GFP antibody (green color) in the cell patch of miR-29b+MI+Tri-P group (A-2) and Anti-29b+MI+Tri-P group (B-2). [score:1]
CFb [miR-29b]. [score:1]
The results of the present study demonstrate a distinctive role for miR-29b -mediated collagen deposition in the animal mo del of acute MI followed by iPSC derived Tri-P for the repair of myocardial infarction. [score:1]
0070023.g003 Figure 3Effect of miR-29b in vivo on cardiomyocyte apoptosis. [score:1]
The anti-fibrosis effect of miR-29b pretreatment was further supported by picrosirius red staining under polarized light, which showed significantly lower levels of cardiac fibrosis 4 weeks after Tri-P graft (Fig. 4A-1). [score:1]
However, no obvious heart functional changes were observed in miR-29b alone treatment group (data not shown). [score:1]
miR-29b group. [score:1]
The pretreatment strategy of intramyocardial delivery with miR-29b followed by Tri-P, in the setting of MI, resulted in restoration of LV mechanical function after MI. [score:1]
Although Tri-P transplantation induced a robust neo-vascularization as early as 1 week post-patch graft, no differences in vessel volume or vessel number were detected between the miR-29b pretreated group and the Anti-29b pretreated group at that early time point (data not shown). [score:1]
Micro-CT imaging for collateral circulation formation in miR-29b+MI+Tri-P (A) and Anti-29b+MI+Tri-P group (B). [score:1]
LV fibrosis, analyzed by Masson's Trichrome staining 4 weeks after patch transplantation, was significantly reduced in the miR-29b pretreated group. [score:1]
In the current study, we observed a significantly increased number of GFP [+] myocytes (identified by cTnT staining) in the infarcted region of the miR-29b pretreated group. [score:1]
miR-29b -mediated fibrotic size facilitates mobilization of iPSC [NCX1+] and angiomyogenesisRats were subjected to LAD ligation for 7 days, followed by apposition of the Tri-P to the infarcted heart region. [score:1]
0070023.g005 Figure 5Micro-CT imaging for collateral circulation formation in miR-29b+MI+Tri-P (A) and Anti-29b+MI+Tri-P group (B). [score:1]
CFb [miR-29b]; [‡]p<0.05 vs. [score:1]
Our in vivo findings demonstrate that the post-MI fibrotic processes can be reversed by miR-29b intramyocardial delivery leading to decreased synthesis of MRTF-A, collagen I and III in the infarcted/border regions. [score:1]
Collagen synthesis is mediated by miR-29b in the heart fibroblasts. [score:1]
miR-29b+MI+Tri-P group. [score:1]
By micro-CT analysis, we demonstrated collateral blood vessel network formation arose from the cell patch and connected to native coronary arteries as a prominent feature in miR-29b pretreated hearts in contrast to the Anti-29b group. [score:1]
Furthermore, GFP positive labeling (Fig. 5C-3) confirmed significant vascularization in the Tri-P region in the miR-29b pretreated group. [score:1]
[1 to 20 of 77 sentences]
20
[+] score: 176
Since 58% of all differentially regulated genes were down-regulated (78 genes were down-regulated and 56 were up-regulated with a corrected -value ), we can estimate the chance that 16 of 17 differentially regulated genes with at least 5 CDS and 3′ UTR MREs for miR-29 are down-regulated using the binomial distribution as. [score:15]
A second limitation is that our results are not able to fully clarify the nature of the upstream factors that up-regulate the expression of the ECM genes and down-regulate the expression of miR-29 and miR-15 family members. [score:11]
Our results suggest the existence of a related miRNA/mRNA network that could be involved in the shift of the metabolic program of the aorta from processes involved in development and extracellular matrix (ECM) protein synthesis in the neo samples to oxidative energy metabolism in the w6 samples, whereby there is a coordinate up-regulation of miR-29 and miR-15 family miRNAs and down-regulation of their ECM target genes including, prominently, elastin (Fig. 7). [score:10]
Additionally, a number of ECM genes found to be down-regulated in aortic maturation in this study are both predicted or validated targets of miR-29 and also are transcriptionally regulated by TGF-, including Col1a1 [55], Eln [56], Col4a1 [57], and Col6a3 [58]. [score:7]
Consistent with the identification of miR-29 family members as the most highly differentially regulated miRNAs in postnatal aortic development, the miR-29 family was found to have the most significant gene -expression signature in the mRNA expression profile of the w6 samples (Fig. 2). [score:7]
Genes with multiple miR-15 and miR-29 family MREs in coding sequence and 3′ UTR are down-regulated in the w6 aortaThese results motivated us to ask whether other genes with multiple miR-29 family MREs are also down-regulated in the w6 aorta. [score:7]
0016250.g007 Figure 7 U denotes upstream factors which tend to up-regulate ECM genes in the neonatal aorta and to suppress miR-29 and miR-15 family microRNAs. [score:6]
U denotes upstream factors which tend to up-regulate ECM genes in the neonatal aorta and to suppress miR-29 and miR-15 family microRNAs. [score:6]
Identification of Differential Regulation of miR-15 and miR-29 family miRNAs and their Target mRNAs in Postnatal Aortic Development. [score:5]
We suggest that the high expression of miR-29 and the miR-15 family member in the adult aorta may be an important factor for the physiological suppression of the production of elastin in the adult organism. [score:5]
As with miR-29 and miR-145, computational analysis of the target gene profile for miR-27 and miR-24 showed a significant shift in the aortic samples from six-week old mice (Fig. 2), suggesting that these miRNAs also contribute to the mRNA expression profile in the adult aorta. [score:5]
Inspection of the 3′ UTR of Eln revealed four potential binding sites for the most highly up-regulated miRNA, miR-29 (Fig. 4A). [score:4]
Genes with multiple miR-15 and miR-29 family MREs in coding sequence and 3′ UTR are down-regulated in the w6 aorta. [score:4]
These results motivated us to ask whether other genes with multiple miR-29 family MREs are also down-regulated in the w6 aorta. [score:4]
Five of the six miRNAs that were most up-regulated in the w6 aortas belonged to just two miRNA families, miR-29 and miR-15. [score:4]
Here we have shown that miR-29 is an important regulator of elastin expression by means of synergistic MREs in its 3′ UTR as well as additional MREs in its CDS. [score:4]
C Putative mo del of miR-15/miR-29 and mRNA target gene networks. [score:3]
We then proceeded to test the effect of treating RFL-6 cells with miR-29 or miR-195 mimics on the expression of Eln, Col1a1, and Col1a2. [score:3]
All three isoforms of miR-29 share the same seed sequence at nucleotides 1–8, corresponding to a sequence of UGGUGCUA in target mRNAs. [score:3]
0016250.g003 Figure 3 All three isoforms of miR-29 share the same seed sequence at nucleotides 1–8, corresponding to a sequence of UGGUGCUA in target mRNAs. [score:3]
These results confirm previous observations that the 3′ UTR of murine Eln is a miR-29 target [35] and additionally show that the multiple miR-29 MREs act synergistically (Fig. 4B). [score:3]
We chose a miR-29a precursor for these studies because all three isoforms of miR-29 share the same seed sequence (nucleotides 2–8; Fig. 3), and miR-29a showed the highest degree of differential expression in our experiments (Fig. 1A). [score:3]
The first construct contains nucleotides 1–45 of the Eln 3′ UTR with a mutation of the miR-29 MRE sequence from UUGGUGCU to AACCACGA. [score:2]
In conclusion, we have shown that miR-29 and the miR-15 family members miR-195 and miR-497 are differentially regulated between the newborn and the six-week old murine aorta, and using in vitro assays we have demonstrated that they regulate elastin by means of multiple MREs in both the 3′ UTR and the CDS. [score:2]
These microRNAs have been intensively studied in the context of myocardial infarction, where miR-29 was shown to act as a regulator of cardiac fibrosis in vivo [35]. [score:2]
There are no MREs for miR-29 and miR-15 family miRNAs in the entire coding sequence of the firefly and renilla luciferase genes. [score:1]
The construct on top with Eln exons 28 to 30 contains three miR-15 but no miR-29 MREs. [score:1]
A limitation of our study is that a role for the miR-29 and miR-15 family MREs in the CDS of elastin and other matrix genes was not demonstrated in an in vivo mo del system. [score:1]
miR-29 MREs are consistently overrepresented in mRNA sequences for elastin, and miR-15 family MREs are overrepresented in rat, cow, and dog but to a lesser degree in humans, suggesting species-specific differences (Supplementary Table S6). [score:1]
MREs for miR-15 and miR-29 are highly overrepresented in the mRNA sequence of Eln. [score:1]
Longer constructs with two or three further miR-29 MREs in the Eln 3′ UTR displayed a higher degree of reduction in luciferase activity when exposed to miR-29a precursor. [score:1]
miR-29 is overrepresented in Eln and multiple collagen genes. [score:1]
There were 7675 mRNA sequences with at least one MRE for miR-29. [score:1]
The longer construct at the bottom with Eln exons 27 to 30 additionally contains four miR-29 MREs. [score:1]
There were 7,675 mRNA sequences with at least one MRE for miR-29. [score:1]
Mimics for miR-29 or miR-195 led to repression of elastin expression as measured by qPCR (Fig. 5), and treatment of the cells with antagonists of miR-29 had the opposite effect (Supplementary Fig. S3). [score:1]
Triplicate qPCR analyses for Col1a1, Col1a2, and Eln following treatment of RFL-6 cells with scrambled (black), miR-29 (dark grey), or miR-195 (light grey) precursor. [score:1]
Van Rooij and coworkers proposed a network feedback motif involving collagen, TGF- and miR-29 for the pathogenesis of cardiac fibrosis following myocardial infarction [35], [52]. [score:1]
Computational sequence analysis identified 50 genes containing at least five MREs for miR-29 in the CDS and 3′ UTR sequences. [score:1]
On top a mutant construct is shown in which the miR-29 MRE is crossed out. [score:1]
For miR-29, whose genomic MRE sequence is TGGTGCT, the probability is thus, and the probability of an MRE starting at any given position can be mo deled as a Bernoulli process with probability. [score:1]
Computational analysis revealed eleven additional 7–8mer binding sites for miR-29 in the coding sequence (CDS) of elastin (Fig. 4A, dashed lines), as well as eight MREs with perfect complementarity to the seed sequence of the miR-15 family members miR-195/miR-497 (Fig. 4A, arrows). [score:1]
There is a highly significant overrepresentation of MREs for miR-29 in the mRNA sequences of the elastin and type 1 collagen genes throughout mammalian evolution. [score:1]
However, we note that TGF- was previously shown to reduce miR-29 activity in cardiac fibroblasts [35], and Wnt signaling was shown to induce miR-29 in an osteoblastic cell line [54]. [score:1]
The first such construct contains three miR-497/miR-195 MREs but no miR-29 MREs, and showed repression by the miR-497 precursor but not by the miR-29 precursor. [score:1]
The second construct additionally contained four miR-29 MREs, and was significantly responsive to both miRNA precursors, indicating a specific effect of miR-15 and miR-29 MREs in the CDS of murine Eln. [score:1]
for the 7,675 genes with at least one MRE for miR-29 are displayed as a histogram of the negative decadic logarithm. [score:1]
In the rat, Col1a1 has 20 miR-29 MREs in its CDS and one in its 3′ UTR, and has 4 MREs for miR-15 family miRNAs in its CDS and one in its 3′ UTR; Col1a2 has 15 miR-29 MREs in its CDS and none in its 3′ UTR, and 7 miR-15 family MREs in its CDS; and Eln has 10 miR-29 MREs in its CDS and 3 in its 3′ UTR, and 9 MREs for miR-15 and none in the 3′ UTR. [score:1]
As shown in Fig. 4B, cotransfection of miR-29a precursor with a 3′ UTR construct containing one miR-29 MRE resulted in a reduction in luciferase activity to about 60%. [score:1]
B The number of MREs for miR-29 was counted in the mRNA sequences of each of 33,394 murine genes, using only the longest transcript for genes with alternative transcripts. [score:1]
Table S5There are 50 genes containing at least five MREs for miR-29 in the CDS plus 3′ UTR. [score:1]
Eight of them have at least five MREs for miR-29, five have at least five MREs for miR-15, including three genes that additionally have at least five MREs for miR-29. [score:1]
In the cartoons of the mouse elastin gene (A) and the luciferase constructs (B,C) miR-29 MREs (UGGUGCU) are indicated by dashed lines, and miR-15 MREs (UGCUGCU) by arrows. [score:1]
0016250.g005 Figure 5Triplicate qPCR analyses for Col1a1, Col1a2, and Eln following treatment of RFL-6 cells with scrambled (black), miR-29 (dark grey), or miR-195 (light grey) precursor. [score:1]
are displayed as a histogram of the negative decadic logarithm (for instance, the -value for miR-29 of is displayed as ). [score:1]
MREs for miR-15 and miR-29 are highly overrepresented in the mRNA sequence of Eln We developed a simple statistical test for overrepresentation of MREs in mRNA sequences (see methods) and used it to analyze the counts of MREs for 373 miRNA families in the entire mRNA sequence of Eln. [score:1]
miR-29 showed the most highly significant enrichment (), and MREs for the miR-15 family showed the second most significant enrichment (). [score:1]
The finding of a total of 14 MREs for miR-29 as well as 13 for the miR-15 miRNA miR-195 in the coding and 3′ UTR sequence of Eln is highly statistically significant (Fig. 6), and to our knowledge a similar finding has not been previously reported for any miRNA. [score:1]
0016250.g004 Figure 4In the cartoons of the mouse elastin gene (A) and the luciferase constructs (B,C) miR-29 MREs (UGGUGCU) are indicated by dashed lines, and miR-15 MREs (UGCUGCU) by arrows. [score:1]
revealed eleven additional 7–8mer binding sites for miR-29 in the coding sequence (CDS) of elastin (Fig. 4A, dashed lines), as well as eight MREs with perfect complementarity to the seed sequence of the miR-15 family members miR-195/miR-497 (Fig. 4A, arrows). [score:1]
See also Supplementary Table S5 for counts of miR-15 and miR-29 family MREs. [score:1]
The seed sequences of miR-15 miRNAs (AGCAGCA) and miR-29 family miRNAs (AGCACCA) differ by only one nucleotide (Fig. 3). [score:1]
The number of MREs for miR-29 and miR-15 family miRNAs in the rat genes is based on the sequences NM_012722 (Eln), NM_053304 (Col1a1), and NM_053356 (Col1a2). [score:1]
7-nucleotide matches for the MREs of miR-29 or miR-15 family miRNAs were counted in the elastin and type I collagen 1 and 2 genes of five mammalian species. [score:1]
There were a total of five genes with for enrichment in MREs for miR-29. [score:1]
A The shaded sequences show the 3′ UTR MREs that are analyzed in B. Three MREs match the seed sequence perfectly, and a fourth MRE at position 380–388 of the Eln 3′ UTR matches positions 3–8 of all miR-29 family seed sequences but positions 9–11 only of miR-29a. [score:1]
3′ UTR and CDS MREs for miR-29, miR-195, and miR-497 in the elastin gene. [score:1]
Although Col1a1 has one miR-15 and one miR-29 MRE in its 3′ UTR, the great majority of MREs for these miRNAs are located in its CDS. [score:1]
miR-29 and the miR-15 family members miR-195/miR-497 form three intergenic clusters in mouse chromosomes 1, 6, and 11.. [score:1]
miR-15 and miR-29 Overrepresentation in Eln. [score:1]
Arrows mark the ten genes which contain at least five MREs for both miR-15 family and miR-29 family. [score:1]
The high multiplicity of MREs for miR-15 and miR-29 family miRNAs is reminiscent of the VGVAPG repeating peptide in elastin, which can induce macrophage chemotaxis and other biological responses by interaction with the elastin -binding protein [48]– [50]. [score:1]
In addition, Col1a2 has neither miR-15 nor miR-29 MREs in its 3′ UTR and was responsive to both miR mimics. [score:1]
[1 to 20 of 73 sentences]
21
[+] score: 175
From the present study, our results revealed that the expression of Sp1 was significantly increased in high glucose induced rMC-1 cells than MIAT directly targeted miR-29b expression, and MIAT suppression significantly reversed the low expression of miR-29b and high expression of Sp1 induced by high glucose. [score:14]
Figure 6 miR-29b targets MIAT to regulate its expression(A) TargetScan database predicted that miR-29b has highly conserved target sequence with 3′-UTR of MIAT. [score:10]
Figure 5The effects of MIAT suppression on the expression of miR-29 and Sp1 in high glucose -induced rMC-1 cells(A) MIAT suppression significantly reversed the decreased expression of miR-29 induced by high glucose. [score:9]
We revealed that the expression of MIAT was associated with NF-κB (p-p65), NF-κB activated the MIAT, MIAT target regulated miR-29b expression and finally regulated the cell apoptosis. [score:9]
TargetScan database was used for the online prediction and the results revealed that miR-29b have highly conserved target sequence with MIAT (Figure 6A), the results indicated that MIAT could regulate miR-29b expression. [score:8]
revealed that MIAT overexpression significantly decreased the expression of miR-29b (Figure 6B), but increased the expression of SP1 (Figure 6C). [score:7]
MIAT overexpression dramatically decreased the expression of miR-29b (B), while increased the expression of Sp1 in rMC-1 cells (C). [score:7]
Moreover, miR-29b knockdown significantly reversed the effects of cell apoptosis induced by MIAT suppression, which indicated that the protective function of MIAT suppression was interfered by miR-29b knockdown. [score:7]
revealed that cell viability was significantly decreased and cell apoptosis was obviously increased by high glucose treatment, then MIAT suppression reversed the effects induced by high glucose, however, miR-29b knockdown significantly reversed the effects induced by MIAT suppression (Figure 7A,B). [score:6]
MIAT targeted miR-29b to regulate its expressionWe explored the relationship of miR-29b and MIAT. [score:6]
Our present study showed that MIAT controlled the cell apoptosis in DR might be partly through absorbing miR-29b and inhibiting its function, meanwhile regulating the expression of Sp1. [score:6]
At the same time, miR-29b inhibited the transcription of Sp1 and then up-regulated its own transcription [36]. [score:6]
MIAT targeted miR-29b to regulate its expression. [score:6]
Figure 7Interaction of MIAT and miR-29b on high glucose induced rMC-1 cells(A) MIAT suppression significantly reversed the decrease in cell viability induced by high glucose, while miR-29b knockdown significantly reversed the effect induced by MIAT suppression. [score:6]
miR-29b targets MIAT to regulate its expression. [score:6]
Previous study investigated that Sp1 expression was directly targeted by miR-29b, which was bound to miR-29b promoter and repressed the expression of miR-29b [35 ]. [score:6]
MIAT suppression increased the expression of miR-29b and SP1. [score:5]
The effects of MIAT suppression on the expression of miR-29 and Sp1 in high glucose -induced rMC-1 cells. [score:5]
MIAT suppression increased the expression of miR-29b and SP1In order to explore the potential mechanism between MIAT and cell apoptosis induced by high glucose, miR-29b was selected for further exploration. [score:5]
The results indicated that MIAT capable of this function might be through harbouring of miR-29b and then regulating the expression of miR-29b and Sp1. [score:4]
At the same time, miR-29b was differentially expressed in DM [31], however, whether miR-29b regulation plays an important role in DR remains unclear. [score:4]
The rMC-1 cells in the logarithmic phase were used in the experiment and cultured at 37°C with 5% CO [2] on a 96-well plate, the cells were stimulated by high glucose and transfected with si-MIAT, si-MIAT and miR-29b inhibitor. [score:3]
miR-29b belongs to the miR-29 family, which acts as a tumour suppressor in many tumour researches. [score:3]
rMC-1 cells were transfected with si-MIAT and miR-29b inhibitor, then high glucose was used to stimulate the cells. [score:3]
In order to verify it, Ad-MIAT was constructed and transfected to rMC-1 cells and the expression of miR-29b and its downstream gene SP1 was detected. [score:3]
The miR-29b inhibitor, si-MIAT and NC were synthesized by Shanghai Yingjun Co. [score:3]
rMC-1 cells were cultured in a 96-well plate for 24 h, miR-29b inhibitor, si-MIAT, Ad (adenovirus)-MIAT (Ad-MIAT) or their negative control (NC), Ad-carrying GFP (Ad-GFP) transfected the cells by Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions. [score:3]
The real-time PCR reflected that when cells were pretreated with si-MIAT and then stimulated by high glucose, the expression of miR-29b was significantly increased than that treated by high glucose only (Figure 5A). [score:3]
rMC-1 cells transfected with si-MIAT, si-MIAT and miR-29b inhibitor were cultured at 37°C with 5% CO [2] on a 96-well plate for 48 h, and then harvested and stained with propidium iodide (PI) (Sigma) for 30 min. [score:3]
Study has reported that miR-29b negatively regulated osteoblast differentiation [30]. [score:2]
Interaction of MIAT and miR-29b on high glucose induced rMC-1 cells. [score:1]
