sort by

231 publications mentioning mmu-mir-30a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-30a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 403
In this study, the results demonstrated that, in H. pylori-infected MKN45 cells, compared with the miR-67 mimic, the miR-30a-5p mimic can significantly down-regulate the mRNA and protein expression of Cyclin D1, MMP7, CD44 and c-Myc, while the miR-30a-5p inhibitor can up-regulate the expression of β-catenin downstream target genes, but no statistical significance was found between the miR-30a-5p inhibitor and miR-67 mimic (Fig.   4G–I). [score:16]
analysis showed that, in H. pylori-infected MKN45 cells, the miR-30a-3p mimic significantly inhibited the expression of COX-2 protein, whereas miR-30a-3p inhibitor partly blocked the inhibitory effect of in situ miR-30a-3p on the expression of COX-2 protein (Fig.   3A). [score:11]
Further studies showed that, in H. pylori-infected MKN45 cells, BCL9 protein expression was significantly increased, and the miR-30a-5p mimic could significantly reduce the expression of BCL9 compared to the miR-67 mimic, while the miR-30a-5p inhibitor blocked the inhibitory effect of in situ miR-30a-5p on BCL9 protein expression (Fig.   4B). [score:10]
Next, real-time PCR was performed to further validate the differentially expressed miRNAs after H. pylori infection in MKN45 cells for 12 h and 24 h. The results showed that, all the miRNAs including miR-29b-1, miR-3125, miR-30a-3p, miR-340, miR-301a, and miR-451 showed decreased expression of varying levels, and the downregulation of miR-30a-3p expression was particularly notable (Fig.   1C). [score:10]
Regulatory effect of miR-30a-3p on the COX-2 expression and nuclear translocation of β-catenin in H. pylori-infected gastric cancer cellsThe preliminary results showed that miR-30a-3p regulated COX-2 mRNA expression but not COX-2 protein expression. [score:9]
All the experimental groups of mice were pretreated with no food for 12 h and no drinking for 4 h. After gavage administration, the mice were kept with no food and drinking for another 4 h. Moreover, H. pylori-infected miR-30a knockout mice showed up-regulated expression of above mentioned COX-2 and BCL9, as well as the growth and metastasis associated genes expression such as VEGF and CD34 (marker of microvessel density, MVD). [score:9]
In addition, we also found that, compared with the healthy controls, the expression levels of both miR-30a-5p and miR-30a-3p were down-regulated in the tissue samples from H. pylori gastritis and H. pylori-related gastric cancer, and the expression levels of miR-30a-5p and miR-30a-3p were even lower in H. pylori-related gastric cancer than that of H. pylori gastritis (Fig.   7E). [score:7]
Similarly, transwell experiments also showed that, the miR-30a-3p mimic inhibited the invasion and migration of H. pylori-infected MKN45 cells, whereas the miR-30a-3p inhibitor blocked the inhibitory effect of in situ miR-30a-3p on the invasion and migration abilities of H. pylori-infected MKN45 cells (Fig.   2D,E). [score:7]
In our study, we found that the double-stranded miR-30a precursor could be processed to generate single-stranded miR-30a-3p and miR-30a-5p, and showed enhanced inhibitory effect on the expression of COX-2 and BCL9 compared to the individual effect of miR-30a-3p or miR-30a-5p, as well as the regulating effect on LEF/TCF promoter activity and transcription of downstream target genes such as Cyclin D1, MMP7, CD44, and c-Myc. [score:7]
As is shown in Fig.   2A–C, the miR-30a-3p mimic significantly inhibited the growth and colony formation of H. pylori-infected MKN45 cells, whereas the miR-30a-3p inhibitor blocked the inhibitory effect of in situ miR-30a-3p on the growth and colony formation of H. pylori-infected MKN45 cells. [score:7]
Our study found that, miR-30a-5p binds to the 3′UTR region of the BCL9 gene and inhibits its translation, thereby affecting the activity of nuclear TCF/LEF transcription factor and transcription of β-catenin downstream target genes, thus ultimately affecting the growth and migration functions of H. pylori-infected gastric cancer cells. [score:7]
These results indicated that, miR-30a-5p can target BCL9 to inhibit the promoter activity of TCF/LEF and transcriptional activity of β-catenin downstream target genes. [score:7]