Further clinical therapy based on the NF-κB/MIAT/ miR-29b/Sp1network appears to be important for DR. [score:1]
Interaction of MIAT, miR-29b and high glucose on cell survival and apoptosisTo identify the effects of MIAT, miR-29b on high glucose induced cell survival and apoptosis. [score:1]
To identify the effects of MIAT, miR-29b on high glucose induced cell survival and apoptosis. [score:1]
Interaction of MIAT, miR-29b and high glucose on cell survival and apoptosis. [score:1]
We explored the relationship of miR-29b and MIAT. [score:1]
In order to explore the potential mechanism between MIAT and cell apoptosis induced by high glucose, miR-29b was selected for further exploration. [score:1]
[1 to 20 of 37 sentences]
22
[+] score: 168
We here demonstrate that synthetic miR-29b mimics specifically bind the 3'UTR of DNMT3A and DNMT3B, resulting in downregulation of both DNMTs at mRNA and protein level; conversely, miR-29b inhibition by antagomiRs led to increased DNMTs expression levels. [score:8]
Our results are in line with previous reports showing that enforced expression of miR-29b reduces global DNA methylation in AML and NSCLC cells, restoring the expression of methylation-silenced tumor suppressor genes (TSGs). [score:7]
SKMM1 cells were stably transduced with a lentiviral vector carrying the antagomiR-29b; miR-29b levels after transduction are reported in Supplemental Fig. 2. Of note, miR-29b inhibition indeed led to up-regulation of both DNMT3A and DNMT3B protein levels, as assessed by western blotting analysis (Fig. 2D, right panel). [score:6]
On the basis of these findings we investigated whether miR-29b inhibition could up-regulate de novo DNMTs expression. [score:6]
We observed significant tumor growth inhibition (p<0.05) in mice treated with miR-29b mimics, together with 2-fold increase of miR-29b levels (Fig. 5D) and down-regulation of both DNMT3A and DNMT3B mRNA levels (Fig. 5E) as assessed by qRT-PCR analysis of the excised tumors. [score:6]
In conclusion, we provide evidence that miR-29b controls the methylation profile of MM cells suggesting that miR-29b down-regulation may play a relevant role in MM pathophysiology by reducing TSGs expression. [score:6]
It was possible to conclude that miR-29b is a direct regulator of DNMT3A and DNMT3B expression in MM cells. [score:5]
Moreover, synthetic miR-29b mimics potentiated the growth -inhibitory effects of the DNMT -inhibitor 5-azacitidine [47], suggesting new strategies based upon DNA-demethylating agents/miRNAs combination in the treatment of MM. [score:5]
Raw microarray expression levels for DNMT3A, DNMT3B and miR-29b are reported in Supplemental Fig. 4. Notably, such integrated analysis highlighted an inverse correlation between miR-29b and DNMT3B expression levels (p=0,0012), whereas no correlation between miR-29b and DNMT3A could be demonstrated (Fig. 3). [score:5]
Indeed, bioinformatic analysis revealed that DNMT3A and DNMT3B are miR-29b targets, according with previous studies which reported the ability of members of the miR-29 -family to target DNMTs in solid tumors and AML [24, 38]. [score:5]
In silico search for target prediction [31, 32] indicates that both DNMT3A and DNMT3B are bona fide targets of miR-29b. [score:5]
As shown in Fig. 5A, repeated intratumor injection of NLE-formulated synthetic miR-29b (1mg/Kg; 5 injections, 3 days apart), significantly inhibited growth of MM xenografts. [score:3]
miR-29b targets de novo DNMTs in MM cells. [score:3]
In our experimental mo del, in vitro transfection of synthetic miR-29b mimics in MM cells promoted apoptosis and cell cycle perturbations, and similar effects were observed when DNMT3A and DNMT3B were silenced by shRNAs, just confirming the thought that these enzymes are valuable targets for anti-tumor treatment. [score:3]
Figure 3 Correlation of endogenous miR-29b levels with DNMT3A (A) and DNMT3B (B) mRNA levels determined by high density microarray of mRNA and miRNA expression in a panel of 17 MM cell lines. [score:3]
To obtain MM cells stably expressing antagomiR-29b, we used the lentiviral vector miRZip29b anti-miR-29b construct (System Biosciences); lentiviral particles production and transduction were performed according to the above indicated protocols. [score:3]
In order to additionally support the clinical translation of our experimental approach, we also studied the in vivo activity of miR-29b mimics using the novel SCID- synth-hu mo del of human MM [29]. [score:3]
Importantly, the growth -inhibitory effect well correlated with miR-29b accumulation in tumor tissues (Fig. 5B), as assessed by q-RT-PCR in retrieved xenografts. [score:3]
Histological and immunohistochemical analysis of retrieved 3D biopolymeric scaffolds after treatment with synthetic miR-29b showed indeed increased expression of cleaved caspase-3 and reduced Ki-67 (Fig. 6). [score:3]
In vitro transfection of synthetic miR-29b mimics decreased cell growth in a time -dependent manner and potentiated 5-azacitidine anti-proliferative effects at 72 hours (percentage of growth inhibition at 72 hours were 45%, 35% and 65% for miR-29b, 5-azacitidine and combination treatment respectively; Fig. 4B). [score:3]
Correlation of endogenous miR-29b levels with DNMT3A (A) and DNMT3B (B) mRNA levels determined by high density microarray of mRNA and miRNA expression in a panel of 17 MM cell lines. [score:3]
To validate this interaction in MM cells, INA-6 cells were co -transfected with synthetic miR-29b or scrambled oligonucleotides (NC), together with an expression vector carrying the 3'UTR of DNMT3A or DNMT3B mRNA cloned downstream to the luciferase reporter gene. [score:3]
In the present study, we evaluated whether miR-29b could inhibit de novo DNMTs expression. [score:3]
In vivo tumor growth of SKMM1 xenografts intratumorally -treated with NLE (MaxSuppressor [TM] In Vivo RNA-LANCER II)-miR-29b or controls. [score:3]
Tumor suppressive role of miR-29b has been previously reported in solid tumors [24, 44] and haematologic malignancies [45], although it remains controversial in CLL [46]. [score:3]
All together, these findings indicate that miR-29b exerts anti-tumor activity in vivo, providing a strong rationale for clinical development of synthetic miR-29b mimics in MM. [score:2]
Approximately one month later, when sIL6R became detectable in mice sera, NLE-miR-29b or -NC were injected directly into the scaffold (total of 7 injections, 2 days apart). [score:2]
A follow-up study will shade light on TSGs under miR-29b regulation by DNA-methylation control. [score:2]
To investigate the relationship between the miRNA network and de novo DNMTs in MM, we studied the regulatory role of miR-29b on DNMTs expression and global DNA methylation in MM cells. [score:2]
MiR-29b targets DNMT3A and DNMT3B and reduces global DNA methylation levels in MM cells. [score:2]
Interestingly, the integrated analysis of miRNA/mRNA profiling revealed an inverse correlation between miR-29b and DNMT3B in a panel of 17 MM cell lines, underscoring a key role of miR-29b on DNMT3B regulation. [score:2]
Then, we studied the effects induced by synthetic miR-29b mimics, alone or in combination with the demethylating agent 5-azacitidine, on cell growth and cell cycle regulation of MM cells. [score:2]
miR-29b expression was normalized on RNU44 (Applied Biosystems, Assay Id 001094). [score:2]
Notably, miR-29b mimics resulted in epigenetic changes, as demonstrated by an approximately 2-fold decrease in global DNA methylation in MM cells. [score:1]
The global DNA methylation levels of MM cell lines transfected with syntehtic miR-29b mimics or scrambled oligonucleotides (NC) were estimated according to our previous report [33]. [score:1]
Inverse correlation between miR-29b and DNMT3B in MM cell lines. [score:1]
Immunoblot of DNMT3A and DNMT3B 24 hours after transfection of INA-6 with synthetic miR-29b or scrambled oligonucleotides (left panel) or in SKMM1 cells transduced with antagomiR-29b (anti-miR-29b) or the empty vector (right panel). [score:1]
In the present report, we also provide insights into biological effects triggered by synthetic miR-29b mimics in vitro and in vivo. [score:1]
The in vivo anti-tumor potential of miR-29b was demonstrated in different clinically relevant murine mo dels of human MM. [score:1]
Inverse correlation between miR-29b and DNMT3B levels in MM cell lines. [score:1]
P values 72hours after electroporation were obtained using two-tailed t test (P= 0,0039 for NC vs miR-29b; P=0,0028 for NC+AZA vs miR-29b+AZA). [score:1]
Quantitative RT-PCR of miR-29b levels in INA-6 cells transfected with synthetic miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
In vivo analysis of miR-29b-effects in the SCID-synth-hu mo del. [score:1]
NLE-formulated miR-29b or NC were injected in groups of three animals, after detection of sIL6R in the mouse sera. [score:1]
Cell cycle analysis of NCI-H929 cells transfected with synthetic miR-29b mimics or scrambled oligonucleotides (NC) and then treated with 5μM azacitidine (5-AZA) or vehicle for 24, 48 or 72 hours. [score:1]
Figure 2A shows miR-29b levels after transfection. [score:1]
Quantitative RT-PCR of miR-29b levels in retrieved xenografts after intratumor injection of miR-29b mimics or scrambled oligonucleotides. [score:1]
To assess the relevance of the interaction between miR-29b and de novo DNMTs, we analyzed the correlation between miR-29b and DNMT3A or DNMT3B mRNA levels in a panel of 17 MM cell lines. [score:1]
SKMM1 MM cells were injected in a cohort of 15 mice and when tumors became palpable, mice were randomized into 3 groups and treated intratumorally with synthetic miR-29b mimics, miR-NC or vehicle alone. [score:1]
Mice carrying palpable subcutaneous OPM1 tumor xenografts were treated with 20 μg of NLE-formulated miR-29b or scrambled oligonucleotides (NC) by intravenous tail vein injections (arrows indicate the day of injection). [score:1]
GDMi values of U266 and NCI-H929 cells transfected with synthetic miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
In this mo del, delivery of systemic miR-29b mimics induced significant anti-tumor effects, as demonstrated by immunohistochemical analysis of retrieved scaffolds, demonstrating the ability of miR-29b to overcome the protective role of BMSCs. [score:1]
Following 3 injections (3 days apart), a significant anti-tumor effect of NLE-formulated miR-29b was detected (Fig. 5C). [score:1]
In vivo anti-tumor activity of miR-29b mimics after intratumoral or systemic delivery in MM mouse-mo dels. [score:1]
Synthetic miR-29b mimics exert anti-MM activity in vivo. [score:1]
MiR-29b levels after transfection are reported in supplemental Fig. 3. As shown in Fig. 2E, miR-29b transfection resulted in a robust reduction of the global methylation levels of MM cell lines, thus supporting its role in the epigenetic control of MM cells. [score:1]
Our findings demonstrate that the delivery of synthetic miR-29b mimics exerts anti-MM activity in vivo. [score:1]
1×10 [6] cells were electroporated with scrambled (miR-NC) or synthetic pre-miR-29b (miR-29b) at a final concentration of 100nM, using Neon® Transfection System (Invitrogen), with 1050 V, 30 ms, 1 pulse. [score:1]
Data are the average of two independent triplicate experiments performed on two NC and two miR-29b injected animals °P<0,01. [score:1]
Quantitative RT-PCR of DNMT3A or DNMT3B in retrieved xenografts after system injection of miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
Our experimental platform was based on xenografts of MM cells that were exposed to synthetic miR-29b mimics delivered via NLE, a novel lipid -based delivery system. [score:1]
MM cells were electroporated as above described using 10μg of the firefly luciferase report; for each plate, 100 nM of the synthetic miR-29b or miR-NC were used. [score:1]
Moreover, miR-29b mimics appear a promising agent in the treatment of MM, alone or in combination with demethylating drugs. [score:1]
Synthetic miR-29b mimics impair cell cycle progression and potentiate 5-azacitidine effects. [score:1]
Xenografted mice were randomized to receive synthetic miR-29b or miR-NC (1mg/kg per mouse), each formulated with NLE particles, via tail vein. [score:1]
Quantitative RT-PCR of DNMT3A and DNMT3B 24 hours after transfection with synthetic miR-29b or scrambled oligonucleotides (NC) in INA-6 cells. [score:1]
These findings also suggested that miR-29b could induce epigenetic modifications in cancer cells. [score:1]
Data are the average of two independent triplicate experiments performed on two NC and two miR-29b injected animals. [score:1]
Cell growth curves of NCI-H929 cells transfected with synthetic miR-29b (miR-29b) or scrambled oligonucleotides (NC) with 5μM azacitidine (5-AZA) or vehicle (RPMI medium). [score:1]
Data are the average of two triplicate experiments performed on two NC and two miR-29b injected animals. [score:1]
Quantitative RT-PCR of miR-29b levels in retrieved xenografts after system injection of miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
Mice were randomized in 3 groups and treated with synthetic miR-29b mimics or miR-NC or vehicle alone or PBS. [score:1]
In a first mo del, we explored the in vivo anti-tumor potential of miR-29b on MM xenografts in SCID mice by intratumor delivery of synthetic miR-29b -mimics. [score:1]
Palpable subcutaneous tumor xenografts were treated every 3 days (indicated by arrows) for a total of 4 injections, with 20 μg of formulated miR-29b or miR-NC (NC). [score:1]
In vitro transfection of MM cells with synthetic miR-29b. [score:1]
We next explored the potential anti-tumor activity of systemic delivered formulated miR-29b mimics. [score:1]
To achieve an efficient delivery of miR-29b or miR-NC, we formulated synthetic miR-29b -mimics with NLE particles [28], a novel in vivo delivery system for oligonucleotides. [score:1]
In vivo tumor growth of OPM1 xenografts after systemic delivery of miR-29b or scrambled oligonucleotides (NC). [score:1]
Consistently, miR-29b transfection reduced DNMT3A and DNMT3B mRNA (Fig. 2C) and protein levels (Fig. 2D, left panel), as assessed by q-RT-PCR and western blotting analysis. [score:1]
[1 to 20 of 79 sentences]
23
[+] score: 146
Although miR-29b leads to an up-regulation of the early activation marker CD69 in splenic CD4 [+] and CD8 [+] T-cells in BALB/c mice in vivo, a direct impact of miR-29b on transferred CD8 [+] lymphocytes seems unlikely because miR-29b is administered eighteen hours before T-cells and has probably reached target cells before injection of effector T-cells. [score:7]
During the first phases of autoimmune diabetes in NOD mice, miR-29b expression increases with age and immune cell infiltration in islet cells, contributing to beta cell apoptosis by targeting the antiapoptotic protein Mcl1 [25]. [score:5]
The expression of miR-29b in islet cells increases with age in the spontaneous Non-Obese Diabetic (NOD) mouse mo del of autoimmune diabetes and an over -expression of miR-29b is observed in mouse and human islet cells following exposure to pro-inflammatory cytokines [25]. [score:5]
In our hands, a significant up-regulation of H-2Kd was observed when comparing miR-29b with miR-127. [score:4]
Among identified physiological functions of miR-29b figure proapoptotic regulation of cellular homeostasis, suppression of immune responses to intracellular pathogens [46], [47] or silencing of the beta cell specific monocarboxylate transporter 1 possibly involved in insulin secretion [24]. [score:4]
For miR-29 knockdown, locked nucleic acid (LNA) miRNA-29 family inhibitor and LNA negative control were purchased from Exiqon (Exiqon, Vedbaek, Denmark). [score:4]
Pre-treatment of effector CD8 [+] T-cells with miR-29b before adoptive transfer does not change disease incidenceA direct effect of miR-29b on effector CD8 [+] T-cells was explored using a pre-treatment with miR-29b in vitro prior to transfer to Ins-HA mice (S5 in File S1). [score:4]
To determine whether miR-29b stimulation relies on TLR-7, we used the immune-regulatory sequence IRS661, a competitive inhibitor of TLR-7 binding [28]. [score:4]
In the pDC CD11c [low]CD11b [−]B220 [+] population (Fig. 4B), the CD40 and CD86 markers were also significantly up-regulated after miR-29b injection (p<0.05). [score:4]
However, IL-10 secretion by NOD splenocytes does not significantly diminish after LNA-miR-29 inhibition in exosomes, suggesting either a miR-29b independent mechanism, delayed kinetics or masking by the complex exosomal composition. [score:3]
MiR-29b parenteral administration is accompanied by an increase in serum IFNa, in parallel to the up-regulation of co-stimulatory molecules (CD40, CD86) and MHC class I molecules (H-2Kd) on conventional mDCs and pDCs. [score:3]
In the mDC CD11c [+]CD11b [+]B220 [−] population (Fig. 4A), miR-29b injection induced the up-regulation of CD40 and CD86 (B7-2) activation markers, as well as of the MHC class I molecule H-2Kd, compared to miR-127 and siRNA9.1 -injected mice (p<0.05). [score:3]
To determine whether exosomal miR-29b is engaged in the stimulation of cytokine secretion of NOD immune cells, MIN6 exosomes were transfected with a LNA-miR-29 family inhibitor. [score:3]
TNFa was detected in vitro following miR-29b stimulation of bmDCs and RAW264.7 cells, and MIN6 exosome treatment of NOD spleen cells, and may be implicated in the delayed disease onset observed in our mouse mo del. [score:3]
In vivo, the systemic delivery of miR-29b dampens antigen-specific T-cell responses and reduces disease incidence in a murine mo del of adoptive transfer of autoimmune diabetes. [score:3]
The endogenous miR-29b, one of the three isoforms of the miR-29 family, is expressed at high levels in pancreatic islet cells [24]. [score:3]
Preliminary data obtained using a pDC-depleting antibody before miR-29b administration led to a >80% decrease in IFNa concentration (from 343 pg/ml to 57 pg/ml) (S2 in File S1), suggesting a direct or indirect effect of miR-29b on pDC -mediated production of IFNa in vivo. [score:3]
TNFa secretion is impaired in the presence of miR-29 inhibitors. [score:3]
Pre-treatment of effector CD8 [+] T-cells with miR-29b before adoptive transfer does not change disease incidence. [score:3]
In support of this idea, in vitro pre-treatment of CD8 [+] T-cells with miR-29b does not alter disease incidence following transfer in vivo. [score:3]
In a murine mo del of adoptive transfer of diabetes mediated by antigen-specific CTLs, we show that synthetic miR-29b systemic delivery prevents disease onset. [score:3]
Induction of IL-10 secretion by bmDCs in our experiments fits with the overall immunosuppressive effect observed after systemic miR-29b treatment. [score:3]
A direct effect of miR-29b on effector CD8 [+] T-cells was explored using a pre-treatment with miR-29b in vitro prior to transfer to Ins-HA mice (S5 in File S1). [score:2]
In vivo, we provide evidence that miR-29b indirectly weighs on effectors of adaptive immunity. [score:2]
Our hypothesis is that beta-cell miRNAs like miR-29b impact autoimmune responses by recruiting innate immune cells through receptor-ligand interactions, in addition to their important regulatory role. [score:2]
MiR-29b inhibits in vivo adoptive transfer of autoimmune diabetes by CD8 [+] T-cells. [score:2]
To discriminate between RNAi -mediated immune effects and direct immune stimulation, 2′-O-Me modifications were introduced in each uridine base on the reverse strand of the miR-29b sequence (Fig. 2A). [score:2]
Whether the exogenous miR-29b enters the endosomal pathway was studied using confocal microscopy in RAW264.7 cells. [score:1]
As chloroquine does not affect cell viability at the working concentration used (data not shown), this result points to the involvement of the endosomal pathway in the miR-29b’s immune activity. [score:1]
Endogenous miR-29b released in beta cell exosomes elicits immune responses in vitro. [score:1]
Three miRNA sequences, namely miR-29b, miR-7a, and miR-376a induced IL-12 secretion (Fig. 1A) and enhanced basal TNFa secretion (Fig. 1B), exceeding levels obtained for LPS and siRNA9.2 [21] positive controls. [score:1]
Briefly, 1 to 10×10 [5] activated HA–specific CD8 [+] T-cells from CL4-TCR mice were transferred to Ins-HA recipient mice previously injected with miR-29b, miR-127, or HBS negative control (Fig. 3A). [score:1]
In vitro generated beta-cell exosomes enclose specific miRNA sequences including miR-29b. [score:1]
In contrast to the control TLR-7- agonist R848, no IL-12 secretion was observed following miR-29b delivery. [score:1]
The cytokine profile in serum was completed by testing the effect of the miR-29b on IL-1b, IL-6, IL-10, IL-12 and TNFa secretion, two or seven hours following its injection in BALB/c mice. [score:1]
The mature miRNAs miR-16 and miR-29b are also present in immune cells (DCs and T- and B-lymphocytes) and in other cell types (alpha pancreatic cells, neuroblasts, kidney duct cells, testis/ovary…). [score:1]
In our hands, the forward and reverse miR-29b strands induced similar TNFa secretion than their double-stranded counterpart. [score:1]
How miR-29b reduced disease incidence was investigated by in vivo cytotoxicity experiments (Fig. 3B). [score:1]
In this context, our description of miR-29b acting as a TLR-7 ligand raises the question of the putative role of beta-cell miRNAs in the initiation and progression of T1D. [score:1]
One hour after transfection, an ALEXA-488-labeled miR-29b co-localizes with the endosomal markers Early Endosomal Antigen 1 protein (EEA-1) and lysotracker (Fig. 2B). [score:1]
In RAW264.7 cells, IRS661 reduced miR-29b -induced TNFa secretion by 80% (Figure 2D). [score:1]
As shown in Fig. 1F and Table 1, miR-29b but not miR-127 greatly albeit transiently stimulated IL-6 and TNFa secretion in sera two hours after injection. [score:1]
0106153.g002 Figure 2(A) 2′-O-methyl modifications were introduced in all uracil residues of the miR-29b reverse strand as indicated. [score:1]
Hence, the immunogenic miR-29b was selected in pursuit of these results for more in depth analysis of the underlying immune modulatory mechanisms. [score:1]
These results demonstrate that injection of miR-29b leads to maturation of antigen-presenting and effector cells. [score:1]
In RAW264.7 macrophages, exosome -induced TNFa secretion is dose -dependent (p<0.01 and p<0.0001 at the concentration of 10 and 20 µg/ml respectively, Fig. 5C), recalling dose-responses observed for the miR-29b analogue (S1 in File S1). [score:1]
In human, the level of circulating miR-29b is increased in children with newly diagnosed T1D [12]. [score:1]
BALB/c mice were injected intravenously with miR-29b, miR-127, or siRNA9.1. [score:1]
Yet, 2′-O-Me modifications in the miR29b sequence led to a significant drop in TNFa secretion by RAW264.7 cells (p<0.05), close to control levels, indicating a RNAi-independent process (Fig. 2A). [score:1]
This result suggests the existence of intermediary cellular effectors operative in the protective effect of miR-29b, in line with the results compiled from in vitro bmDC experiments, IFNa levels in serum (Fig. 1), and preliminary results from in vivo pDC-depletion experiment (S2 in File S1). [score:1]
Ins-HA mice were treated intravenously with miR-29b, miR-127, HBS buffer or DOTAP alone, eighteen hours before receiving HA-specific CTLs from CL4-TCR mice. [score:1]
MiR-29b reduces the cytolytic activity and persistence of effector CD8 [+] T-cells in vivo How miR-29b reduced disease incidence was investigated by in vivo cytotoxicity experiments (Fig. 3B). [score:1]
9±32.0 nd 26.5±21.0 3.1±6.2 Cytokine content in serum from BALB/c mice was analysed by a BD Cytometric Bead Array two and seven hours following intravenous injection of miR29b, the immune-silent miR-127 or positive (R848) or negative (HBS) controls. [score:1]
The survival curves and table summarize the results of five independent experiments after transfer of 1 to 10×10 [5] cells, with miR-29b -injected mice as filled symbols, and HBS -injected mice as empty symbols. [score:1]
Mouse macrophage stimulation by miR-29b involves endosomal TLR-7, independently of RNA interference. [score:1]
In accordance, insulitis seems less invasive in miR-29b recipient mice, although differences in the homing of CD8 [+] T-cells to the PLNs do not reach statistical significance. [score:1]
0106153.g003 Figure 3Systemic delivery of miR-29b protects against adoptive transfer of T1D in vivo. [score:1]
In a preliminary experiment, administration of a pDC-depleting antibody before miR-29b injection abrogates IFNa secretion in vivo, consistent with a contribution of pDCs. [score:1]
In contrast, only 83% of miR-29b -treated mice became diabetic after the injection of 1×10 [6] T-cells (p<0.03), and no diabetes was observed after transfer of 1×10 [5] T-cells (p<0.01). [score:1]
The presence of beta cell miRNAs i. e. miR-375, miR-29b, and miR-7a in MIN6 exosomes was confirmed by RT-qPCR (S6C in File S1). [score:1]
A possible explanation for this decrease in miR-29b -injected mice may be a deletion of effector CD8 [+] T-cells. [score:1]
As shown in S3 in File S1), 2′-O-Me modifications do not impact the RNAi activity of the miR-29b analogue. [score:1]
RAW264.7 cells were plated four hours before stimulation with DOTAP-embedded miR-29b, 2′-O-Me -modified miR-29b, or the control miR-127 (750 nM working concentration). [score:1]
Systemic delivery of miR-29b protects against adoptive transfer of T1D in vivo. [score:1]
MiR-29b inhibits in vivo adoptive transfer of autoimmune diabetes by CD8 [+] T-cellsWith the aim to investigate the effect of the miR-29b analogue on T-cell effector functions in vivo, we used the Ins-HA transgenic mouse mo del of autoimmune diabetes [14]. [score:1]
Splenic mDC and pDC activation by miR-29b in vivo. [score:1]
A significant drop in TNFa secretion by NOD spleen cells treated with miR-29b knockdown exosomes compared to controls (p<0.01, Fig. 5D) was observed. [score:1]
For each marker, graphs represent the relative fluorescence intensity (RFI) of individual mice in two independent experiments (n = 3 mice for miR-29b and siRNA9.1, n = 4 mice for miR-127), and are representative of two other independent experiments. [score:1]
IL-6: P<0.05 for miR-29b vs miR-127 and miR-127 vs R848; IL-12: P<0.05 for miR-127 vs R848 (Kruskal-Wallis). [score:1]
Interestingly, secretion of the anti-inflammatory cytokine IL-10 was also observed for miR-29b and miR-7a (Fig. 1C). [score:1]
0106153.g004 Figure 4Splenic mDC and pDC activation by miR-29b in vivo. [score:1]
Finally, pancreatic islet infiltration four days after transfer is less invasive in miR-29b treated mice as shown by histological analysis (Fig. 3E). [score:1]
In conclusion, miR-29b was able to decrease the antigen-specific pathogenic activity of effector CD8 [+] T-cells and to confer protection against diabetes outbreak. [score:1]
We describe here that miR-29b exerts dose -dependent immune modulatory effects, in contrast with other miRNA sequences, arguing in favour of a sequence -dependent mechanism. [score:1]
are presented as the mean percentage of n = 5 mice for miR-29b, n = 3 for miR-127, and n = 4 mice in the HBS group from three independent experiments. [score:1]
Again, miR-29b, miR-7a and miR-376a stimulated IFNa production in sera of treated mice, in contrast to miR-127 and miR-210. [score:1]
Using the TLR-7 antagonist IRS661 [28] or chloroquine to impair TLR activation in the endosome, we show that miR-29b sensing involves the TLR-7 pathway. [score:1]
In contrast, a specific lysis of only 13.8±7.3% occurred in miR-29b mice (p<0.05 versus miR-127 and p<0.01 versus DOTAP). [score:1]
Stimulation of the TLR-7 pathway by miR-29b in murine RAW264.7 macrophages. [score:1]
2′-O-Me modifications were introduced in the miR-29b reverse strand before annealing to the unmodified guide strand. [score:1]
Using a LNA miR-29 antagonist, we show that miR-29 molecules shuttled in MIN6 exosomes are immunologically active and significantly weigh on the induction of TNFa secretion in NOD spleen cells. [score:1]
These data suggest that miR-29b alleviates diabetes through decreased cytolytic activity of the injected CTLs. [score:1]
Like miR-29b, other endogenous miRNA sequences activating TLR-signalling may provide new insights into the mechanisms underlying inflammatory and autoimmune conditions opening the way for new applications for miRNA mimics in immune-interventions. [score:1]
[1 to 20 of 83 sentences]
24
[+] score: 140
Consistent with Tet1 knockdown, ESCs expressing pri-miR-29a/b-1 showed a similar expression pattern of these early differentiation markers (Figure 3G), which further confirmed that miR-29 could negatively regulate Tet1 expression in ESCs. [score:9]
In this study, we screened a panel of miRNAs which were predicted to target Tet1 and found that miR-29 family members (including miR-29a, miR-29b and miR-29c) can target Tet1 at 3′UTR and repress its expression directly. [score:8]
miR-29 negatively regulates Tet1 expression in mouse ESCs and promotes upregulation of trophoblast lineages markers. [score:7]
Consistently, Lin et al. have also elucidated the roles of feedback of miR-29-Tet1 downregulation in hepatocellular carcinoma development, Thus, miR-29-Tet signaling may serve as potential target for the prognosis of cancers developing. [score:7]
miR-29 negatively regulates Tet1 expression in mouse ESCs and promotes the upregulation of trophoblast lineages markers. [score:7]
Unfortunately, since there are 3 members in miR-29 family, it will be difficult and laborious to knockout all these miRNAs using traditional gene targeting strategy, such as homology recombination mediated gene targeting. [score:6]
Here we show that miR-29 family members can negatively regulate Tet1 expression via direct binding to its 3′UTR, which was also reported in two papers recently [36, 44]. [score:5]
Our data also highlight miR-29 as a potential therapeutic target in treating Tet1-related human diseases. [score:5]
We further documented that miR-29 overexpression in ESCs caused a similar phenotype as Tet1 knockdown. [score:4]
We found that Tet1 was highly expressed in mouse ESCs and decreases during the early differentiation, and was partially regulated by miR-29. [score:4]
Taken together, all these in vitro data showed that miR-29 family can target Tet1 via direct binding to its 3′UTR. [score:4]
We found that the cell line overexpressing pri-miR-29a/b-1 showed the highest level of miR-29 family members (Figure 3B), while the cell line overexpressing pri-miR-29b-2/c showed a moderately high level of miR-29 family members compared to the control cell line, but there was no statistical difference between the two cell lines (Figure 3B). [score:4]
Previous research has reported that miR-29 could directly target both DNA methyltransferases 3A and 3B and is involved in DNA methylation [46]. [score:4]
Recent studies have found that Oct 4 could be replaced by Tet1 during induced pluripotent stem cell (iPSC) induction [47], we compared the expression of miR-29 between fibroblast and ESCs and found that miR-29 was expressed highly in fibroblasts but decreased heavily in ESCs (data not shown), which was contrary to the change of Tet1. [score:4]
Moreover, recent research findings have suggested that miR-29 may directly regulate Tet protein and is involved in cancer progression. [score:3]
We found that there were a few miRNAs predicted to target Tet1: miR-106a, miR-106b, miR-17, miR-183, miR-20a, miR-20b, miR-26b, miR-29a, miR-29b, miR-29c, miR-302b, miR-372, miR-7a and miR-93. [score:3]
miR-29 overexpressed ESCs showed a reduced level of 5hmC and upregualted levels of several early differentiation markers, which was consistent with Tet1 loss-of-function ESCs. [score:3]
To verify whether miR-29 overexpression could cause a similar effect on ESCs, we analyzed several markers of early differentiation via RT-qPCR. [score:3]
The psiCheck2 luciferase vector containing wild-type or mutant Tet1 3′-UTR was co -transfected with miR-29a or miR-29b or miR-29c or NC mimics or inhibitors (Genepharma), or pre-miR-29a or pre-miR-29a/b1 or pre-miR-29b2/c or pL KO. [score:3]
Recent studies have suggested that miR-29 family could target at Tet1 and is involved in the pathogenesis of human malignancies [36– 38]. [score:3]
In addition, miR-29a and miR-29b were also reported to function as tumor suppressors in leukogenesis [49– 51]. [score:3]
We firstly determined the miR-29 family member expression in these cell lines. [score:3]
We found that miR-29 family (miR-29a, miR-29b and miR-29c) and miR-183 significantly inhibited the relative luciferase activity while miR-20b increased the relative luciferase activity (Figure 1A). [score:3]
These data suggest miR-29 is a direct regulator of Tet1 and may provide potential strategies for cancer diagnosis and therapy. [score:3]
To further verify the repressive impacts of miR-29 on Tet1 expression in mouse ESCs, we established cell lines stably transfecting with miR-29 precursors. [score:3]
As expected, the Tet1 mRNA levels were reduced in three miR-29 overexpressing ESCs (Figure 3C), with pri-miR-29a/b-1 showed the best effect on Tet1 repression. [score:3]
In summary, our study proves miR-29 as a direct regulator of Tet1 and provides possible mechanisms on how miR-29 and Tet1 interact and play bio-functions. [score:3]
To elucidate the significance of miR-29 targeting Tet1, we examined Tet1 mRNA and miR-29a/b/c levels during the early differentiation of mouse ESCs. [score:3]
In addition, the novel epigenetic approaches for inhibiting miR-29 or modifying TET -mediated signaling pathways may have important implications for cancer therapy. [score:3]
However, whether miR-29 mediated Tet1 suppression is required for ESC differentiation is not elucidated here. [score:3]
We constructed three miR-29 overexpressed vectors, pri-miR-29a, pri-miR-29a/b-1 and pri-miR-29b-2/c, and confirmed their activities by dual luciferase reporter assay (Figure 3A). [score:2]
To answer this question, miR-29 knockout ESC should be established. [score:2]
Takayama K et al. have revealed a novel divergent function of miR-29 as a crucial epigenetic regulator that represses TET2 in cancer progression [55]. [score:2]
Whether miR-29 promotes DNA methylation or demethylation may be determined by amount of miR-29 in a cell or interaction with other regulators. [score:2]
As some certain miRNAs have been proved to promote reprogramming of somatic cells to pluripotency more efficiently [48], whether controlling the expression of Tet1 via miR-29 may help to iPSC induction requires further investigation. [score:1]
Additionally, our present study further elucidated the biological significances of this relationship between miR-29 and Tet1. [score:1]
Tet1 3′UTR contains 8 putative binding sites to miR-29a/b/c (Figure 1C), we mutated “seed region” in these sites and found that miR-29 mimics were unable to reduce the relative luciferase activity (Figure 1D). [score:1]
We firstly demonstrated the direct regulation of Tet1 by miR-29 in vitro, and then we investigated the role of miR-29 in mouse ESCs and confirmed that Tet1 was repressed by miR-29 during the early differentiation of mouse ESCs. [score:1]
miR-29 family members are encoded by two gene clusters in the genome: miR-29a/b-1 and miR-29b-2/c [42, 43]. [score:1]
In this study, we found that miR-29 negatively regulated Tet1 and promoted the generation of 5hmC, which is considered to be an intermediate product in the process of DNA demethylation. [score:1]
[1 to 20 of 40 sentences]
25
[+] score: 120
Disrupting the Na/K-ATPase-related signaling and inhibition of Src activation by pNaKtide increased miR-29b-3p expression in heart tissue and thus attenuated cardiac fibrosis in these animals. [score:5]
C): mRNA expression of miR-29b-3p targeted genes: collagen 1A1 (Col1a1), matrix metalloproteinase-2 (Mmp2), fibrillin 1 (Fbn1), and elastin (Eln). [score:5]
More recently, we found that mimicry of miR-29b-3p can prevent CTS -induced collagen synthesis in cardiac fibroblasts [31], indicating that an increase in miR-29b-3p expression is a potential therapeutic treatment strategy for fibrosis-related diseases. [score:5]
We also found that in isolated cardiac fibroblasts, treatment with ouabain, a Na/K-ATPase ligand, induced decreases in miR-29b-3p and increased collagen expression, whereas blocking the Na/K-ATPase related signaling pathway restores miR-29b-3p levels and mitigated collagen expression in these cells [31]. [score:5]
As a transcription factor, NFκB can form a complex with Sp1 and HDAC and directly bind to the regulatory sequence of the miR-29b-3p gene, causing decreased expression of miR-29b-3p [40]. [score:5]
It has been previously reported that Na/K-ATPase regulates Src [28, 34] and NFκB signaling [38, 39], while both Src and NFκB are known to regulate miR-29b-3p expression [31, 40]. [score:5]
Treatment with pNaKtide inhibits Src activation and antagonizes PNx -induced cardiac fibrosis by increasing miR-29b-3p expression in heart tissue from CKD mice. [score:5]
Expression of miR-29b-3p was presented as fold regulation relevant to WT sham animals. [score:4]
Canonical Transforming Growth Factor-beta Signaling Regulates Disintegrin Metalloprotease Expression in Experimental Renal Fibrosis via miR-29. [score:4]
The current study was designed to test the in vivo effect of Na/K-ATPase signaling in regulating the expression of miR-29b-3p and tissue fibrosis in a mouse mo del of CKD. [score:4]
The effect of NFκB inhibitor on ouabain -induced miR-29b-3p regulation in cardiac fibroblasts isolated from WT and α1+/- mice. [score:4]
As shown in Fig 4A, ouabain alone induced a decrease in miR-29b-3p expression in a dose -dependent manner in fibroblasts isolated from WT mice and the decrease of miR-29b-3p can be blocked by Bay11-7082, suggesting that NFκB is involved in Na/K-ATPase mediated miR-29b-3p regulation. [score:4]
Quantification of miR-29b-3p expression was performed as previously described [31, 37]. [score:3]
miR-29b as a therapeutic agent for angiotensin II -induced cardiac fibrosis by targeting TGF-beta/Smad3 signaling. [score:3]
Injection of pNaKtide in sham-operated mice caused a slight increase in miR-29b-3p expression, but it was not statistically significant. [score:3]
In addition, our in vitro data showed that pNaKtide treatment prevented excessive collagen synthesis by restoring endogenous miR-29b-3p expression to levels close to non -treated controls [31]. [score:3]
However, in cardiac fibroblasts isolated from α1+/- mice, ouabain failed to induce the change in miR-29b-3p levels, and the NFκB inhibitor had no effect either (Fig 4B). [score:3]
PNx -induced miR-29b-3p expression change in WT and α1+/- mice. [score:3]
The pNaKtide has been reported as an inhibitor of Na/K-ATPase related Src signaling [41, 42], which prevents ouabain -induced reduction of miR-29b-3p in isolated cardiac fibroblasts [31]. [score:3]
To test the effect of pNaKtide on miR-29b-3p expression and cardiac fibrosis in CKD mice, we performed PNx or sham surgery on WT mice and α1+/- mice. [score:3]
Injection of pNaKtide diminishes PNx -induced decrease in miR-29b-3p expression. [score:3]
In α1+/- mice, pNaKtide slightly increased miR-29b-3p expression in heart tissue. [score:3]
To test if the above changes in Src activation and miR-29b-3p expression correlate with cardiac tissue fibrosis, formalin-fixed left ventricle tissue was analyzed using Trichrome staining as described in the Materials and Methods section. [score:3]
These results of NFκB expression and activation are consistent with the observation of miR-29b-3p changes in WT and α1+/- mice, suggesting that activation of Src and NFκB may mediate the PNx -induced reduction of miR-29b-3p in WT mice. [score:3]
Reduction of Na/K-ATPase α1 caused a deficiency in Src and NFκB activation, and CKD caused no significant changes on miR-29b-3p expression in these animals. [score:3]
Consistently, as shown in Fig 6, we found that injection of pNaKtide in WT mice significantly increased miR-29b-3p expression in heart tissue compared to that in PNx alone group. [score:2]
To further determine the role of NFκB in Na/K-ATPase mediated miR-29b-3p regulation, we used isolated cardiac fibroblasts from WT as well as α1+/- mice. [score:2]
In addition, we found that even though Na/K-ATPase reduction in α1+/- mice caused a deficiency in Na/K-ATPase signaling and prevented miR-29b-3p dysregulation, it did not completely block PNx -induced cardiac fibrosis, suggesting that other pathways also contribute to the formation of cardiac fibrosis in this mo del. [score:2]
Na/K-ATPase regulates miR-29b-3p through activation of Src and NFκB in CKD mice. [score:2]
However, an interesting observation is that even though the basal level of Src phosphorylation and NFκB activation is higher in heart tissue from α1+/- mice compared to their WT littermates, the miR-29b-3p expression was not significantly different between these animals. [score:2]
We have previously demonstrated that Src activation is involved in Na/K-ATPase regulated miR-29b-3p in isolated cardiac fibroblasts [31]. [score:2]
In summary, the current study demonstrate that Na/K-ATPase signaling is an important mediator that regulates miR-29b-3p, which contributes to the formation of cardiac fibrosis in the setting of CKD. [score:2]
The data from α1+/- mice also demonstrated that miR-29b-3p regulation requires Na/K-ATPase signaling activation. [score:2]
Na/K-ATPase is involved in the regulation of miR-29b-3p and cardiac fibrosis in CKD animals. [score:2]
We also measured the potential targets of miR-29b-3p such as collagen 1A1, matrix metalloproteinase-2 (Mmp-2), fibrillin 1 (Fbn1), and elastin (Eln). [score:1]
When miR-29b-3p was measured by RT-qPCR using total RNA extracted from left ventricle tissue, we found that PNx decreased miR-29b-3p levels by about 2 fold in WT mice (0.89±0.14 in sham vs 0.46±0.08 in PNx, p<0.01), whereas in α1+/- mice the basal level of miR-29b-3p was slightly lower than that in WT mice, but PNx surgery caused no significant changes in miR-29b-3p expression (Fig 1B). [score:1]
Total RNA was extracted from the cell lysates and miR-29b-3p level was quantified using RT-qPCR as described previously [31]. [score:1]
Calculation of miRNA expression was conducted by comparing the relative change in cycle threshold value (ΔCt) between miR-29-3p and the internal control, RNU6 (Cat No. [score:1]
B): Expression of miR-29b-3p measured by RT-qPCR in left ventricle tissue from experimental mice. [score:1]
Expression of miR-29b-3p was measured using RT-qPCR in RNA isolated from cells from WT animals (A) and α1 +/- animals (B). [score:1]