In H. pylori-infected MKN45 cells, H. pylori significantly increased the dual luciferase activity of the TCF/LEF promoter, and the miR-30a-5p mimic significantly decreased the dual luciferase activity of the TCF/LEF promoter compared with the miR-67 mimic group, while the miR-30a-5p inhibitor blocked the inhibitory effect of in situ miR-30a-5p on the dual luciferase activity of the TCF/LEF promoter but there was no statistically significant difference between the effects of the miR-67 mimic and miR-30a-5p inhibitor (Fig.   4F). [score:6]
In summary, the results of our in vitro and in vivo experiments indicate that, miR-30a, the complementary sequence of miR-30a-3p and miR-30a-5p, functions as a tumor suppressor by double -targeting COX-2 and BCL9 in H. pylori-infected gastric cancer cells and significantly affects the development of H. pylori -induced gastric cancer, shedding new light on the mechanisms underlying H. pylori -associated gastric cancer (Fig.   S8). [score:6]
The preliminary results showed that miR-30a-3p regulated COX-2 mRNA expression but not COX-2 protein expression. [score:6]
However, as observed in MKN45 cells, compared with individual miR-30a-3p or miR-30a-5p, the miR-30a precursor had an increased inhibitory effect on COX-2, BCL9, Cyclin D1 and MMP7 expression in H. pylori-infected SGC-7901 cells (Fig.   3D,E), and an increased inhibitory effect on LEF/TCF promoter activity (Fig.   3F). [score:6]
Compared with the individual miR-30a-3p or miR-30a-5p, the miR-30a precursor had excellent inhibitory effects on both mRNA and protein expression of COX-2 and BCL9 in H. pylori-infected MKN45 cells (Fig.   5B,C), and the miR-30a precursor also showed a double inhibitory effect on the luciferase activities of pmirGLO-COX-2-3′UTR and pmirGLO-BCL9-3′UTR (Fig.   5D). [score:6]
analysis of randomly selected tissues also showed that, the expression levels of COX-2 and BCL9 protein were significantly up-regulated in H. pylori-infected miR-30a knockout mouse mo del compared with the H. pylori-infected wild-type mice mo del (Fig.   7F). [score:6]
Further systematical analysis demonstrated that, miR-29b-1, miR-3125, miR-30a-3p, miR-340, miR-301a and miR-451 were the most significantly down-regulated miRNAs that target the COX-2 gene in H. pylori-infected MKN45 cells (Fig.   1A,B). [score:6]
Moreover, in H. pylori-infected MKN45 cells, compared with the miR-30a-3p mimic or miR-30a-5p mimic, the miR-30a precursor showed an increased inhibitory effect on the LEF/TCF promoter activity (Fig.   5E) and the expression of β-catenin downstream target genes such as Cyclin D1 and MMP7 (Fig.   5B,C). [score:6]
However, the detailed mechanism of miR-30a-5p targeting BCL9 to regulate the downstream gene expression or involved signaling pathways in H. pylori-infected gastric cancer is unclear. [score:6]
Therefore, another aim of the current study was to determine if miR-30a-5p targets BCL9 to regulate TCF/LEF promoter activity [16] and downstream gene expression of β-catenin. [score:6]
Since the dysregulation of oncogenes or suppressors such as miR-30a and the abnormal activation of oncogenic pathways such as Wnt/β-catenin have been achieved before H. pylori eradication, to seek more effective drugs targeting the involved genes or signaling pathway is more real in therapy for H. pylori-related gastric cancer. [score:6]
Real-time PCR results indicated that, in H. pylori-infected MKN45 cells, the miR-30a-5p mimic significantly inhibited the expression of BCL9 mRNA, which was consistent with the results of the dual luciferase detection (Fig.   4A). [score:5]
In the bioinformatics screen for miR-30a targets, we found that miR-30a-5p, the reverse complementary sequence of miR-30a-3p, targeted binding sites of the key cofactor BCL9 in the Wnt/β-catenin signaling pathway. [score:5]
Our studies indicated that, in H. pylori-infected MKN45 cells, the miR-30a-3p mimic significantly inhibited nuclear translocation of β-catenin, while the miR-30a-3p inhibitor partly increased the nuclear translocation of β-catenin but without significant differences (Fig.   3B,C). [score:5]
In this study, using microarray analysis, bioinformatics prediction, dual luciferase activity experiments and other means, miR-30a-3p was identified to have an inhibitory effect on growth and migration of H. pylori-infected gastric cancer cells through targeting the COX-2 gene. [score:5]
miR-30a-3p was identified by microarray analysis as one of the upstream regulatory factors that target COX-2, and its regulatory mechanisms associated with the β-catenin signaling pathway 12, 13 are the new findings to be elaborated in this study. [score:5]