Urinary miR-21, miR-29, and miR-93: novel biomarkers of fibrosis. [score:1]
Studies have shown that reduction of miR-29b-3p can cause fibrosis in heart, lung, liver, skin and kidney, while increase of miR-29b-3p prevents tissue fibrosis [7, 8, 16– 19]. [score:1]
[1 to 20 of 42 sentences]
26
[+] score: 113
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Furthermore, we confirmed that IL-6 participates in the regulation of HG induced collagen production of CFs by enhancing the expression of TGFβ1 and inhibiting the expression of miR-29. [score:8]
In consistent, we found that overexpression of miR-29 cancelled the pro-fibrotic effects of IL-6 in cultured CFs and inhibited the expression of TGFβ1. [score:7]
We found that forced overexpression of miR-29 abrogated IL-6 induced collagen I and III production, while knockdown of miR-29 expression with AMO-29 did the opposite (Fig. 7C,D). [score:6]
Van Rooij E et al. demonstrated that miR-29 produced anti-fibrotic effect by directly inhibiting the expression of collagen I and III 13. [score:6]
Suppression of miR-29 upregulation may be one of the mechanisms responsible for the deleterious role of IL-6 in diabetic cardiomyopathy. [score:6]
Moreover, a recent study demonstrated that miR-29 inhibited angiotensin II -induced cardiac fibrosis by targeting TGF-β/Smad3 signaling 24. [score:5]
These data indicated that the expression of miR-29 in CFs is regulated by IL-6. We then explored the regulatory role of miR-29 in IL-6 induced proliferation and collagen production of CFs. [score:5]
The data showed that high glucose treatment increased the level of miR-29, which was further up-regulated when IL-6 was deleted (Fig. 8A). [score:4]
These data indicated that upregulation of miR-29 represents a protective response of the hearts to diabetic stimuli, which were compromised by the production of IL-6. The potential signaling pathway of IL-6 in DCM was summarized in Fig. 9. In conclusion, we demonstrated that IL-6 deletion is beneficial against DCM by alleviating interstitial fibrosis. [score:4]
miR-29 also regulates the expression of TGFβ1 (Fig. 7E). [score:4]
These data implied that upregulation of miR-29 may be protective response of the hearts to diabetic stimuli. [score:4]
We found that the level of miR-29 were significantly upregulated in cultured CFs of IL-6 KO mice that WT controls (Fig. 7A). [score:4]
The successful overexpression and knockdown of miR-29 were confirmed by qRT-PCR (Fig. 7B). [score:4]
Up-regulation of miR-29 in diabetic heart is compromised by IL-6 increment. [score:4]
We firstly tested the influence of IL-6 on miR-29 expression. [score:3]
These data indicated that inhibition of miR-29 also contributes to the profibrotic effects of IL-6 on CFs. [score:3]
When the cells grew to 60% confluence, they were treated with IL-6 cytokines (50 pg/ml) and transfected with miR-29 mimics (miR-29), miR-29 inhibitor (AMO29) or negative control (Scramble) using X-tremeGENE siRNA Transfection Reagent (Roche, Germany). [score:3]
Synthesis and transfection of miR-29 and anti-miR-29 antisense inhibitor. [score:3]
miR-29a and its inhibitor anti-miR-29 (AMO-29) were synthesized by Genepharma (Shanghai). [score:3]
Interestingly, in IL-6 knockout mice the level of miR-29 in the heart further elevated than WT controls upon diabetes induction (Fig. 8B). [score:2]
Interestingly, knockout of IL-6 further elevated the level of miR-29 than WT diabetic hearts (Fig. 8). [score:2]
miR-29 has been shown to be a critical regulator of cardiac fibrosis. [score:2]
Role of miR-29 in mediating the regulation of IL-6 on CFs. [score:2]
These findings imply that IL-6 regulates interstitial fibrosis of DCM through miR-29/TGFβ1 pathway. [score:2]
Interestingly, studies showed that miR-29 is also negatively regulated by TGFβ1 signaling pathway in renal fibrosis 25 and mouse myoblasts 26. [score:2]
IL-6 modulates the development of high glucose induced cardiac fibrosis by affecting TGFβ1 and miR-29 pathways. [score:2]
These data imply that there may be a negatively reciprocal regulatory loop existing between miR-29 and TGFβ1, which requires further study. [score:2]
miR-29 on IL-6 induced collagenI and TGFB1 production in cultured CFs. [score:1]
After culturing for 24 hours, IL-6 cytokines (50 pg/ml; Sigma) alone or in combination with miR-29, miR-29 + AMO-29, or negative control were added to the medium. [score:1]
We evaluated the effects of high glucose on the expression of miR-29. [score:1]
However, the role of miR-29 in IL-6 induced collagen production and diabetic cardiomyopathy remains unknown. [score:1]
miR-29 increased in diabetic hearts than controls (Fig. 8B). [score:1]
How to cite this article: Zhang, Y. et al. Deletion of interleukin-6 alleviated interstitial fibrosis in streptozotocin -induced diabetic cardiomyopathy of mice through affecting TGFβ1 and miR-29 pathways. [score:1]
The RNA levels of collagen I, collagen III, TGF-β1 and IL-6 were determined using SYBR Green I incorporation method on ABI 7500 fast Real Time PCR system (Applied Biosystems,USA), with GAPDH as an internal control for mRNAs and U6 for miR-29. [score:1]
Moreover, we found the level of miR-29 increased in diabetic hearts (Fig. 8), which is in consistent with previous studies 27 28. [score:1]
The effects of miR-29 on CFs were canceled by co-administration of AMO-29 (Fig. 7C,D). [score:1]
In contrast, treatment of cultured CFs with IL-6 significantly reduced the level of miR-29 (Fig. 7B). [score:1]
N = 4. *P < 0.05 vs WT or Ctl; [#]P < 0.05 vs IL-6; [$]P < 0.05 vs IL-6 + miR-29. [score:1]
[1 to 20 of 38 sentences]
27
[+] score: 112
Other miRNAs from this paper: mmu-mir-29b-2
As shown in the volcano maps, we obtained 1,229 genes up-regulated and 941 genes down-regulated in the group of OSKM + shDnmt3a-iPSC versus OSKM-iPSC (Fig. 2a), whereas 1,254 genes up-regulated and 282 genes down-regulated in OSKM + miR-29b-iPSC versus OSKM-iPSC (Fig. 2b). [score:13]
To investigate whether the target genes of miR-29b are directly regulated by miR-29b or indirectly affected by DNA demethylation, we collected 5,332 predicted targets and 153 validated targets of miR-29b from the miRwalk database 29. [score:8]
Moreover, the specifically down-regulated genes in OSKM + shDnmt3a-iPSC were enriched in macromolecular metabolic process, DNA metabolic processes, nucleic acid metabolic process and organelle organization (Fig. 5d), while the down-regulated genes in OSKM + miR-29b-iPSC were enriched in the regulation of metabolic, biological and cellular processes (Fig. 5e). [score:8]
During iPSC generation, changes in epigenetic modifications such as DNA methylation are crucial for the reestablishment of ES-specific gene expression pattern 7. Here, to systematically characterize the quality of iPSCs derived using demethylation via overexpression of miR-29b or knockdown of Dnmt3a, as well as the exact effects of DNA methylation and histone modification on regulating gene expression, we performed RNA-seq across the whole transcriptomes of ES cells and iPSCs derived by demethylation. [score:7]
showed that there were 877 genes and 835 genes that were specifically up-regulated in OSKM + shDnmt3a-iPSC versus OSKM-iPSC and OSKM + miR-29b-iPSC versus OSKM-iPSC, while 798 genes and 206 genes were down-regulated only in OSKM + shDnmt3a-iPSC versus OSKM-iPSC and OSKM + miR-29b-iPSC versus OSKM-iPSC, respectively. [score:7]
Interestingly, these miR-29b targets tend to be up-regulated in OSKM + miR-29b-iPSC (Fig. 4d). [score:6]
By combining various online data sets, we confirmed that the DEGs up-regulated by shDnmt3a and miR-29b tend to be poised for activation, while the synergy of DNA methylation and histone modification is critical for controlling gene expression. [score:6]
Targets of miR-29b are mainly up-regulated DEGs by shDnmt3a. [score:6]
However, the specifically up-regulated genes in OSKM + miR-29b-iPSC were mainly enriched in development, metabolic process, cell adhesion and motility (Fig. 5c). [score:5]
Retroviral plasmids were used for overexpression of miR-29b and knockdown of Dnmt3a. [score:4]
These findings suggested that miR-29b and shDnmt3a played similar but distinct roles in regulating gene expression and iPSC generation. [score:4]
Furthermore, the up-regulated genes in OSKM + miR-29b-iPSC tended to be associated with H3K27me3 in ES cells, and also enriched with binding of Ezh2 and Suz12 (Fig. 4c). [score:4]
Different from OSKM + shDnmt3a-iPSC, down-regulated genes in OSKM + miR-29b-iPSC also tended to show more ICP (22.5%) or LCP (12.7%) promoters and K27 signals (Fig. 4b). [score:4]
To clarify the exact differences and mechanisms underlying reprogramming with demethylation and the quality of pluripotency, we used iPSCs as previously reported 19, derived using OSKM and in addition to demethylation with overexpressing miR-29b (OSKM + miR-29b) or repressing Dnmt3a using shRNA (OSKM + shDnmt3a). [score:3]
Mouse iPSCs including OSKM-iPSC, OSKM + miR-29b-iPSC, and OSKM + shDnmt3a-iPSC were previously reported and obtained using the traditional transcriptional factors OSKM, overexpressing miR-29b with OSKM, and shDnmt3a with OSKM, respectively 19. [score:3]
Different from OSKM + shDnmt3a-iPSC, DEGs in OSKM + miR-29b-iPSC were associated with targets of pluripotent transcription factors Sox2, Ctcf and Nanog. [score:3]
Recently, miR-29b has been found to regulate the self-renewal of ES cells during ROS treatment and was found to be critically involved in DNA methylation-related reprogramming events 18 19. [score:2]
To identify the specific DEGs regulated by miR-29b or shDnmt3a, we carried out further analysis of the differences between OSKM + miR-29b-iPSC and OSKM + shDnmt3a-iPSC. [score:2]
Further analyses of specific DEGs regulated by shDnmt3a and miR-29b. [score:2]
The specific DEGs regulated by shDnmt3a and miR-29b. [score:2]
Further analysis with Pearson correlation coefficient clustering on these 238 genes showed that OSKM + miR-29b-iPSC and OSKM + shDnmt3a-iPSC were more close to ES cells than OSKM-iPSC (Fig. 1c). [score:1]
These three iPSC lines were referred to as iPSC (OSKM-iPSC), miR-29b (OSKM + miR-29b-iPSC), and shDnmt3a (OSKM + shDnmt3a-iPSC), respectively. [score:1]
showed that the GO term and KEGG pathway of DEGs caused by miR-29b was similar to that of shDnmt3a. [score:1]
Global demethylation by shDnmt3a and miR-29b tended to recover silenced genes with LCP or ICP promoters, while HCP promoters were accompanied by K4-K27. [score:1]
Moreover, as shown in Fig. 1d, the clustered heatmap of 24 critical genes associated with stem cells indicated that OSKM + miR-29b-iPSC was more close to ES cells than the other iPSCs. [score:1]
Further analyses of DEGs between OSKM + miR-29b-iPSC and OSKM-iPSC. [score:1]
These findings suggested that iPSCs derived with demethylation were more close to ES cells, and using miR-29b maybe better than shDnmt3a for demethylation during iPSC generation. [score:1]
Results of single and multiple logistic regression analyses of DEGs in OSKM + miR-29b-iPSC based on logFPKM_iPSC, K36, K4, and K27 signals. [score:1]
miR-29b, OSKM + miR-29b-iPSC; shDnmt3a, OSKM + shDnmt3a-iPSC. [score:1]
iPSC, OSKM-iPSC; miR-29b, OSKM + miR-29b-iPSC; shDnmt3a, OSKM + shDnmt3a-iPSC. [score:1]
As shown in Fig. 5a, the overlapping patterns of DEGs in OSKM + miR-29b-iPSC versus OSKM-iPSC and OSKM + shDnmt3a-iPSC versus OSKM-iPSC were presented in the Venn diagram. [score:1]
These findings indicated that introduction of demethylation via shDnmt3a or miR-29b during somatic cell reprogramming improved the quality of the derived iPSCs. [score:1]
Interestingly, DEGs caused by miR-29b mainly focus on stem cell related signaling pathways. [score:1]
[1 to 20 of 33 sentences]
28
[+] score: 93
The fibrosis -associated downregulation of miR-29 is of particular interest because these miRNAs target the transcripts of a large number of ECM proteins including several collagens, elastin, and fibrillin. [score:6]
Consistent with prior reports [21, 23], we observed downregulation of miRNAs belonging to the miR-29 family (miR-29a, miR-29b, and miR-29c) among a larger set of dysregulated miRNAs in the livers of mice treated with CCl [4] for up to eight weeks (Fig 1B and 1C). [score:5]
Antisense -mediated inhibition of miR-29 also strongly de-repressed endogenous type I collagen expression (S1 Fig). [score:5]
miR-29 family members have been shown to inhibit the synthesis of collagen and other important ECM proteins and the anti-fibrotic effects of miR-29 expression in multiple tissues including liver, lung, heart, and muscle have been demonstrated [10, 23, 28– 30]. [score:5]
Second, miR-29 is detectably expressed in normal hepatocytes and we observed that exposure of these cells to the profibrotic cytokine TGF-β decreased expression of miR-29a/b/c (Fig 1D). [score:5]
While such tight regulation of miR-29 production could limit the utility of this approach in settings where supraphysiologic miRNA levels are required to reach the therapeutic threshold, it also provides natural protection against potential toxicity from virally-derived miR-29 overexpression. [score:4]
The mutations created in each of the miR-29 target sites in the luciferase reporter construct used in b are shown in red. [score:4]
Third, the importance of maintaining normal miR-29 expression in hepatocytes is highlighted by a previous report which showed that hepatocyte specific knockout of miR-29 was associated with increased susceptibility to liver fibrosis [28]. [score:4]
Numerous extracellular matrix (ECM) proteins including several collagens, elastin and fibrillin are validated targets of the miR-29 family [10– 15], which includes miR-29a, miR-29b and miR-29c. [score:3]
Primary and mature miR-29 expression levels in murine liver and isolated human hepatocytes. [score:3]
S2 Fig In vitro and in vivo miR-29 expression levels associated with AAV. [score:3]
Nevertheless, use of a clinically relevant delivery system to restore hepatic miR-29 expression and reverse existing liver fibrosis, the likely clinical scenario in which this therapy would be implemented, has not yet been demonstrated. [score:3]
In vitro and in vivo miR-29 expression levels associated with AAV. [score:3]
This is significant because activated stellate cells and their derivatives are responsible for most if not all of the ECM production in liver fibrosis and restoration of normal miR-29 expression in activated stellate cells could repress ongoing ECM protein synthesis and thus provide significant anti-fibrotic protection. [score:3]
While elucidation of specific therapeutic mechanisms and further refinement of delivery methods will aid ongoing efforts to develop clinically viable strategies, the antifibrotic protection associated with parenchymal transgene expression suggests that therapeutic miR-29 delivery may be effective in treating a variety of fibroproliferative disorders. [score:3]
eGFP treated mice exhibited normal hepatic miR-29 expression (Fig 3C), lacked any histologic evidence of fibrosis (Fig 3D and 3E) and had only a slight increase in total collagen (Fig 3F). [score:3]
Mutating the binding sites or inhibiting endogenous miR-29 with antisense oligonucleotides de-repressed a COL1A1 3' UTR luciferase reporter construct upon transfection into primary fibroblasts (S1 Fig). [score:3]
miR-29, a potent regulator of ECM production, is down regulated in fibrotic livers and TGF-β treated hepatocytes. [score:3]
Here we report that AAV -mediated restoration of miR-29 expression in a mouse mo del of liver fibrosis provides significant anti-fibrotic protection. [score:3]
Liver injury and associated hepatocyte proliferation are known to rapidly dilute AAV vector genomes [27] and 8 weeks after injection (12 weeks total CCl [4]) viral genomes were very low in both control and miR-29 treated animals (Fig 4B) and miR-29a expression was repressed in both scAAV8. [score:3]
scAAV8 transduction and miR-29 expression levels in murine liver. [score:3]
We determined that miR-29 family members are also expressed in purified human hepatocytes and that stimulation of hepatocytes with TGF-β, a potent fibroproliferative cytokine, resulted in decreased mature miR-29a/b/c without a significant reduction in pri-miR-29a (Fig 1D), similar to the pattern observed in liver samples of CCl [4] treated mice. [score:3]
The primary transcript of miR-29a was significantly increased after 1 and 4 weeks of CCl [4] exposure suggesting that altered processing and/or decreased stability of the mature miRNA contributes to the observed reduction in mature miR-29 (Fig 1C). [score:1]
miR29. [score:1]
miR-29. [score:1]
AAV vectors are being used in several clinical trials [24] and our data provides the first evidence that a clinically relevant miR-29 delivery platform can reverse established liver fibrosis. [score:1]
Our findings highlight the potential of clinically viable miR-29 -based therapies for treating established organ fibrosis in chronically injured tissues. [score:1]
In humans and mice these miRNAs are encoded by two distinct transcripts (miR-29a/miR-29b-1 and miR-29b-2/miR-29c) and fibrosis -associated decreases in mature miR-29 levels have been reported in diverse tissues [10, 16– 22]. [score:1]
In support of this possibility, the transfer of functional miRNAs, including miR-29, to other cells via gap junctions or exosomes has been described [33– 38]. [score:1]
To facilitate therapeutic delivery of miR-29 to injured livers we adapted a previously described AAV vector system [25]. [score:1]
Importantly though, the residual genomes were sufficient to maintain normal miR-29a levels (Fig 3C) and it therefore appears that processing of virally-derived miR-29 transcripts can counteract the decrease in endogenous miR-29 levels that otherwise occurs in the setting of chronic liver injury. [score:1]
eGFP was sufficient to maintain normal miR-29 levels and thereby block de novo fibrosis in the setting of chronic liver injury. [score:1]
miR-29 family members indicated with arrows. [score:1]
Coordinated Regulation of Extracellular Matrix Synthesis by the MicroRNA-29 Family in the Trabecular Meshwork. [score:1]
Activated stellate cells and their derivatives are responsible for most if not all of the ECM production in liver fibrosis and previous studies have shown that inflammatory stimuli decrease miR-29 levels in purified stellate cells [21]. [score:1]
[1 to 20 of 35 sentences]
29
[+] score: 88
MiR-29 has been shown to induce apoptosis and inhibit proliferation and invasion by downregulating oncogenes and/or upregulate tumor suppressors. [score:10]
Several human miRs, including miR-29 family, miR-148, and miR-200b/c have been found to be frequently downregulated in human cancers and lead to increase expression of DNMT1 and DNMT3a/b because they directly target the 3′-UTR of DNMTs [30, 35, 36]. [score:9]
Figure 1 A. miR-29a, miR-29b and miR-29c expression were downregulated in human glioma tissues examined by using qRT-PCR. [score:6]
A. miR-29a, miR-29b and miR-29c expression were downregulated in human glioma tissues examined by using qRT-PCR. [score:6]
Transcriptional profiling studies of miRNA expression across tumor tissues or cancer cell lines have revealed that miR-29 is downregulated in the majority solid tumors. [score:6]
One particular miRNA family, the miRNA-29 family suppress DNA methylation of tumor-suppressor genes [28- 30], reduce proliferation of tumors and increase chemosensitivity. [score:5]
Garzon et al found that miR-29b not only directly bound to DNMT3a/b but also indirectly suppressed DNMT1 by binding to Sp1. [score:5]
Previous research has shown that the family member miR-29b functions as an oncogene by inhibiting tumor suppressors such as phosphatase and tensin homolog (PTEN) [30]. [score:5]
miR-29 family is downregulated in primary glioma tissues. [score:4]
In the nervous system, miR-29b was found to be downregulated in glioblastomas [37] and neuroblastoma [38]. [score:4]
We found that miR-29 mimic transfection remarkably suppressed luciferase activity in the vector containing wild-type Sp1 sequence. [score:3]
There is no gender difference in miR-29 expression. [score:3]
Analysis of the correlation between expression of miR-29a, miR-29b and miR-29c in primary glioma and its clinicopathological parameters. [score:3]
We further examined whether TMZ chemotherapy would be more beneficial in patients with high miR-29 expression. [score:3]
B. Kaplan-Meier survival curves for OS in relation to miR-29a, miR-29b and miR-29c expression. [score:3]
We found that miR-29a, miR-29b, and miR-29c were significantly downregulated in the majority of tumor samples when compared with the matched adjacent normal brain tissues (Figure 1A). [score:3]
However only miR-29c level was strongly (inversely) associated with tumor recurrence (P=0.001), and no such relationship was observed for miR-29a (P=0.784) or miR-29b (P=0.774) (Table 1). [score:1]
The miR-29 family has a finely complementary structure to the 3′-TURs of DNA methyltransferase DNMT3a and DNMT3b [39]. [score:1]
The tumor size or weight was significantly smaller or lighter in mice injected with miR-29 transfected glioma cells. [score:1]
No significant correlation was observed between miR-29a (Figure 1B; P=0.863) or miR-29b level and the outcome (Figure 1B; P=0.570). [score:1]
The potential miR-29 binding site in the 3′-UTR of Sp1 was mutated by the overlap extension PCR method. [score:1]
To explore the roles of miR-29 family in glioma pathogenesis, we first quantified miR-29 levels in 22 primary glioma tissue samples. [score:1]
We found that patients with grade III or IV gliomas had low miR-29 levels (miR-29a: P= 0.017; miR-29b: P= 0.016; miR-29c: P= 0.001). [score:1]
The miR-29a, miR-29b and miR-29c miRCURYTM LNA custom detection probe (Exiqon, Vedbaek, Denmark) was used for ISH. [score:1]
Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) was performed using the All-in-One™ miRNA qRT-PCR detection kit (GeneCopoeia, Rockville, MD, USA) for miR-29 and small nuclear RNA U6, which was used as an endogenous control. [score:1]
The human miRNA-29 family has three main members including miR-29a, miR-29b and miR-29c. [score:1]
[1 to 20 of 26 sentences]
30
[+] score: 85
THI treatment of non-injured mdx mice inhibits HDAC activity, and increases histone acetylation and the expression of the HDAC2 targets miR-29 and miR-1. Beneficial muscle genes are upregulated due to a THI -dependent S1P increase. [score:10]
The increase in expression of these genes, including miR-1 and miR-29, in turn alleviates fibrosis by decreasing fibrotic gene (Col1α1) expression (target of miR-29), and increases muscle metabolism (metabolic genes are targets of miR-1). [score:9]
THI treatment of non-injured mdx mice inhibits HDAC activity, and increases histone acetylation and the expression of the HDAC2 targets miR-29 and miR-1Because S1P is specifically enriched in the nucleus of THI -treated adductor muscles in mdx mice, we tested whether it had an inhibitory effect on nuclear HDACs. [score:9]
These beneficial effects of THI correlate with increased nuclear S1P levels in the affected muscles, decreased nuclear HDAC activity and increased specific histone acetylation marks, resulting in upregulation of HDAC2 target genes miR-29 and miR-1. Further gene expression microarray -based analysis showed a significant decrease in inflammation genes and increase in metabolic genes, especially genes involved in fatty acid metabolism in muscles from THI -treated mdx mice. [score:8]
In dystrophic mdx mouse muscles, miR-29 is significantly downregulated (Wang et al., 2012), possibly affecting the prevalence of fibrosis because miR-29 can reduce fibrosis by targeting the mRNA transcripts of fibrotic genes. [score:6]
Previous studies have shown that HDAC2 binds to the promoter regions of miR-1 and miR-29 and downregulates their gene expression in mdx muscles (Cacchiarelli et al., 2010). [score:6]
Taken together, these data suggest that increasing nuclear S1P by treatment with THI inhibits HDAC activity in mdx muscles, resulting in upregulation of miR-1 and miR-29 and reduction of fibrosis. [score:6]
Particularly, elevated levels of miR-29 suppress fibrosis by downregulating the fibrotic gene (Col1a1) in mdx muscles (Cacchiarelli et al., 2010; Wang et al., 2012). [score:6]
miR-1 can regulate cellular metabolism through G6PD, and miR-29 downregulates fibrosis through Col1a1; both of these processes are affected by THI treatment in mdx mice. [score:5]
We examined HDAC2 activity in THI -treated mdx muscles by tracking the expression of its target genes, especially miR-1 and miR-29. [score:5]
We are now showing that the beneficial effects of THI in mdx mice correlate with increased nuclear S1P, decreased HDAC activity, increased histone acetylation, and upregulation of miR-29, miR-1 and many metabolic genes. [score:4]
We observed a significant increase in gene expression of miR-1 and miR-29, along with a reduction in Col1a1. [score:3]
In mdx mice, HDAC2 is bound to the promoters of miR-1 and miR-29, keeping their expression repressed (Cacchiarelli et al., 2010). [score:3]
There was a significant increase in expression of both miR-29 and miR-1 (9- and 5.6-fold, respectively) in diaphragms from THI -treated mdx mice compared with controls (Fig. 4E,F). [score:2]
Both miR-29 and miR-1 have been shown to positively regulate skeletal muscle regeneration, particularly myogenic differentiation (Chen et al., 2006; Wang et al., 2012). [score:2]
Loss of miR-29 in myoblasts contributes to dystrophic muscle pathogenesis. [score:1]
[1 to 20 of 16 sentences]
31
[+] score: 84
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
This research aimed to determine whether the miR-29 families regulate the expression of ICAT and, if so, whether deregulation of ICAT by miR-29 results in defective neurogenesis and whether these pathologies are because of impaired β-catenin -mediated signaling events. [score:5]
The activity of the reporter gene containing the MUT 3′-UTR was not affected by miR-29b (Figure 3a), indicating that miR-29b represses ICAT protein expression by specifically binding to the predicted target sites in the ICAT 3′-UTR. [score:5]
Although the genetic targets regulated by β-catenin and ICAT remain to be defined, our data provide a link between regulation of ICAT by miR-29b and corticogenesis. [score:5]
To determine whether the predicted miR-29b target site in the ICAT 3′-UTR is required for repression of ICAT expression, we mutated the TGCT sequence located within the conserved binding site to GTAG (Figure 3b), thereby abolishing miR-29b binding to the MUT construct. [score:5]
Transfection of miR-29b remarkably inhibited ICAT protein expression but ICAT mRNA was reduced by only ∼15% in NSCs (P=0.0525, Student's t-test, Figure 1f). [score:5]
In contrast, a decrease in reelin -positive Cajal–Retzius neurons in the marginal zone was observed in brains microinjected with anti-miR-29b, presumably because TBR-1 (T box brain gene-1) expression in the cortical plate is suppressed in the presence of anti-miR29b. [score:5]
Inhibition of miR-29b induces a profound defect in corticogenesis during brain development. [score:4]
Figure 1b shows that miR-29b was significantly upregulated in 3-D NSC cultures and that the ICAT mRNA level was reduced in the differentiation medium by ∼80% (P<0.01, Student's t-test). [score:4]
MiR-29b directly targets the 3′-UTR of ICAT. [score:3]
[5] We found that transfection of 3-D NSCs in ECM with miR-29b or siRNA targeting ICAT (siICAT) triggered nuclear translocation of a β-catenin (Figures 2b–l), suggesting that this translocation event is essential for NSC differentiation (Figures 2b–f). [score:3]
Nestin expression was significantly reduced in NSCs transfected with miR-29b or small interfering RNA (siRNA) against ICAT (P<0.005, Student's t-test, Figure 1e). [score:3]
The MUT construct was created by substituting GTAG for the WT TGCT sequence within the miR-29-target binding site in the 3′-UTR. [score:3]
Inhibition of miR-29b by in utero electroporation of anti-miR-29b into embryonic mouse brains led to premature outward cortical migration (Figures 4b–e). [score:3]
The miR-29 family members were predicted to target a conserved sequence (TGGTGCT) in the 3′-UTR of ICAT. [score:3]
To validate whether miR-29b targets ICAT through this putative miR-29b binding site in the 3′-UTR, we used a luciferase reporter construct in which the mouse ICAT 3′-UTR (2173 bp) containing the predicted miR-29b binding sequence is positioned immediately downstream of the luciferase gene. [score:3]
To examine the population ratio of self-renewed NSCs generated from neurosphere-expanded stem cells, we analyzed Nestin expression in miR-29b -transfected NSCs 3-D cultured in ECM by qRT-PCR. [score:3]
org [15] algorithms showed that miR-29b targets the 3′-UTR of ICAT. [score:3]
MiR-29b is significantly upregulated during differentiation in NSCs. [score:3]
The miR-29b-regulated target mRNAs, including ICAT mRNA, were investigated by reverse transcribing 0.5  μg of total RNA into cDNA followed by PCR. [score:2]
Here we demonstrate that miR-29b regulates β-catenin–ICAT complex during fetal neurogenesis. [score:2]
Given that (1) miRNA-29 family members bind directly to ICAT, (2) β-catenin that is not bound to ICAT translocates to the nucleus, and (3) anti-miR-29b alters the functional properties of ICAT, it seems likely that ICAT is a component of β-catenin signal pathways (Figure 5). [score:2]
Luciferase reporter activity of WT constructs was significantly decreased (~25%) in cells co -transfected with miR-29b (P<0.01, Student's t-test, Figure 3a). [score:1]
MiR-29b, but not miR-29a or c, showed a prominent (approximately sixfold) increase following induction of differentiation using commercially available supplements (Stem Cell Technologies, Vancouver, BC, Canada) (P<0.05, Student's t-test, Figure 1a). [score:1]
The miR-29b oligonucleotides were co -transfected into human embryonic kidney HEK293T cells with wild-type (WT) or mutant (MUT) reporter constructs. [score:1]
At 24 h after seeding, HEK293T cells were co -transfected with 0.5  μg of reporter constructs (WT or MUT) and control siRNA or 50 nM mouse miR-29b miRNA oligonucleotides (Qiagen). [score:1]
Then, 1  μl of small RNA (37.5 pmol of control siRNA or anti-miR-29b (5′-GCUGGUUUCAUAUGGUGGUUUA-3′)) together with 0.625  μg of pCAGIG GFP-reporter plasmid DNA in PBS were microinjected into the lateral ventricle using 90-mm glass capillaries (GD-1; Narishige, Tokyo, Japan) as previously described. [score:1]
Therefore, ICAT depletion in NSCs in ECM by transfection with miR-29b or siICAT predominantly promotes differentiation toward intermediate progenitor cells via nuclear β-catenin. [score:1]
The discrepancies in the statistical significance and reduction ratio between the results shown in Figures 1b and f may be explained by differences in the transfection efficiency of an exogenous miR-29b RNA oligonucleotides in primary NSC cultures. [score:1]
Furthermore, these results may contribute to a better understanding of the role of miR-29 miRNAs in the progression of many types of cancer, especially brain cancer. [score:1]
In addition, we checked the effects of miR-29b transfection on the mRNA and protein levels of ICAT. [score:1]
To determine whether our in vitro results could be substantiated in vivo, we microinjected an anti-miR-29b oligonucleotide into the left ventricle of mouse embryos at E13.5 (Figure 4a). [score:1]
[1 to 20 of 31 sentences]
32
[+] score: 73
Other miRNAs from this paper: mmu-mir-132, mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Moreover, overexpression of miR-29 in murine HSCs resulted in a downregulation of collagen expression through directly targeting the mRNA expression of ECM genes. [score:13]
Moreover, miR-29 can inhibit the TGF-β1 -mediated upregulation of HDAC4 via the inhibition of Smad3 expression in the regulation of myogenic differentiation [19]. [score:11]
In addition, inhibition of HDAC activity leads to a strong reduction of HSC activation markers, α-SMA, lysyl oxidase and collagens, as well as an inhibition of cell proliferation through the induction of miR-29 expression [10]. [score:7]
Previously, we showed that hepatic overexpression of miR-29 leads to inhibition of hepatocellular apoptosis and to reduction of acute liver damage [14]. [score:5]
In addition, inhibition of HDAC activity leads to a strong reduction of HSC activation through the induction of miR-29 expression [10]. [score:5]
In a recent study of renal fibrosis, it was demonstrated that Smad3 mediated TGF-β1 -induced the downregulation of miR-29 by binding to the promoter of miR-29 [26]. [score:4]
Recent studies have shown that microRNA-29 (miR-29) is significantly decreased in liver fibrosis and that its downregulation influences the activation of hepatic stellate cells (HSCs). [score:4]
Recently, Roderburg et al. reported that TGF-β1- mediated downregulation of miR-29 in HSCs [5], a finding supported by Bandyopadhyay et al. [6]. [score:4]
In vitro activation of HSCs led to a downregulation of all miR-29-members during eight days of culturing [5]. [score:4]
Furthermore, miR-29 acted as a downstream inhibitor and therapeutic miR for TGF-β1/Smad3 -mediated renal fibrosis. [score:3]
Because liver fibrosis is an imbalance between ECM deposition and ECM degradation, the miR-29 -mediated suppression of ECM synthesis in HSCs could hopefully drive the balance toward reduced fibrosis. [score:3]
Recent reports have demonstrated that miR-29 acts as a downstream inhibitor and therapeutic miR for TGF-β1/Smad3- mediated renal fibrosis [26] and myogenic differentiation [27]. [score:3]
Recent studies have shown that the expression of miR-132 and miR-29, which consists of miR-29a, miR-29b, and miR-29c, are significantly decreased in fibrotic livers, as demonstrated in human liver cirrhosis as well as in two different mo dels of liver injury induced by bile duct ligation (BDL) and carbon tetrachloride (CCl [4]) [5]. [score:3]
In addition, miR-29 is also a major regulator of genes associated with pulmonary fibrosis [35], renal fibrosis [26], as well as myocardial infarction [36] and aneurysm formation [37]. [score:2]
It seems that miR-29 is a key player in fibrogenesis. [score:1]
In order to quantify miR-29 in the tissue samples, we performed real-time, quantitative RT-PCR with the ABI 7700 Sequence Detection System (TaqMan; Applied Biosystems, Inc. [score:1]
[1 to 20 of 16 sentences]
33
[+] score: 72
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-29b-2
miR-29b, a vital tumor suppressor, can suppress the tumor cell growth by regulating the expression of p53 [40], thereby playing a critical role in the process of fibrosis diseases in various tissues, including liver [41], lung [42], kidney [43], and heart [44]. [score:10]
The normal activities of oxidant enzymes (MPO, MDA) could promote cell proliferation; however, the abnormal expression would upregulate the expression of p53 and miR-29b, inducing cell apoptosis [47]. [score:8]
On the other hand, miR-29b suppressed the expression of TGF-β1 to mediate the procession of pulmonary fibrosis [22]. [score:5]
Yan B. Guo Q. Fu F. J. Wang Z. Yin Z. Wei Y. B. Yang J. R. The role of miR-29b in cancer: Regulation, function, and signaling OncoTargets Ther. [score:4]
These results indicated that CI [SCFE] combined with BLM affected the miR-29b expression, and regulated the balance between p53 and TGF-β1 signaling pathways in H22 tumor-bearing mice. [score:4]
The inflammatory cytokines also play a pivotal role in the procession and metastasis in the tumor, whereby the excess inflammatory factors would upregulate the miR-29b, p53, and caspases 3 and 8 levels to stimulate the tumor cell apoptosis [47, 48, 49]. [score:4]
Intriguingly, miR-29b could upregulate the level of p53 [40], and consequently activate downstream the p53 pathway including caspases 3 and 8, which eventually induce the apoptosis of tumor cells [45]. [score:4]
miR-29b is a well-established vital tumor suppressor and fibrosis modulator [22, 23], playing a key role in cancer with visceral fibrosis. [score:3]
Expression of miR-29b in Ascites Cells and Lung Tissues. [score:3]
Moreover, the pro-inflammatory factors stimulated the expression of miR-29b and enhanced the anti-tumor effect mediated by enhancing the cell apoptosis [8]. [score:3]
Interestingly, the expression of miR-29b levels was dramatically enhanced when CI [SCFE] was coupled with BLM. [score:3]
Qin W. Chung A. C. Huang X. R. Meng X. M. Hui D. S. Yu C. M. Sung J. J. Lan H. Y. TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29 J. Am. [score:3]
The present data substantiated that the treatment with CI [SCFE] or BLM alone had no obvious effect on miR-29b expression in the ascites cells and lung tissues. [score:3]
Park S. Y. Lee J. H. Ha M. Nam J. W. Kim V. N. miR-29 miRNAs activate p53 by targeting p85α and CDC42 Nat. [score:3]
Cushing L. Kuang P. P. Qian J. Shao F. Z. Wu J. J. Little F. Thannickal V. J. Cardoso W. V. Lu J. N. miR-29 is a major regulator of genes associated with pulmonary fibrosis Am. [score:2]
As shown in Figure 9, the treatment with CI [SCFE] or BLM alone did not exhibit any distinct effect on miR-29b expression in the ascites cells and lung tissues as compared to the mo del group (p < 0.05, respectively). [score:2]
Van Rooij E. Sutherland L. B. Thatcher J. E. DiMaio J. M. Naseem R. H. Marshall W. S. Hill J. A. Olson E. N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis Proc. [score:2]
However, the combination of BLM with CI [SCFE] significantly enhanced the expression of miR-29b in ascites cells and lung tissues as compared to BLM alone (p < 0.05). [score:2]
In the tumor procession, miR-29b could regulate the balance of p53 and TGF-β1 signaling pathways simultaneously. [score:2]
The TGF-β1 signaling pathway could, in turn, modulate the activity of miR-29b [8]. [score:1]
Thus, we attempted to evaluate whether CI [SCFE] could modulate the miR-29b expression of BLM -treated tumor-bearing mice. [score:1]
[1 to 20 of 21 sentences]
34
[+] score: 70
By contrast, the expression of its two main receptors, TNFRSF1A (TNF-R1) and TNFRSF1B (TNF-R2), is expected to be upregulated at ST and IT as a result of the downregulation of mmu-miR-690, -805 and -574-5p (at ST) and mmu-miR-29b, -29c, -152, -218 and 690 (at IT). [score:9]
MiR-29 has been reported to be involved in various human cancers [54]- [57] and in tumour suppression by targeting the T-cell leukemia/lymphoma 1 (Tcl1) oncogene mRNA [54], by reverting DNA methylation by targeting DNA methyltransferases 3A (Dnmt3a) and 3B (Dnmt3b) mRNA [58] and by regulating p53 pathway through Cdc42 and p85α [59]. [score:7]
At IT, expressions of mmu-miR-29b, -29c, -152, -200a and -690 that potentially target laminin γ chain LAMC1 are inhibited. [score:7]
Evidence that miR-29b attenuates expression of collagen genes by blocking their mRNA translation has already been described [103], [104] and an inverse correlation between the expression of mmu-miR-29b and -29c and the synthesis of collagen type I and III is further evidenced here. [score:7]
For miR-146b, which was up-regulated at the 3 time-points, and for miR-29b and -29c, which are thought to be regulators of extracellular matrix remo delling and are downregulates at IT and LT, increasing concentrations were tested to evaluate the sensitivity and the specificity of the assays (Figure 4). [score:5]
At IT, repression of mmu-miR-29b and -29c should induce an increase expression of MMP-15 and -24 (Figure 4A-D) but also of MMP-2. Moreover, these miRNAs can prospectively target MMP-2 and MMP-15. [score:5]
Downregulation of mmu-miR-29 members is strongly correlated with (WP458) especially with the extracellular matrix components directly involved in fibrosing processes. [score:5]
This suggests that downregulation of mmu-miR-29 members coud be one of the causes of the subepithelial fibrosis observed in chronic asthma. [score:4]
Despite their close sequence similarity, miR-29 members showed different inhibitory patterns. [score:3]
0016509.g004 Figure 4Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
Dose-response analysis of the effect of miR-29b, -29c and -146b on their predicted target in lung cells. [score:3]
This hypothesis is further reinforced by our functional data showing that 3′UTRs of both human and mouse Mmp-15 and -24 are similarly targeted by miR-29b and -29c. [score:3]
We selected 8 miRNAs (those described in Tables 4 and 5 and mmu-miR-29b) and, at least, 2 of their potential targets for functional testing in vitro (Figures 4 and 5). [score:3]
Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
As discussed further in the section, mmu-miR-29 appears to be a miRNA family displaying a protective role against fibrosis. [score:1]
MiR-29b mimic reduced efficiently and dose -dependently the luciferase activity from constructs containing the 3′UTRs of mouse Mmp-15 and Mmp-24 while miR-29c had only a limited effect at high concentration on Mmp-24 3′UTR (Figure 4A, B). [score:1]
MiR-29 regulates also muscle cell differentiation probably, in part, under a feed-back control of NF-κB-YY1 pathway [61]. [score:1]
[1 to 20 of 17 sentences]
35
[+] score: 69
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Indeed, miR-29s have been demonstrated to directly target 3′UTRs of collagen mRNAs and downregulation of miR-29 family has been shown to correlate with the development of fibrosis in several tissues [22]– [24]. [score:8]
TGF-β1 -induced Col1A1 expression is independent of miR-29 downregulation. [score:6]
To explore the potential involvement of miR-29 in TGF-β1 -induced Col1A1 upregulation in 603B cells, we generated a luciferase vector which contains a 280-bp fragment of Col1A1 3′UTR with three conserved seed sequences for miR-29 targeting (Fig. 4 A ), conserved for miR-29a, -29b, and -29c [24]. [score:6]
TGF-β1 has been demonstrated to suppress miR-29 expression in the cardiac fibroblast and HSC cells in vitro [23], [24]. [score:5]
Thus, although Col1A1 is a target for miR-29, miR-29 -mediated posttranscriptional mechanisms may not be involved in TGF-β1 -induced Col1A1 expression in 603B cells. [score:5]
We found that the luciferase activity in 603B cells transfected with the construct covering the miR-29 binding sites within the 3′UTR of Col1A1 was significant suppressed, indicating that endogenous miR-29 might help to prevent excessive expression of Col1A1. [score:5]
Moreover, TGF-β1 -induced Col1A1 expression in 603B cells in vitro is independent of miR-29 expression. [score:5]