It was found that, all the miRNAs have inhibitory effect on the dual luciferase activity of COX-2 3′UTR, and miR-30a-3p showed the most significant inhibitory effect (Fig.   1E). [score:5]
H. pylori-infected miR-30a knockout mice show increased incidence of precancerous lesions and adenocarcinoma manifestationsThe in vivo experiment demonstrated that, after H. pylori infection for 10 weeks, 25 weeks, and 45 weeks, whether in the control wild-type mouse mo del or in miR-30a knockout mouse mo del, the H. pylori colonization rates in the antrum and gastric mucosal were both very high, and at 45 weeks the H. pylori colonization rate of all the mice reached 100%, although several mice died of natural causes without obvious disease symptom by pathological examination. [score:5]
Moreover, the immunohistochemistry (IHC) results showed that, 72 weeks after H. pylori infection, compared with the H. pylori-infected wild-type mouse mo del, the H. pylori-infected miR-30a knockout mouse mo del displayed significantly increased CD34 expression, as well as the COX-2 and VEGF expression (Fig.   5A,B). [score:5]
Using CRISPR/Cas9 gene targeting techniques, gRNA targeting miR-30a was built, and used to guild Cas9 protein to shear DNA duplexes at specific sites. [score:5]
These results suggested that miR-30a-5p can significantly inhibit the expression of BCL9. [score:5]
Expression of COX-2, BCL9, β-catenin, VEGF and CD34 in the miR-30a knockout mouse mo del. [score:4]
miR-30a knockout reduced both the expression levels of miR-30a-3p and miR-30-5p for their complementary stem-loop structure in the presence of miR-30a precursor. [score:4]
miR-30a precursor targets COX-2 and BCL9 to regulate the growth and migration of H. pylori-infected gastric cancer cells. [score:4]
These results suggested that, miR-30a-3p could affect the biological function of H. pylori-infected gastric cancer cells by regulating COX-2 expression and nuclear translocation of β-catenin protein. [score:4]
All the above results demonstrated that, the miR-30a precursor targets COX-2 and BCL9 to regulate the growth and migration of H. pylori-infected gastric cancer cells. [score:4]
However, the miR-30a-3p mimic had no direct effect on the mRNA and total protein expression of β-catenin (Fig.   3B–D), and miR-30a-3p also had little effect on the dual luciferase activity of the 3′UTR of β-catenin encoding gene (CTNNB1) (Fig.   3E). [score:4]
Regulatory effect of miR-30a-3p on the COX-2 expression and nuclear translocation of β-catenin in H. pylori-infected gastric cancer cells. [score:4]
In addition, the phenotype observation showed that, miR-30a knockout had little influence on the growth and development of the miR-30a knockout mice. [score:4]
miR-30a precursor targets COX-2 and BCL9 to regulate the growth and migration of H. pylori-infected gastric cancer cellsmiR-30a-3p and miR-30a-5p exhibit a complementary stem-loop structure in the presence of the miR-30a precursor. [score:4]
All these results suggested that, miR-30a was associated closely with the development of H. pylori -induced gastric cancer, and regulated the genes closely associated with tumor development such as COX-2, BCL9, nuclear β-catenin, VEGF and CD34. [score:4]
Regulatory effect of miR-30a-5p on the BCL9-TCF/LEF signaling pathway in H. pylori-infected gastric cancer cells Bioinformatics analysis indicated that, miR-30a-5p, another production of the miR-30a precursor, showed targeted binding sites on the 3′UTR of the BCL9 gene, which is the critical auxiliary protein in the β-catenin signaling pathway. [score:4]
The in vivo experiment demonstrated that, after H. pylori infection for 10 weeks, 25 weeks, and 45 weeks, whether in the control wild-type mouse mo del or in miR-30a knockout mouse mo del, the H. pylori colonization rates in the antrum and gastric mucosal were both very high, and at 45 weeks the H. pylori colonization rate of all the mice reached 100%, although several mice died of natural causes without obvious disease symptom by pathological examination. [score:4]
Figure 7Expression of miR-30a, COX-2, BCL9, β-catenin, VEGF and CD34 in the H. pylori-infected miR-30a knockout mouse mo del. [score:4]
Meanwhile, the mRNA expression levels of both COX-2 (PTGS2) and BCL9, significantly increased in the H. pylori-infected miR-30a knockout mouse mo del comparing with the H. pylori infected wild-type mice (Fig.   7D,E). [score:4]
In addition, the miR-30a precursor showed an increased inhibitory effect on the growth and migartion of H. pylori-infected gastric cancer cells. [score:3]