Although the detailed mechanisms for miR-29 downregulation during fibrosis remain to be elucidated, TGF-β1 decreases the transcription of this miRNA family in myofibroblasts in vitro [24]. [score:4]
Therefore, TGF-β1 may regulate miR-29 expression in a cell type-specific manner. [score:4]
Col1A1 is a target for miR-29 [24]. [score:3]
It has recently been shown that decreased miR-29 expression results in the excessive production of Col1A1 in cardiac fibrosis and liver fibrosis patients [23], [24]. [score:3]
Nevertheless, qRT-PCR analysis showed no significant change for the expression of miR-29 family members after TGF-β1 exposure (Fig. 4 C ). [score:3]
However, TGF-β1 -induced Col1A1 production is independent of EMT-like alterations and miR-29 expression. [score:3]
0051371.g004 Figure 4(A) The schematic of Col1A1 mRNA showed three potential binding sites in its 3′UTR for miR-29 targeting. [score:3]
The precise molecular mechanisms underlying miR-29 dysregulation during fibrosis are unknown. [score:2]
Recent studies demonstrated that miRNAs, such as miR-29 family members, might play a role in the control of cardiac and liver fibrosis [23], [24]. [score:1]
The Col1A1 3'UTR sequence covering the potential binding sites for miR-29 was inserted into the pMIR-REPORT luciferase plasmid. [score:1]
For analysis of miR-29, total RNA was isolated from cells with the TRIzol reagent (Invitrogen). [score:1]
A 280 bp fragment from Col1A1 3′UTR containing three potential miR-29 binding sites was cloned into the multiple-cloning site of the pMIR-REPORT Luciferase vector (Ambion). [score:1]
[1 to 20 of 19 sentences]
36
[+] score: 66
After overexpression of miR-29 was confirmed, we examined mRNA expression for 23 of 25 predicted target genes, excluding 2 with no defined function. [score:7]
Based on computational predictions from both miRBase and TargetScan, there are a total of 25 predicted target mRNAs for miR-29 within our data displaying decreased expression. [score:7]
For this specific cell type in vitro, one of many in the developing lung, miR-29 was shown to directly modulate expression of predicted target mRNAs. [score:6]
A number of genes identified as predicted miR-29 targets were also validated in a miR-29 overexpression mo del using BASC cells. [score:5]
Figure 4 Effects of hyperoxia on the expression of miR-29 and predicted mRNA targets. [score:5]
Expression of the MiR-29 family is increased during normal mouse lung development, and is known to play an important role in the pathogenesis of lung diseases such as pulmonary fibrosis [28, 29]. [score:5]
MiR-29 targeted gene expression in BASC cells following transfection with miR-29 mimics. [score:5]
Direct miR-29 targets were further validated in vitro using bronchoalveolar stem cells. [score:4]
To investigate direct targets of miR-29, we identified candidate mRNAs by overlapping computational prediction with opposite expression patterns in our miRNA and mRNA data. [score:4]
MiR-29 was prominently increased in the lungs of hyperoxic mice, and several predicted mRNA targets of miR-29 were validated with real-time PCR, western blotting and immunohistochemistry. [score:3]
MiR-29 was then overexpressed in vitro by transfection of miR-29a and miR-29c mimics into bronchoalveolar stem cells (BASC), isolated and cultured in our laboratory as previously described [31]. [score:3]
Figure 5 Validation of predicted miR-29 targets. [score:3]
Relative miR-29 expression in BASC cells after transfection of miR-29 mimics. [score:3]
MiR-29 modulates predicted target mRNAs in mouse bronchoalveolar stem cells (BASCs). [score:2]
MiR-29 modulates development in the neonatal mouse lung exposed to hyperoxia through Ntrk2. [score:1]
Analysis of normal lung has shown the presence of miR-29 in subsets of cells in the alveolar wall and entrance to the alveolar duct [28]. [score:1]
Transfection of miR-29 mimics. [score:1]
After 24 hours following transfection, mRNAs were isolated and miR-29 expression measured by RT- PCR. [score:1]
[1 to 20 of 18 sentences]
37
[+] score: 64
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Deletion of Smad7 Upregulates Sp1 but Downregulates miR-29b in ANG II -mediated Hypertensive Nephropathy. [score:7]
Deletion of Smad7 enhances upregulation of Sp1 but dowregulates miR-29b expression in ANG II -induced hypertensive nephropathy. [score:7]
Furthermore, the findings that enhanced TGF-β/Smad3 -mediated renal fibrosis and NF-κB -dependent renal inflammation in Smad7 KO mice were associated with up-regulation of Sp1 and down-regulation of miR-29b in the hypertensive kidney also provided new mechanisms for understanding the protective role of Smad7 in ANG II -mediated hypertensive nephropathy. [score:7]
We have recently shown that miR-29b is a downstream target of TGF-β/Smad3 signalling and that down-regulation of miR-29b promotes renal fibrosis [27]. [score:6]
B. detects that disruption of Smad7 results in a further inhibition of miR-29b expression in the hypertensive kidney. [score:5]
Moreover, miR-29 can inhibit TGF-β1 and Sp1 expression [40], [41]. [score:5]
miR-29 exerts an anti-fibrotic function through direct targeting of the 3'UTR regions in the mRNA for collagens I, III and IV and fibrillin and elastin [39]. [score:4]
For detection of miR-29b expression, renal RNA was isolated using Trizol® and expression of miR-29b was examined with primers as previously described [27]. [score:4]
We have previously demonstrated that Smad3 can physically interact with the miR-29b promoter to negatively regulate miR-29b expression in response to TGF-β1 in vitro and in obstructive nephropathy [27]. [score:4]
Thus, down-regulation of miR-29 in ANG II -mediated hypertensive nephropathy may be attributed to activation of both TGF-β/Smad3 and NF-κB pathways. [score:4]
As miR-29b is also negatively regulated by the NF-κB-YY1-miR-29 regulatory circuit [33], we hypothesized that a loss of renal miR-29b might contribute to the enhanced renal fibrosis and inflammation seen in ANG II infused Smad7 KO mice. [score:3]
miR-29 is also negatively regulated by the NF-κB-YY1-miR-29 regulatory circuit in cancer cells [33]. [score:3]
Therefore, loss of miR-29 may also be a new mechanism by which deletion of Smad7 enhanced ANG II -mediated renal injury via the Sp1-TGF-β/Smad3-NF-κB-miR29 auto-regulatory loop. [score:2]
As shown in Figure 6B, renal levels of miR-29b were significantly reduced in ANG II infused WT mice and this was further decreased in Smad7 KO mice in response to ANG II. [score:1]
Furthermore, loss of miR-29 may also be a mechanism through which disruption of Smad7 enhances Ang II -mediated renal fibrosis and inflammation. [score:1]
Taken together, ANG II -induced loss of miR-29b via the TGF-β/Smad3 and NF-κB -dependent mechanism may result in further increase in TGF-β1 and Sp1 -dependent renal injury. [score:1]
[1 to 20 of 16 sentences]
38
[+] score: 60
Indeed, miR-29b targets specific fibrotic molecules including collagens or α-smooth muscle actin, and its abundance is reduced in many fibrotic pathologies as its expression is inhibited by TGFβ [22, 27]. [score:7]
Furthermore, other reports point to the fact that miRNAs may induce the same direction of regulation of their mRNA targets depending on the timeframe and conditions [56– 60], providing an explanation of a possible indirect mechanism of miR-29b-NAV1 regulation. [score:7]
It is notable, though, that the regulation of NAV1 by miR-29b-3p did not follow the classical regulation pattern (up regulation of a miRNA causes down regulation of a target or vice versa) in the partial UUO mo del. [score:7]
In contrast, in the in vitro experiment NAV1 followed the predicted regulation and confirming that it may be a direct target of miR-29b. [score:5]
This combined systems biology -based approach followed by an in vitro validation pointed to the consistent dysregulation of specific miRNAs, let-7a-5p and miR-29-3p and to new potential targets, E3 ubiquitin-protein ligase (DTX4) and neuron navigator 1 (NAV1) in UPJ obstruction that would not be identified otherwise. [score:4]
Moreover, significant upregulation of neuron navigator 1 NAV1 was observed in HK2 cells treated with the miR-29b-3p antagomir (Fig.   2d). [score:4]
In vitro and in vivo validation identified consistent dysregulation of let-7a-5p and miR-29-3p and new potential targets, E3 ubiquitin-protein ligase (DTX4) and neuron navigator 1 (NAV1), potentially involved in fibrotic processes, in obstructive nephropathy in both human and mice that would not be identified otherwise. [score:4]
Expression of E3 ubiquitin-protein ligase DXT4 (DTX4) (a), leiomodin-1 (LMOD1) (b), a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 (ADAMTS19) (c) and neuron navigator 1 (NAV1) (d) was assessed by RT-PCR in HK2 cells treated or not with antagomirs against let-7a, miR-125b-5p, miR-16-5p, miR-26a-5p or miR-29b-3p. [score:3]
Obstructive nephropathy miRNAs/microRNAs Microarrays let-7a-5p and miR-29b-3p DTX4 and NAV1 Congenital obstructive nephropathy is the main cause of end stage renal disease (ESRD) in children [1]. [score:3]
Expression of let-7a (a), miR-125b-5p (b), miR-16-5p (c), miR-26a-5p (d) and miR-29b-3p (e) was assessed by RT-PCR in HK2 cells treated or not with antagomirs. [score:3]
There is evidence connecting dysregulated miRNAs including miR-21 and miR-29 with kidney fibrosis [17– 22], an important feature in severe UPJ obstruction. [score:2]
Nevertheless, further investigation is needed to determine if NAV1 is a direct target of miR-29b in vivo and if it is an interesting molecule in the context of UPJ obstruction. [score:2]
Our data revealed let-7a and miR-29b as molecules potentially involved in the development of fibrosis in UPJ obstruction via the control of DTX4 in both man and mice that would not be identified otherwise. [score:2]
These five miRNAs were let-7a-5p miR-16-5p, miR-29b-3p, miR-125b-5p and miR-26a-5p (Table  3). [score:1]
Among these, miR-29b is a well-known player in renal pathologies and especially fibrosis. [score:1]
Antagomirs for miR-125b-5p, miR-16-5p and miR-29b-3p showed no effect on DTX4, LMOD1 and ADAMTS19, respectively (Fig.   2a–c). [score:1]
67488993) and hsa-miR-29b-3p (ref. [score:1]
In the presence of antagomirs, the detected signal of let-7a, miR-16-5p, miR-125b-5p, miR-26a-5p and miR-29b-3p was significantly decreased (Fig.   1). [score:1]
MiRNAs let-7a-5p, miR-125b-5p, miR-16-5p, miR-26a-5p and miR-29b-3p were consistently modified in mice and humans. [score:1]
The protective role of miR-29b in fibrosis was further demonstrated in vivo since restoring miR-29b levels in a diabetic nephropathy animal mo del reversed accumulation of renal extracellular matrix [28]. [score:1]
[1 to 20 of 20 sentences]
39
[+] score: 59
This suggests that class II HDACs could affect collagen expression in HSCs through up-regulation of miR-29, as could be confirmed by siRNA -mediated knock-down of class II HDACs 4 and 5 (to a lesser extend HDAC6) induced miR-29 expression (Figure 4E). [score:9]
In the cells with inhibited HDAC-activity, miR-29 expression was strongly induced, while during normal culture the expression of miR-29a, -29b and -29c were effectively inhibited compared to the day 1 control as was described before by others (Figure 4D) [11], [12]. [score:8]
miR-29 expression in HDAC knock down samples was calculated relative to miR-29 expression in a sample transfected with non -targeting siRNA (represented by dashed line). [score:6]
We also conclude that the anti-fibrotic effect of class II HDAC inhibition is partially the result of subsequent regulation of miR-29 and collagen expression. [score:6]
As we observed a strong and reproducible effect on collagen expression (both type I and type III) upon HDAC inhibition using MC1568 or siRNA, we investigated the impact of MC1568 treatment on miR-29 expression. [score:5]
These results are in line with reports in chronic lymphocytic leukemia patients showing that microRNA-29 (miR-29) expression can be regulated by HDAC-activity [48]. [score:4]
Although some inconsistencies exist between different reports, it becomes clear that members of the miR-29 family are important regulators of collagen expression during HSC transdifferentiation [11], [12]. [score:4]
During HSC activation the expression of antifibrogenic microRNAs such as miR-29 is decreased [11], [12], whereas others like miR-21 are suggested to be increased [13]. [score:3]
Reduction of miRNA-29 levels during myofibroblastic transition of HSCs seems to play a predominant role for progression of fibrosis, because miRNA-29 was shown to inhibit collagen synthesis and profibrotic growth [11], [12]. [score:3]
Daily treatment inhibits HSC proliferation, collagen secretion and the differentiation of the HSC toward a more myofibroblast-like cell, and this through the induction of microRNA-29. [score:3]
In conclusion, the use of MC1568 has enabled us to identify a role for class II HDACs regulating miR-29 during HSC activation. [score:2]
Recent studies have investigated the role of microRNA-29 family members in the regulation of collagen expression during HSC activation, both, in vitro and in vivo [11], [12], [38]. [score:2]
Class II HDAC knock-down partially hinders HSC activation through induction of microRNA-29. [score:2]
In addition, we observed a strong up regulation of miR-29, a well-known anti-fibrotic miR, upon treatment with MC1568. [score:2]
[1 to 20 of 14 sentences]
40
[+] score: 54
Interestingly, ZL-F had higher cardiac Med13 expression than ZL-M. (d– f) Graphs show qRT-PCR data on the expression of cardiac microRNA miR-29a, b and c. Expression of all miR-29 family miRNAs were increased in ZDF-F and ZDF-M. miR-29c was the most differentially expressed miRNA between male rats (f) whereas miR-29b was the most differentially expressed miRNA between female rats (e). [score:11]
Differential expression of miR-29b was highest between ZDF-F and ZL-F, while differential expression of cardiac miR-29a and c were prominent between ZDF-M and ZL-M. Collectively our data show that T2DM -associated CVD progression in ZDF-F and ZDF-M is structurally and mechanistically different. [score:5]
Since increased expression of miR-208a is associated with cardiac hypertrophy, the female-specific increase in cardiac miR-208a expression could have contributed to the increased susceptibility to cardiac hypertrophy in ZDF-F. Increases in the circulating levels of miR-29 family miRNAs in children with T1DM and adults with T2DM 42, 43 emphasize the clinical relevance of this biomarker in DM. [score:5]
DM -associated dysregulation of miR-208a-MED13 signaling and increase in miR-29 family miRNAs occur in both male and female ZDF rats, however, only ZDF-F rats exhibited myocardial damage indicating that cardiac repair is impaired in ZDF-F. It is conceivable that the higher expression of cardio-reparative Agtr2 in ZL-F compared to ZL-M (Fig.   9a) could have provided increased protection despite the higher expression of pro-hypertrophic miR-208a in ZL-F heart compared to ZL-M heart. [score:4]
Here we show for the first time that while all miR-29 family miRNAs increased in response to diabetes in both sexes, there was a sex difference in their expression patterns. [score:3]
Thus, increases in the expression levels of the individual DM -associated miR-29 isoforms are also largely dependent on sex. [score:3]
Cardiac miR-29 family miRNA expression patterns are different in male and female diabetic rats. [score:3]
Thus, there were sex differences in miR-29 family miRNA expression. [score:3]
Cardiac expression of AT2R (Agtr2), Med13, miR-208a, and miR-29 family miRNAs were determined using mRNA and miRNA isolated from frozen heart tissues as described previously [44]. [score:3]
Figure 9Expression patterns of cardioprotective Agtr2 and Med13, and cardio- deleterious miR-208a and diabetic marker miR-29 family miRNAs in heart tissues of 5-month old healthy and diabetic, male and female rats. [score:3]
Additionally, miR-29b expression was highest in ZDF-F (Fig.   9e). [score:3]
Cardiac expression of all members of the miR-29 family increased in both ZDF-F and ZDF-M compared to ZL-F and ZL-M (Fig.   9d–f, p < 0.05). [score:2]
Given the critical role of miR-29 in both DM and cardiac structure, we compared the cardiac expression of miR-29a, b and c between our groups. [score:2]
miR-29b is implicated in the development of early aortic aneurysm [68], whereas miR-29c is considered as a signature molecule of hyperglycemia [69]. [score:1]
We previously showed that increased miR-29 family miRNAs correlate with DM -induced cardiomyocyte disorganization [44]. [score:1]
We showed that elevated miR-29 family miRNAs correlate with increased cardiomyocyte disarray in 15-week old ZDF-M [44]. [score:1]
Members of the microRNA miR-29 family (miR-29a, b, and c) serve as mechanistic biomarkers for diabetes (T1DM and T2DM) and cardiovascular damage. [score:1]
[1 to 20 of 17 sentences]
41
[+] score: 53
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Furthermore, the overexpression and inhibition of miR-29 were observed to cause an inhibition and induction of S irt1 expression, respectively. [score:9]
Figure 7 MicroRNA 29b Affects Cholesterol-Loaded SCA-1 [+] Cell Migration via Sirtuin-1/MMP-9(A) SCA-1 [+] cells were loaded with 20 μg/mL chol-MβD, overexpressed with miRNA-29, pre -treated with 50 μM EX-527 (SIRT-1 inhibitor), or treated with 20 μg/mL chol-MβD and a hsa-miR-29b-3p ID: MH10103 mirVana miRNA inhibitor. [score:7]
Consistently, the inhibition of miR-29 and SIRT-1 in progenitor cells, in the presence of cholesterol, caused a reduction and increase in Mmp-9 expression, respectively (Figure 7E). [score:5]
Taken together, these data suggest that chol-MβD can induce MiR-29, which in turn suppresses Sirt1 and upregulates MMP-9 levels to induce AdvSCA-1 [+] progenitor cell migration. [score:5]
It is thus tempting to postulate that cholesterol can enhance AdvSCA-1 [+] progenitors' migratory response toward pro-inflammatory cytokines via miR-29b upregulation. [score:4]
To test whether miR-29b is involved in the chol-MβD -mediated induction of AdvSCA-1 [+] progenitor migration, we overexpressed miRNA 29b in the AdvSCA-1 [+] progenitors by treating them with an mmu-miR-29b-3p mirVana miRNA mimic (Figure 6D). [score:3]
Furthermore, we show that lipid loading increased miRNA-29b expression and induced sirtuin-1 and matrix metalloproteinase-9 levels to promote cell migration. [score:3]
Subsequent experiments using an miRNA29 inhibitor showed a significant reduction in miR-29 levels and attenuated the migration of chol-MβD -mediated cells (Figure 6E). [score:3]
We observed that overexpression of miR-29 significantly increased SCA-1 [+] progenitor migration, both stochastically and in the presence of TNF-α. [score:3]
Furthermore, treatment with chol-MβD or miR-29 caused a marked increase in matrix metalloproteinase 9 (MMP-9) expression in AdvSCA-1 [+] progenitor cells (Figures 7C and 7D). [score:3]
MiRNA-29b Mediates Cholesterol-Induced SCA-1 [+] Cell MigrationWe aimed to elucidate microRNA expression that drives the chol-MβD -mediated chemotactic induction of AdvSCA-1 [+] progenitors. [score:2]
•Hyperlipidemia affects migration of AdvSca-1 [+] cells •AdvSca-1 [+] ApoE KO cells show altered matrix of proteins •Decorin ameliorates extensive migration of AdvSca-1 [+] cells toward the neointima • MicroRNA-29 interferes with AdvSca-1 [+] migration via SIRT-1 and MMP-9 vascular progenitors adventitial migration hyperlipidemia atherosclerosis extracellular matrix Atherosclerosis is a condition whereby the arteries supplying target organs, such as the brain and the heart, become occluded. [score:2]
Of note, it has been reported that human MiR-29b has been implicated in ECM remo deling including collagen regulation (Kriegel et al., 2012), while its dysregulation in murine cardiac fibroblasts upon post-myocardial infraction led to decreased collagen formation and fibrosis (van Rooij et al., 2008). [score:2]
Manipulation of miRNA levels in vascular progenitor cells (cultured to 60%–70% confluence) was carried out using an mmu-miR-29b-3p mouse mirVana miRNA mimic (5 μM), according to the manufacturer's protocol. [score:1]
Our experiments show that miR-29b elicits a response to the migratory potential of lipid -loaded AdvSCA-1 [+], possibly via Sirt1 and MMP-9, with the latter documented to play a role in atherosclerosis (Chen et al., 2008, Gough et al., 2006, Pleva et al., 2015), while the former is a molecule now shown to be involved in AdvSCA-1 [+] progenitors. [score:1]
[1 to 20 of 15 sentences]
42
[+] score: 53
Furthermore, BMPC administration upregulated miR-29 expression (P<0.05; Figure 1C), which is known to inhibit fibrosis by targeting collagen and fibrillin-1 [9] and increased miR-133a (P<0.05; Figure 1D), a negative regulator of connective tissue growth factor (CTGF) [10]. [score:11]
Interestingly, BMPC administration modulates the expression of several fibrosis-related miRNAs after MI, specifically up-regulated miR-29 and miR-133a and down-regulated miR-155 and miR-21. [score:9]
For instance, miR-29 has been shown to inhibit fibrosis by targeting collagen and fibrillin-1 [9], miR-133a negatively regulates connective tissue growth factor (CTGF) [10] and miR-21 targets sprouty homologue 1 [8] and phosphatase and tensin homologue [25]]. [score:8]