Since miR-30a is a short, non-coding sequence, the appropriate target was chosen for gRNA designing. [score:3]
Bioinformatics analysis indicated that, miR-30a-5p, another production of the miR-30a precursor, showed targeted binding sites on the 3′UTR of the BCL9 gene, which is the critical auxiliary protein in the β-catenin signaling pathway. [score:3]
Real-time PCR showed that, 72 weeks after H. pylori infection, compared with the H. pylori-infected wild-type mouse mo del, miR-30a expression in H. pylori-infected miR-30a knockout mouse mo del was significantly decreased (Fig.   7C). [score:3]
miR-30a is a newly found small molecular that affects the H. pylori -induced gastric cancer, and its lower expression in H. pylori gastritis and gastric cancer showed its potential as a clinical diagnostic. [score:3]
In vivo, the miR-30a precursor produces two different short miRNAs, accompanied by two different targets and pathways. [score:3]
Further experiments showed the important effect of miR-30a-5p on β-catenin associated LEF/TCF promoter activity and downstream target genes transcription such as Cyclin D1, MMP7, CD44 and c-Myc. [score:3]
Many reports have shown that, miR-30a had low expression levels in breast cancer [30], bone tumors [31], non-small cell lung cancer [32], liver cancer [33] and other malignant tumors. [score:3]
Inhibitory effect of miR-30a-3p on the growth and migration of H. pylori-infected gastric cancer cells. [score:3]
In preliminary experiments, we demonstrated that, after H. pylori infection in MKN45 cells for 12 h and 24 h, miR-30a-5p showed significantly decreased expression (Fig.   2A). [score:3]
The pmirGLO-BCL9-3′UTR plasmid (or pmirGLO-BCL9-3′UTR-mut, or pmirGLO) and miR-30a-5p mimic (or miR-67 mimic, or miR-30a-5p inhibitor) were co -transfected into HEK293T cells. [score:3]
Sequence alignment results indicated that there are complementary binding sites between miR-30a-5p and the 3′UTR region of B-cell CLL/lymphoma 9 (BCL9) tumor suppressor gene 14, 15. [score:3]
Not surprisingly, miR-30a knockout did not affect the growth and development of the mice, and had little effect on the H. pylori colonization rates of mice. [score:3]
Targeting the binding sites, we designed the dual luciferase reporter vector pmirGLO-BCL9-3′UTR, and the pmirGLO-BCL9-3′UTR-mut vector, which was mutated in the binding sites between miR-30a-5p and the 3′UTR of the BCL9 gene (Fig.   4C). [score:3]
Similarly, the miR-30a precursor had very pronounced inhibitory effect on the growth and migration of H. pylori-infected SGC-7901 cells (Fig.   4C,D). [score:3]
Taken together, our results indicated that, the function of miR-30a in the development of H. pylori -induced gastric cancer was associated closely with the regulation of COX-2, BCL9, VEGF and CD34. [score:3]
The gRNA targeting miR-30a and the Cas9 mRNA were in vitro transcribed respectively, mixed and diluted for microinjection. [score:3]
Figure 6Construction of miR-30a knockout mouse mo del using CRISPR/Cas9 technology. [score:2]
Our CRISPR/Cas9 -mediated miR-30a knockout mice and previously well-built gastric cancer mouse mo dels generated by H. pylori infection for long-time provide us the tools to elaborate the function of miR-30a in vivo. [score:2]
Previous studies have suggested an impact of H. pylori on the β-catenin signaling pathway [9], therefore, we next observed the regulatory effect of miR-30a-3p on the β-catenin involved signaling pathway. [score:2]
In addition, the biological function of miR-30a in the development of H. pylori-infected gastric cancer is also not fully understood. [score:2]
Therefore, in this study, we also showed the important roles of miR-30a in the development of H. pylori -induced gastric cancer. [score:2]
However, when the MKN45 cells were treated with the H. pylori and miR-30a-3p mimic simultaneously, the quantity of β-catenin protein in the nucleus significantly reduced, whereas the miR-30a-3p inhibitor had the opposite effect compared to the miR-30a-3p mimic (Fig.   3F). [score:2]
H. pylori-infected miR-30a knockout mice show increased incidence of precancerous lesions and adenocarcinoma manifestations. [score:2]
However, our current study does not provide the mechanism by which H. pylori downregulates miR-30a (miR-30a-3p and miR-30a-5p), which is required to be addressed in future investigation. [score:2]
The homozygous F2 generation mice with miR-30a knockout were obtained by two-two mating of above heterozygous mice. [score:2]