Given that microRNAs (miRNAs) modulate pathophysiology of cardiovascular diseases through regulation of gene expression [7], [8], [9], [47], we determined whether BMPCs administration after MI regulates miRNAs (like miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a) that have been shown to play a role in fibrosis in various tissues/organs [8], [11], [12]. [score:7]
Saline -treated (control) MI mice showed a significant up-regulation of miR-21 and miR-155 and decrease in miR-29 and miR-133a expression (Figure 1). [score:6]
To determine whether BMPCs regulate fibrosis-related miRNAs in infarcted heart, we injected mouse BMPCs in infarcted hearts of C57BLKS/J mice and determined (at 3 days post-MI) the expression of miRNAs (miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a, which have been shown to play a role in fibrosis [9], [10], [11], [24], [25]). [score:4]
BMPC therapy decreased miR-21 (A) and miR-155 (B) and increased miR-29 (C) and miR-133a (D) expression in comparison with saline -treated or sham groups. [score:3]
Figure 1 depicts that saline -treated MI mice showed a significant increase in expression of miR-21 and miR-155 (P<0.01; Figures 1A and 1B) and decrease in miR-29 and miR-133a (P<0.01; Figures 1C and 1D) levels with non-significant reducing trend of miR-27 and miR-30a (Figures S4. [score:3]
Several miRNAs in the myocardium are modulated after MI including those that have been implicated in the regulation of fibrosis like miR-21, miR-29, miR-30, miR-133 and miR-155 [8], [9], [10], [11], [12]. [score:2]
[1 to 20 of 9 sentences]
43
[+] score: 52
The data -driven integration of target prediction and paired mRNA/miRNA expression profiling data revealed that i) the quantity of predicted miRNA-mRNA relations was reduced, ii) miRNA targets with a function in cell cycle and axon guidance were enriched, iii) differential regulation of anti-differentiation miR-155-5p and miR-29b-3p as well as pro-differentiation miR-335-3p, miR-335-5p, miR-322-3p, and miR-322-5p seemed to be of primary importance during skeletal myoblast differentiation compared to the other miRNAs, iv) the abundance of targets and affected biological processes was miRNA specific, and v) subsets of miRNAs may collectively regulate gene expression. [score:12]
MiR-155-5p and miR-29b-3p targeted early differentiation upregulated genes (Fig 3A and S4A Table) which are retrieved in pathway associations such as semaphorin, cannabinoid receptor, and adenylate cyclase signaling (S5A Table) as well as the gene ontology terms steroid biosynthetic process and skeletal muscle tissue development (S5B Table). [score:7]
Moreover, miR-155-5p and miR-29b-3p targets were overrepresented in the cluster containing genes which were upregulated during later myoblast differentiation (Fig 3B and S4B Table). [score:6]
Self-organizing tree algorithm (SOTA) analysis revealed that cohorts of genes which were upregulated during early or late myogenic differentiation were mostly targeted by miR-155-5p or miR-29b-3p (Fig 3A and 3B; S4A and S4B Table). [score:6]
However, expression studies in mice with chronic kidney disease showed that an increase in miR-29 improved the differentiation of myoblasts into myotubes [43], which appears to contradict our findings. [score:5]
In contrast to anti-myogenic miR-155-5p and miR-29b-3p, the pro-myogenic miR-322-3p, miR-322-5p, miR-335-3p, and miR-335-5p were involved in down-regulation of, for example, cell cycle or growth related pathways. [score:4]
Our data support the hypothesis that down-regulation of miR-29b-3p promotes myoblast differentiation. [score:4]
It has been reported that miR-29b-3p was down-regulated in Myotonic Dystrophy Type-1 biopsies compared to controls [42]. [score:3]
Decreased miR-29 suppresses myogenesis in CKD. [score:3]
On the other hand, our study provided new insights into the biological implications of miR-155-5p and miR-29b-3p in skeletal muscle cell differentiation. [score:1]
In addition, our data corroborated a function of miR-29b-3p in muscle differentiation. [score:1]
[1 to 20 of 11 sentences]
44
[+] score: 51
[38] The miR-29 family includes 3 members expressed from a bicistronic cluster with miR-29a coexpressed with miR-29b-1, and miR-29b-2 coexpressed with miR-29c. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
In vivo inhibition of miR-29 with an antagomir, an oligonucleotide complementary to miR-29b (anti-miR-29b), activates collagen expression [25]. [score:5]
All three miR-29 family members are downregulated with myocardial ischemia-reperfusion in mice and humans, particularly in the border zone. [score:4]
[40] Downregulation of miR-29 activates several extracellular matrix proteins that play important roles in cardiac fibrosis. [score:4]
[25] A number of fibrosis-related genes are targeted by miR-29, including collagens, fibrillins, and elastin to induce cardiac fibrosis. [score:3]
The miR-29 family is the fourth most abundant miR in the heart, [37] with preferential expression in fibroblasts. [score:3]
The miR-29 family directly regulates at least 16 extracellular matrix genes. [score:3]
Since several fibrosis-related genes are directly activated by decreased miR-29 [25], decreased miR-29c may play an important role in the LPS -induced cardiac fibrosis. [score:2]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
There was no significant change in miR-29a or miR-29b. [score:1]
miR-29 plays a role in fibrosis also in the liver. [score:1]
[18] Hepatic stellate cells, the major cell in hepatic fibrogenesis, are rapidly (1–2 hours) activated by LPS to decrease miR-29a, miR-29b, and miR-29c. [score:1]
[15]– [17] LPS decreases miR-29 in liver fibrosis. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
[1 to 20 of 16 sentences]
45
[+] score: 47
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
S1 File Mir29ab1 generation strategy (insert: Southern Blot to identify the mutated clones) (Fig A); mir29b2c generation strategy (insert: Southern Blot to identify the mutated clones) (Fig B); Real Time for miR29a in the miR29ab1 knockout mouse (Fig C); Real Time for miR29b in the miR29ab1 knockout mouse (Fig D); Real Time for miR29c in the miR29b2c knockout mouse (Fig E); spleens collected from 4 month old 29 ab1 ko and WT mice (Fig F); flow cytometry on bone marrow of miR29ab1 knockout mice versus wild type for the antibodies indicated in the table (n = 10; 5 wt +5 ko; p = 0.0001) (Table G); complete blood count for miR29ab1 knockout mice versus wild type (Table H);; cytogenetics for miR 29ab1 knockout failed to show any abnormalities (Fig I); Kaplan Meyer survival chart—miR29 double knockouts versus wild types (Fig K); histology of miR29 double knockout spleens show virtually absent myeloid lineage (Fig L). [score:9]
Based on the data and previous literature [4, 7, 10] we can surmise that on one hand miR29a deletion might interfere with the HSCs self-renewal through the upregulation of Wnt and CDC42 pathway whereas the absence of miR29b increases the expression of T-bet and interferon gamma in the CD4+ cells sharpening their selectivity for new HSCs which might result in increased auto- deletion of endogenous HSCs (S3A File). [score:6]
Our research does not confirm, at least in a mouse mo del, previous studies that indicated miR29b down-regulation as implicated in AML [5], even though that might have seemed like an attractive idea, in the light of the 7q deletion related MDS and the fact that miR29ab1 is localized on chromosome 7. However, our data seem to confirm many of the miR29a and b targets like DNMTs, especially 3a and 3b, as previously shown [9], interferon activated gene 202B [7], and one member of the Claudin family [10]. [score:6]
Northern Blots and RT-PCRs performed to check for the absence of miR expression in the homozygous for both miR29ab1 and b2c found total absence of miR29a and b in the 29ab1 knockout and lack of miR29c in the miR29b2c knockouts confirming that miR29b transcription comes mostly from the 29b1 gene (chromosome 7) and not the b2 (chromosome 1) [7, 8] (Fig 1 and S1C, S1D and S1E File). [score:5]
analysis identified upregulated mRNAs like DNMT3a and b in the miR29 knockouts vs wild type littermate controls. [score:5]
Recent research has shown that microRNA 29a is highly expressed in HSC and AML (acute myeloid leukemia) [4] whereas miR29 is deleted in AML cell lines [5]. [score:3]
Moreover, while we show that the miR29b2c knockout does not have the same phenotype as miR29ab1, we also are able to prove that when both miR29 clusters are deleted a marked decrease of organ and body size ensues, accompanied by a far more drastic diminution of the hematopoietic stem cells. [score:2]
As the miR29 double knockout shows, the combined absence of miR29a, b and c leads to extreme atrophy, pointing to the possibility of cooperation between the two clusters with the goal of maintaining the stem cell populations in various organs in the human body. [score:2]
Also, miR29 deficient bone marrow transplants failed to repopulate the bone marrow of irradiated wild type mice. [score:1]
Our results seem to be confirmed by recent work that shows miR29 to be involved in organ and body growth [12]. [score:1]
Their work is definitely very thorough; however, we do feel that our paper offers a more complete in vivo picture of the miR29 function. [score:1]
This indicates a more general role of the miR29 gene clusters in maintaining the size of viscera through an adequate amount of cellularity. [score:1]
Pathway graphic representation showing hypothetical roles of miR29a and miR29b deletion in the decreased of HSCs (Fig A). [score:1]
We cannot tell whether this is due to miR29a or b as it has already been shown that the mature sequence of mIR29b is transcribed mainly from the 29b1 gene and not b2 [8]. [score:1]
Mir29 double knockouts were markedly atrophic with an almost absent white pulp in the spleen (n = 4). [score:1]
MiR29 double knockouts exhibit markedly generalized atrophy. [score:1]
Therefore, we believe that the prior publication by Hu et al only represents a partial depiction of the consequences of miR29 deletion and that our report is a more detailed account to date of the effects of the deletion of not one but both miR29 clusters. [score:1]
[1 to 20 of 17 sentences]
46
[+] score: 47
TGF-β -associated pathways are important regulators of miR-29 expression, leading to triggering of the fibrotic response by decreasing miR-29 levels in cardiac fibroblasts, hepatic stellate cells, and dermal fibroblasts, and leading to a substantial increase in the aforementioned ECM target genes [78, 81, 82]. [score:6]
Further decreasing of miR-29b expression with a LNA-anti-miR-29b led to an acceleration of collagen encoding gene expression (COL1A1, COL2A1, COL3A1, COL5A1), as well as elastin (ELN). [score:5]
We found that miR-29b was the only member of the miR-29 family to be significantly down-regulated at three different time points during murine AAA development and progression [82]. [score:5]
Human AAA tissue samples displayed a similar pattern of reduced miR-29b expression with increased collagen gene expression in comparison to non-aneurysmal organ donor controls. [score:5]
Furthermore, matrix-metalloproteinases-2 and -9 (MMP2 and MMP9) were down-regulated in LNA-anti-miR-29b-transduced mice. [score:4]
Based on these observations, miR-29 seems to be a crucial regulator of aortic aneurysm disease through modulating genes and pathways which are responsible for ECM composition and dynamics. [score:4]
In these mice, AngII infusion increased miR-29b expression in samples derived from the entire aorta, which would seem to suggest that with aging the protective role of miR-29b during AAA development may be diminished. [score:4]
These results suggest that the aortic wall, which weakens due to steadily increasing diameter, acts to induce expression of collagens by repressing miR-29b levels, providing additional support to the aortic wall in an attempt to limit the risk for rupture. [score:3]
In accordance with our aforementioned results, Boon et al. found that systemic treatment with an LNA -modified anti-miR-29b significantly increased the expression of collagen isoforms (COL1A1, COL3A1), as well as ELN, and decreased suprarenal aortic dilatation in aged AngII -treated mice. [score:3]
They discovered that expression of the miR-29 family was increased in the aging mouse aorta [61]. [score:3]
Other fibrosis-related responses and diseases, such as liver [79] and kidney fibrosis [80], systemic sclerosis [81], as well as cardiac fibrosis in response to myocardial ischemia [78], have all been linked to repressed levels of miR-29. [score:3]
The miR-29 family of miRs contains three members (miR-29a, miR-29b, and miR-29c) that are encoded by two separate loci, giving rise to bi-cistronic precursor miRs (miR-29a/b1 and miR-29b2/c). [score:1]
4.3. miR-29b. [score:1]
[1 to 20 of 13 sentences]
47
[+] score: 44
We found that downregulation of MMP9 was associated with upregulation in the levels of mir29b and mir455 in the exosomes. [score:7]
Mir29b mimics did not completely inhibit the expression of MMP9 suggesting that it may not regulate MMP9 directly and there may be other mechanisms (Fig. 7B). [score:6]
With mir29b the use of mimics did not completely downregulate the expression of MMP9 (B). [score:6]
Although qRT-PCR confirmed the presence of all the microRNAs in the exosomes, the expression of mir29b and mir455 was significantly upregulated in the exercise group as compared to the non-exercise group. [score:5]
Of the four microRNAs there was significant upregulation of mir29b and mir455 (* P < 0.05) in the exercise group. [score:4]
The evidence provided by this study that exosomes released in exercise contain microRNAs (mir29b, mir455) to silence MMP9 can be extrapolated to replace MMP9 inhibitors which have not been successful so far for managing cardiac remo delling 23. [score:3]
The data suggest that mir29b may not regulate MMP9 directly. [score:3]
We used mimics and inhibitors for mir455 and mir29b in the HL-1 cell line (as described in our previous study 27) to evaluate the expression of MMP9. [score:3]
Figure 6Expression of mir29b, mir455, mir323-5p and mir466. [score:3]
However, with mir29b the results were not significant and suggested that there may be other mechanisms that are involved in the regulation of MMP9 by mir29b 39. [score:2]
Interestingly, we observed mir29b and mir455 in the exosomal population after exercise in type 2 diabetic mice which suggests that the exosomal content varies and depends upon the cells of origin at time of secretion. [score:1]
We observed the same trend with mir29b but it was not significant. [score:1]
[1 to 20 of 12 sentences]
48
[+] score: 44
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Moreover, miR-29 overexpression in murine HSC caused the downregulation of collagen expressions, including col1α1 and col1α2 [7, 18] through inhibiting mRNA expression of extracellular matrices. [score:12]
TGF-β1 signaling reportedly downregulates miR-29 expression in HSCs [7]. [score:6]
Bandyopadhyay S. Friedman R. C. Marquez R. T. Keck K. Kong B. Icardi M. S. Brown K. E. Burge C. B. Schmidt W. N. Wang Y. Hepatitis C virus infection and hepatic stellate cell activation downregulate miR-29: miR-29 overexpression reduces hepatitis C viral abundance in culture J. Infect. [score:6]
Since fibrosis represents a deregulation between ECM deposition and degradation, the miR-29–mediated suppression of ECM synthesis in HSCs could ideally counteract these excessive remo deling reactions that resulted in a low fibrosis activity in vivo. [score:4]
Consistent with our previous observation of the protective actions of miR-29 in liver fibrosis [3, 4], miR-29 also acts as a potent fibrosis -inhibitory regulator that alleviates TGF-β1/Smad3 -mediated renal fibrosis [21] and pulmonary fibrosis [22]. [score:4]
Through interacting with miR-29 promoter, Smad3 is observed to mediate TGF-β1 -induced inhibition of miR-29 [20]. [score:3]
Xiao J. Meng X. M. Huang X. R. Chung A. C. Feng Y. L. Hui D. S. Yu C. M. Sung J. J. Lan H. Y. miR-29 inhibits bleomycin -induced pulmonary fibrosis in mice Mol. [score:3]
Qin W. Chung A. C. Huang X. R. Meng X. M. Hui D. S. Yu C. M. Sung J. J. Lan H. Y. TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29 J. Am. [score:3]
Since fibrosis represents a balance between ECM deposition and degradation, miR-29–mediated suppression of ECM synthesis in HSCs can ideally tip this balance that attenuates fibrosis reactions. [score:3]
[1 to 20 of 9 sentences]
49
[+] score: 42
miR-29b and miR-29c also target YY1, a chromatin remo deling protein that recruits PRC2 and a histone deacetylase, HDCA, to suppress the expression of specific loci [46]. [score:7]
Here, using this murine melanoma mo del [26, 27], we demonstrate that Dnmt3a and Dnmt3b are downregulated in nonmetastatic (4C3−) and metastatic (4C3+) melanoma cell lines, concomitant with the overexpression of miR-29b and miR-29c, which are known Dnmt3a and Dnmt3b regulators [30]. [score:7]
Indeed, the miR-29 family is particularly interesting, as overexpression of its members in lung tumor cells significantly reduces Dnmt3a and Dnmt3b expression [30]. [score:5]
Given that miR-26 and miR-29 exhibit expression patterns similar to that of miR-203 in 4C3− cells treated with 5-aza-CdR, it is conceivable that these miRNAs are also epigenetically regulated in these cells. [score:4]
Since miR-29 family was validated to target Dnmt3a and Dnmt3b [30], the expression profile of the miR-29 family was evaluated and showed that miR-29a did not contribute to the phenotype of the malignant cells, as there were no statistically significant differences observed between the 3 studied cell lines (Figure 3(a)). [score:3]
Additionally, it highlights the importance of miR-26, miR-29, and miR-203 in promoting the imbalanced expression of genes involved in the epigenetic machinery during the malignant transformation of melanocytes. [score:3]
More specifically, miR-29b reduces DNMT1, DNMT3A, and DNMT3B expression in acute myeloid leukemia (AML) [44] and germ cells [45]. [score:3]
Nevertheless, miR-29b and miR-29c were significantly upregulated in 4C3+ and 4C3− cells, respectively, compared with melan-a cells (Figures 3(b) and 3(c), resp. [score:3]
miR-26 and miR-29 family members were also overexpressed in 4C3− cells compared with untreated cells (Figures 4(c), 4(d), 3(d), 3(e), and 3(f), resp. [score:2]
To our knowledge, this study provides the first evidence that miR-26a, miR-26b, miR-29b, and miR-29c might be epigenetically regulated in mouse and is in agreement with study of Desjobert and colleagues that showed miR-29a methylated in human lymphoma cells [56]. [score:2]
Furthermore, to determine whether miR-26, miR-29 family members and miR-203 could be epigenetically regulated, cells were treated with the hypomethylating agent 5-aza-deoxycytidine (5-aza-CdR). [score:2]
Taken together, these data suggest that epigenetic alterations that occur early during malignant transformation might be a result from the modulation of miR-26, miR-29, miR-203, and the consequent effects on key genes involved in the epigenetic machinery. [score:1]
[1 to 20 of 12 sentences]
50
[+] score: 42
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Increasing evidence shows that down-regulation of miR-29 is associated with fibrosis in a number of disease mo dels including ischemic cardiac remo deling [26], while overexpression of miR-29b is capable of inhibiting Smad3 -mediated kidney and lung fibrosis [23], [35]. [score:10]
miR-29b exerts an anti-fibrotic function through direct targeting of the 3′UTR regions in the mRNA for collagens I, III and IV and fibrillin and elastin [26]. [score:4]
Smad7 deficiency enhances Ang II -induced NF-κB signaling activation, upregulation of Sp1, but loss of miR-29b. [score:4]
Enhanced Activation of Sp1, TGF-β/Smad, and NF-κB Signaling Pathways and Downregulation of miR-29 are Mechanisms by which Deletion of Smad7 Promotes Cardiac Fibrosis and Inflammation. [score:4]
Upregulation of the Sp1-TGF-β/Smad-NF-κB pathway and loss of miR-29b may be mechanisms by which deletion of Smad7 enhances hypertensive cardiac remo deling. [score:4]
miR-29b is negatively regulated by both TGF-β/Smad3 and NF-κB-YY1 regulatory circuit [23], [26], [27]. [score:3]
show that deletion of Smad7 enhances activation of NF-κB signaling by promoting phosphorylation of IκBα and p65, promotes Sp1 expression, but induces loss of cardiac miR-29b. [score:3]
It is also reported that miR-29b can interact with Sp1 to form the Sp1/NFκB/HDAC/miR-29b regulatory network in myeloid leukemia [36]. [score:2]
Moreover, it has been shown that loss of miR-29b is associated with cardiac fibrosis and is negatively regulated by both TGF-β/Smad3 and NF-κB-YY1 [23], [26], [27], we examined whether deletion of Smad7 causes enhanced Ang II -induced loss of cardiac miR-29b during cardiac remo deling. [score:2]
In addition, miR-29b expression was detected by real-time PCR using the Taqman microRNA Assay (Applied Biosystems, Foster City, CA) with small nuclear RNA U6 as an endogenous control for normalization as previously described [23]. [score:2]
All these findings suggest that Ang II -induced loss of miR-29b via TGF-β/Smad3 and NF-κB -dependent pathways may also be an additional mechanism by which deletion of Smad7 promotes Ang II -induced cardiac remo deling. [score:1]
Enhanced activation of Sp1-TGF-β/Smad-NF-κB signaling pathways and loss of cardiac miR-29 were key mechanisms by which deficiency of Smad7 promoted Ang II -mediated cardiopathy. [score:1]
As shown in Figure 7D, real-time PCR showed that miR-29b was significantly decreased in the hypertensive heart of Smad7 WT mice, which became almost undetectable in Ang II-infused Smad7 KO mice. [score:1]
Interestingly, we also found that loss of miR-29 may be an additional mechanism through which disruption of Smad7 enhances Ang II -mediated cardiac fibrosis and inflammation. [score:1]
[1 to 20 of 14 sentences]
51
[+] score: 42
miR-29 family members indirectly upregulate p53 levels and induce apoptosis in a p53 -dependent manner by suppressing p85a (the regulatory subunit of PI3Kinase) and CDC42 (a Rho family GTPase), both of which negatively regulate p53 [52]. [score:9]
Among this list, forty miRNAs showed significant down-regulation whereas four miRNAs, miR-29a, miR-29b, miR-34a and miR-124, were up-regulated. [score:7]
Overexpression of miR-29 family members inhibits cell proliferation [50]. [score:5]
miRNAs that showed approximately 2-fold upregulation include members of the miR-29 family and miR-34 family, which have been demonstrated to be involved in cellular senescence and apoptosis in cell lines, tissues, and organisms during aging [48]– [51]. [score:4]
miR-29a and miR-29b were significantly upregulated in both strains of mice in our study. [score:4]
miR-29 can suppress several important genes that drive cell survival (e. g. Cdc42, p85a, Mcl1, and Tcl1). [score:3]
The increased expression of miR-29 during aging and the pro-apoptotic nature of this family indicate miR-29 is likely involved in the degeneration of the OC. [score:3]
Whereas miR-29 regulates genes upstream of p53 pathways and miR-34a regulates genes downstream of p53 pathways, the results suggest that miRNAs contribute to p53 -dependent apoptosis in degeneration of the OC in the inner ear. [score:3]
A number of other miRNAs including the miR-29 family, miR-34 family, miR-15/16, miR-17-92 cluster, miR-146a/b, and miR-200 family are all known to be involved in networks regulating cell senescence and death [8]– [10]. [score:2]
High levels of miR-29 may render the cells more susceptible to p53 -dependent stress responses [54]. [score:1]
Both miR-29 and miR-34 can affect genes that activate or enhance p53 pathways. [score:1]
[1 to 20 of 11 sentences]
52
[+] score: 40
As illustrated in Figure 2, TGF-β1 up-regulates miR-21, miR192, miR-377, miR-382, and miR-491-5p, but down-regulates miR-29 and miR-200 families during renal fibrosis (Kantharidis et al., 2011; Kriegel et al., 2012; Lan and Chung, 2012; Chung et al., 2013a, b). [score:7]
The miR-29 and miR-200 are TGF-β1 -dependent anti-fibrotic miRNAs that are extensively suppressed in the diseased kidneys (Qin et al., 2011). [score:5]
Overexpression of miR-29 attenuates renal fibrosis in vivo in obstructive and diabetic nephropathies and suppresses the fibrotic genes in vitro in response to various stimuli including TGF-β1, high glucose or salt -induced hypertensive conditions (Du et al., 2010; Liu et al., 2010; Qin et al., 2011; Chen et al., 2014). [score:5]
Moreover, recent studies also revealed that overexpression of miR-29, miR-200 or inhibition of miR-21 and miR-192 can effectively decelerate the progression of renal fibrosis (Oba et al., 2010; Chung et al., 2010a; Qin et al., 2011; Zhong et al., 2011, 2013; Chen et al., 2014) (Figure 3). [score:5]
Of note, more than 20 ECM-related genes, including collagens, are potential targets for miR-29 where some of them are regulated by the TGF-β signaling (van Rooij et al., 2008; Xiao et al., 2012). [score:4]
TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29. [score:3]
miR-29 inhibits bleomycin -induced pulmonary fibrosis in mice. [score:3]
Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. [score:2]
MicroRNA-29b inhibits diabetic nephropathy in db/db mice. [score:2]
Furthermore, a number of miRNAs, such as let-7b and miR-29, are capable of regulating TGF-β signaling and altering the progression of renal fibrosis (Kato et al., 2011; Xiao et al., 2012; Wang et al., 2014). [score:2]
Renal medullary microRNAs in Dahl salt-sensitive rats: miR-29b regulates several collagens and related genes. [score:2]
[1 to 20 of 11 sentences]
53
[+] score: 39
This included seven (87.5%; miR-16-5p, miR-29b-3p, miR-29a-3p, miR-503-5p, miR-15a-5p, miR-155-5p, and miR-425-5p) that were significantly upregulated and one (12.5%; miR-880-3p) that was downregulated (>2 folds, P < 0.05). [score:7]
Furthermore, HepG2 cells transfected with miR-29a and miR-29b mimic significantly downregulated its target mRNA expression such as Col3a1 and Col1a1 genes, compared to those of mock group (Figures 5(c) and 5(d)). [score:7]
To determine whether the miRNAs dysregulate expression of their predicted target genes, we transfected 3 different types of miRNA mimics (hsa-miR-15a-5p mimic, hsa-miR-29a-3p mimic, and hsa-miR-29b-3p mimic) and 1 positive (hsa-miR-1 mimic) or negative control siRNA (AllStar negative control siRNA) into HepG2 cells. [score:6]
This study observed that expression of the miRNAs miR-155-5p, miR-425-5p, miR-15a-5p, miR-503-5p, miR-16-5p, miR-29a-3p, and miR-29b-3p in the liver of Cmah -null mice may downregulate components of the insulin/PI3K-AKT signaling pathway in concert with other genes. [score:6]
Among them, miR-155-5p, miR-425-5P, miR-15a-5p, miR-503-5p, miR-16-5p, miR-29a-3p, and miR-29b-3p were significantly upregulated in the liver and pancreas of Cmah -null mice. [score:4]
As shown in Figure 4(b) miR-155-5p miR-15a-5p, and miR-425-5p in the case of insulin signaling and miR-29b-3p, miR-29a-3p, miR-16-5p, and miR-503-5p in the case of PI3K-AKT1-mTOR signaling were significantly dysregulated. [score:2]
It has been well demonstrated that miRNAs such as miR-375, miR-29, miR-320, miR-103, miR-107, and miR-126, play a crucial role in regulating glucose and lipid metabolism through control of pancreatic islet cell function, adipocyte insulin resistance, hepatocyte insulin signaling, and glucose homeostasis [15– 19]. [score:2]
For example, in obesity and diabetes, it has been demonstrated that miRNAs such as miR-375, miR-29, miR-320, miR-103, mir-107, and miR-126 play a crucial role in the regulation of glucose and lipid metabolism. [score:2]
Hsa-miR-15a-5p mimic, hsa-miR-29a-3p mimic, hsa-miR-29b-3p mimic, hsa-miR-1 mimic, and AllStar negative control siRNA were purchased from Qiagen (Valencia, CA, USA). [score:1]
Among them, we found two major signal pathways such as insulin signaling (miR-155-5p, miR-425-5p, and miR-15a-5p) and PI3K-AKT signaling (miR-503-5p, miR-16-5p, miR-29a-3p, and miR-29b-3p) pathways (Table 2). [score:1]
The final concentrations of the transfectants (hsa-miR-15a-5p mimic, hsa-miR-29a-3p mimic, and hsa-miR-29b-3p mimic) and their respective controls (AllStar siRNA for negative control and hsa-miR-1 mimic for positive control) were either 10 nM (miRNA mimic) or 50 nM (siRNAs). [score:1]
[1 to 20 of 11 sentences]
54
[+] score: 37
Lastly, the miR-29 family may also promote neuroprotection via the direct suppression of disease-linked pathways (Figure 1). [score:6]
In agreement with a critical role in the brain, miRNA profiling studies have reported that miR-29a is expressed abundantly in neurons in the adult mouse brain, while miR-29b expression increases in various compartments of the maturing mouse CNS (Kole et al., 2011; Jovicic et al., 2013). [score:5]
Overall, functional studies focusing on miR-29 align well with its inverse association with neurodegenerative disease and point to a conserved role for this miRNA family in neuroprotection. [score:3]
Several studies employing mouse mo dels and human cell lines have examined the involvement of miR-29 in neurodegenerative diseases. [score:3]
This phenotype appears to be mediated in part by the de-repression of VDAC1, an apoptotic effector protein and miR-29b target. [score:3]
miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. [score:3]
In this study, partial phenotypic rescue was achieved by the restoration of miR-29b expression. [score:3]
The notion that these patterns may represent disease-promoting mechanisms rather than just correlational markers stems from the observation that perturbing miR-29 function is associated with compromised neuronal survival. [score:3]
For instance, knocking down miR-29b in the mouse brain using LNA -based antagomirs induces severe cerebellar and hippocampal degeneration, which manifests in ataxia and eventually leads to death (Roshan et al., 2014). [score:2]
Brain-specific knockdown of miR-29 results in neuronal cell death and ataxia in mice. [score:2]
Loss of miR-29b following acute ischemic stroke contributes to neural cell death and infarct size. [score:1]
Consistent with a role in neuroprotection, diminished levels of miR-29 family members have been reported in both patients or mouse mo dels of AD, HD, and various subtypes of SCA (Lee et al., 2011; Wang et al., 2011b). [score:1]
One family of miRNAs that has emerged as putatively protective is the miR-29 family (Figure 1). [score:1]
Reduced miR-29b levels are also associated with increased susceptibility to neuronal apoptosis in mouse mo dels of acute ischemic stroke (Khanna et al., 2013). [score:1]
[1 to 20 of 14 sentences]
55
[+] score: 36
Other miRNAs from this paper: mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
A previous study revealed that SIRT1 was the direct target gene of miR-29 (Xu et al., 2014) and that expression of miR-29b was upregulated in the ARHL mouse mo del (Zhang et al., 2013). [score:9]
In vitro experiments showed that overexpression of miR-29b in HEI-OC1 cells inhibited SIRT-1 and PGC-1α protein levels, causing mitochondrial dysfunction and hair cell apoptosis, whereas in miR-29b knockdown cells, the SIRT1 and PGC-1α protein levels, as well as their mRNA levels, were all significantly upregulated (Xue et al., 2016). [score:9]
From the above research, we propose that expression of miR-29b may be increased in the inner ear with aging, which reduces the expression of its target SIRT1 and affects downstream PGC-1α and FNDC5. [score:7]
miR-29b overexpression induces cochlear hair cell apoptosis through the regulation of SIRT1/PGC-1alpha signaling: Implications for age-related hearing loss. [score:4]
Though no previous study has explored the changes of miR-29b in the brains of AD patients, we believe that SIRT1/PGC-1α (FNDC5) may be a possible drug target to prevent patients with ARHL from developing AD. [score:3]
Consequently, it was hypothesized that miR-29b/SIRT1/PGC-1α signaling most likely plays a role in regulating hair cells apoptosis and in the pathogenesis of ARHL. [score:2]
The miR-29b-Sirt1 axis regulates self-renewal of mouse embryonic stem cells in response to reactive oxygen species. [score:2]
[1 to 20 of 7 sentences]
56
[+] score: 34
Other miRNAs from this paper: mmu-mir-29b-2, mmu-mir-455
We performed real time expression of three microRNAs‐122a, 29b and 455‐5p since we found in our previous reports that mir29b and 455‐5p regulate the levels of MMP9 6 and mir122a is associated with TIMP4 expression 9. We observed up‐regulated expression of mir122a and down‐regulated expression of mir29b and 455‐5p (Fig. 11). [score:12]
We checked the expression of micro RNAs 122a which we reported earlier to be involved in TIMP4 regulation and mir29b and mir455‐5p, which were reported to be involved in MMP9 regulation. [score:5]
We also evaluated the expression of mir29b, and mir455‐5p which we have reported to regulate the expression of MMP9 6. Although, there are no studies in heart that explain epigenetic silencing of TIMP4 due to methylation, but there is a report in lung cancer which shows that CpG islands in the TIMP4 promoter region get methylated 15. [score:4]
Since mir29b and mir455‐5p regulate the expression of MMP9, the high MMP9 levels in AVF mice can be partially attributed to these two microRNAs. [score:4]
E. M., AVF versus WT, Student's t‐test, n = 6) and down‐regulated expression of mir29b and mir455‐5p in AVF mice as compared to WT (* P < 0.05, ±S. [score:3]
Real time expression of mir122a, mir29b and 455‐5p. [score:3]
We also evaluated mir29b and mir455‐5p which have been shown to regulate MMP9 6. We observed down‐regulated expression of these two microRNAs in AVF mice as compared to WT mice. [score:2]
To validate this hypothesis, we created heart failure mo del by creating AV fistula in C57 BL/6 mice and looked into the promoter methylation (methylation specific PCR, high resolution melting, methylation sensitive restriction enzyme and Na bisulphite treatment followed by sequencing), histone modification (Ch IP assay) and micro RNAs that regulate TIMP4 (mir122a) and MMP9 (mir29b and mir455‐5p). [score:1]
[1 to 20 of 8 sentences]
57
[+] score: 34
Three of the four genes were significantly (p<0.05) down regulated by the over -expression of miR-29 and three genes were significantly (p<0.05) up regulated by the antagomiR -mediated inhibition of miR-29 (Fig. 4B). [score:7]
The x-axis lists the gene symbols for each of four predicted miR-29 target genes and the y-axis depicts the relative quantitative value (RQV; expression determined by RT-qPCR and normalized to Rps9) in response to the miR-29 mimic (blue) or the miR-29 inhibitor (red) relative to mock transfection. [score:7]
We evaluated several predicted gene targets of our top candidate regulatory hub, miR-29, and demonstrated the potential of the 5′-shifted isomiRs miR-375+1 and miR-375-1 to differentially regulate gene expression in MIN6 cells. [score:5]
Though miR-29 has been shown to regulate glucose-stimulated insulin secretion, its target genes in the beta cell are largely unknown. [score:4]
To validate the in silico approach, we selected several predicted targets (Camk1d, Glis3, and Jazf1), and one previously validated target (Slc16a1 [48]), of miR-29 from among the for evaluation in MIN6 cells. [score:3]
MIN6 cells were transiently transfected with (1) 10 nM mmu-miR-29 mimic (Dharmacon); (2) 200 nM mmu-miR-29 hairpin -inhibitor (Dharmacon); (3) 10 nM mmu-miR-375 mimic (Dharmacon); (4) 10 nM custom mmu-miR-375+1 mimic (Dharmacon: 5′-UUGUUCGUUCGGCUCGCGUGA-3′) or (5) 10 nM custom mmu-miR-375-1 mimic (Dharmacon: 5′UUUUGUUCGUUCGGCUCGCGUGA-3′). [score:3]
These findings are consistent with previous reports that miR-29 is involved in the regulation of beta cell function [48], [50], and they serve as a validation of the in silico regulatory hub analysis. [score:3]
Specifically, we transiently transfected MIN6 cells with a miR-29 mimic or inhibitor (antagomiR) and measured the mRNA levels of each of the four genes by real-time quantitative PCR (RT-qPCR). [score:1]
The top two were the 5′-reference miRNAs miR-29 and let-7, both of which have been implicated in beta cell function and glucose homeostasis [47]– [49]. [score:1]
[1 to 20 of 9 sentences]
58
[+] score: 32
Low relative expression of miR-29 during early development and high expression during late involution were paralleled by increased and reduced relative expression of seed match-harbouring transcripts, respectively. [score:8]
The down-regulation of miR-29 targets, enriched for focal adhesion genes, would fit with the extensive remo delling and changes during late involution. [score:6]
Figure 5 shows results for the miR-29 family, which showed greatest evidence for changes in the expression of predicted targets (P < 0.05 after Benjamini-Hochberg correction). [score:5]
Figure 5 Predicted targets for the miR-29 family show systematic changes in their relative expression. [score:5]
However, we did observe trends for individual miRNA families (Additional file 7), most notably the miR-29 family, for which miRNAs and targets showed anti-correlated expression (Figure 5). [score:5]
Among putative miR-29 targets genes related to focal adhesion were significantly overrepresented (Additional file 4). [score:3]
[1 to 20 of 6 sentences]
59
[+] score: 32
HL-1 atrial cardiomyocytes transfected with miR-29 and miR-200 (Fig 8) significantly down-regulate Cacna1c, Hnc4 and Ryr2 expression, while Camk2a was significantly decreased with miR-200 but not miR-29 (Fig 8). [score:6]
miR-29 over -expression in HL1 atrial cardiomyocyte deregulate Cacna1c, Hnc4 and Ryr2, influencing therefore both the calcium handling and pacemaker activity, whereas miR-200 regulated Cacna1c, Ryr2 and Camk2a, in addition to Scn5a as previously reported [64], impacting therefore also in calcium handling. [score:5]
Observe that miR-29 and miR-200 over -expression leads to significant decreased of Cacna1c, Hcn4, Ryr2 and Camk2a (except for miR-29a) expression. [score:5]
We provide herein evidences that miR-29 and miR-200 over -expression also contributes to ion channel expression remo deling. [score:5]
Thus these data demonstrate that miR-29 and miR-200 impaired expression also contributes to develop pro-arrhythmogenic substrates. [score:3]
We have previously demonstrated that Pitx2 modulates expression of miR-29 and miR-200, among other microRNAs [16] and furthermore we have demonstrated in this study that modulation of distinct ion channel is greatly influenced by H [2]0 [2] administration while microRNA signature is mostly dependent on Pitx2c but not H [2]0 [2] administration. [score:3]
Whereas it is wi dely documented that redox signaling can compromise ion channel functioning and calcium homeostasis in cardiomyocytes [67], in our system we observed no influence of H [2]O [2] administration on the regulatory impact of Pitx2 in distinct ion channels such as Scn5a, Kcnj2 and Cacna1c as well as multiple Pitx2-regulated microRNAs such as miR-1, miR-26, miR-29 and miR-200, in which redox impairment impact is less documented [68]. [score:3]
Importantly, miR-29 and miR-200 are not significantly impaired in SHR atrial chambers, suggesting that Wnt-microRNA might be a pivotal candidate establishing fundamental differences between HTD and HTN in atrial arrhythmogenesis susceptibility. [score:1]
Modulation of miR-29 and miR-200 alters cardiac action potential determinants. [score:1]
[1 to 20 of 9 sentences]
60
[+] score: 31
Bioinformatic analyses with miRBase, Target Scan, and Pic Tar indicated that MMP-2 regulation could be mediated by miR-29s, and evidence indicated that miR-29b is involved in tumor angiogenesis, invasion, and metastasis by mediating MMP-2 protein expression [15]. [score:6]
AMD: Age-related macular degeneration; CNV: Choroidal neovascularization; miR-29: microRNA 29; HUVEC: Human umbilical vein endothelial cell; MMP-2: Matrix metallopeptidase-2; MT1-MMP: Membrane type1 metalloprotease; NFκB: Nuclear factor kappa-like-chain-enhancer of activated B cells; ODN: Oligodeoxynucleotide; RPE: Retinal pigment epithelial cell; RT-qPCR: Reverse transcription quantitative real-time PCR; TIMP: Tissue inhibitors of metalloproteinase; TNFα: Tumor necrosis factor alpha; VEGF: Vascular endothelial growth factor; UTR: untranslated region. [score:5]
Consequently, we tested the possible regulatory effect of TNFα on the miR-29 family and determined stimulation with TNFα (10 ng/mL) resulted in significant down-regulation of all miR-29 members (Figure  4). [score:5]
To gain more information about the regulation of MMP-2 in CNV, we analyzed the circuitry associated with MMP-2 regulation in a CNV mo del and in cell cultures, focusing on NFκB and the microRNA-29 family (miR-29s). [score:3]
It was recently shown that the transcription factor NFκB negatively regulates miR-29 b/c in various cells [18, 23]. [score:2]
C, HEK-293 cells were cultured in 96-well dishes, and each well was transfected with 50 ng pMIR-MMP-2 3’UTR/firefly luciferase, 25 ng pRL-SV40 Renilla luciferase vector, and 5 nM miR-29 mimics or 5 nM NC. [score:1]
HEK-293 cells were transfected in serum-free DMEM into 24-well plates with 50 ng pMIR-MMP-2 3’UTR containing firefly luciferase coding sequence, 25 ng pRL-SV40 Renilla vector (Promega Branch, Beijing, China) and 5 nM miR-29 mimics or negative control mimics (NC). [score:1]
Transfection with individual miR-29 reduced protein levels of MMP-2 to a similar level, but transfection with miR-29 b/c induced a larger decrease in EA hy926 than did transfection with miR-29a (Figure  5A and B). [score:1]
Figure 2 Decreased miR-29 s level in choroidal-RPE tissue of CNV. [score:1]
For instance, as reported, epigenetic modification by miR-29b is distinct from miR-29a and c [38], whereas miR-29a specifically modulates the angiogenic process in endothelial cells [39]. [score:1]
Further bioinformatic analysis reveals a complementary sequence for all the miR-29 members in the 3’-UTR of MMP-2 (data not shown). [score:1]
Figure 4 TNFα reduced miR-29 s, which was reversed by NFκB decoy. [score:1]
Specifically, the microRNA-29 family (miR-29s) consists of a miR-29a/b1 cluster in one chromosome and a miR-29b2/c cluster in a different chromosome. [score:1]
The ARPE-19 cells were then treated with TNFα (10 ng/mL) for 12 hours and miR-29 s levels were determined by RT-qPCR. [score:1]
We transfected both types of cells with miR-29 mimics or non-specific control miRNA mimics (NC mimic). [score:1]
[1 to 20 of 15 sentences]
61
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
62
[+] score: 30