miR-30a can regulate the proliferation, apoptosis, invasion, migration and other biological function of different tumor cells [34]. [score:2]
Figure 2Regulatory effect of miR-30a-3p on the growth and migration of H. pylori-infected gastric cancer cells. [score:2]
9 were identified as miR-30a gene knockout homozygous mice (Fig.   6F), which could be used in the subsequent H. pylori infection experiments. [score:2]
13 produced more than 60 missing bases, indicating that miR-30a had achieved efficient knockout in mice (Fig.   6D). [score:2]
Comprehensive analysis demonstrated that, both of the control wild-type mice mo del and miR-30a knockout mouse mo del showed chronic gastritis, chronic atrophic gastritis, dysplasia and adenocarcinoma in the gastric mucosa, and H. pylori-infected miR-30a knockout mice showed increased incidence of precancerous lesions and adenocarcinoma manifestations compared to the H. pylori-infected wild-type mice. [score:2]
Figure 4Regulation of miR-30a-5p on the BCL9-TCF/LEF signaling pathway in H. pylori-infected gastric cancer cells. [score:2]
To knockout the miR-30a gene in vivo, two primers were designed and synthesized, wherein the first primer comprised the T7 promoter sequence for in vitro transcription, the miR-30a target-specific sequence, and a partial sequence for the gRNA (guilding RNA) backbone. [score:2]
These results implied that, miR-30a knockout had little effect on the H. pylori colonization rate of mice (Fig.   7A, Table  1). [score:2]
For pmirGLO-BCL9-3′UTR, compared with the miR-67 mimic group, the miR-30a-5p mimic group showed decreased luciferase activity, whereas the miR-30a-5p inhibitor group showed significantly increased luciferase activity. [score:2]
Figure 3Regulation of miR-30a-3p on the COX-2 and β-catenin signaling pathway in H. pylori-infected gastric cancer cells. [score:2]
Production of H. pylori infected miR-30a knockout mouse mo del. [score:2]
However, H. pylori-infected miR-30a knockout mice showed increased incidence of chronic gastritis, chronic atrophic gastritis, atypical hyperplasia, and other precancerous lesions and adenocarcinoma manifestations in the antral or gastric mucosa of mice. [score:2]
Regulatory effect of miR-30a-5p on the BCL9-TCF/LEF signaling pathway in H. pylori-infected gastric cancer cells. [score:2]
Production of H. pylori infected miR-30a knockout mouse mo delThe H. pylori colonies were scraped and adjusted the concentration to 1 × 10 [9] CFU/ml. [score:2]
PCR were performed to identify the success ratio and efficiency of miR-30a knockout. [score:2]
Thus, we directly chemically synthesized the double-stranded miR-30a precursor for experimental verification (Fig.   5A). [score:2]
Using CRISPR/Cas9 technology, we successfully achieved the production of miR-30a knockout homozygous mice. [score:2]
More than 15 of 20 mice in the miR-30a knockout mouse mo del showed the pathological phenomena described above, but with more instances of focus and more serious pathological degree. [score:2]
Construction of miR-30a knockout mouse mo del using CRISPR/Cas9 technology. [score:2]
It is well known that the miR-30a precursor is presented in vivo in the form of complementary stem-loop structure including miR-30a-3p and miR-30a-5p, which can be processed to generate two separate miRNAs and play their respective biological function. [score:1]
Accordingly, we tested the effect of miR-30a-5p on the promoter activity of TCF/LEF. [score:1]
miR-30a-3p and miR-30a-5p exhibit a complementary stem-loop structure in the presence of the miR-30a precursor. [score:1]
Twelve miR-30a heterozygous mice were screened out by PCR amplification from F1 generation mice (Fig.   6E). [score:1]
Although there are several reports stating the very low frequency of gastric cancer progression in C57BL/6 mice 38– 40, our results demonstrated that the percentage of adenocarcinoma was 5% (1/20) to 15% (3/20), and miR-30a KO increased the percentage of adenocarcinoma to more than 20% (4/20). [score:1]
These results showed that, miR-30a-5p can significantly reduce the promoter activity of TCF/LEF. [score:1]
Figure  1D showed a diagrammatic sketch of the specific binding between miR-30a-3p and the COX-2 3′UTR. [score:1]
Bioinformatics analysis has shown that miR-30a-3p is just one strand of a double-stranded miR-30a precursor with a stem-loop structure, and our next analysis focused on the role that its complementary strand miR-30a-5p plays in H. pylori-infected gastric cancer cells. [score:1]
Since miR-30a has very important regulatory effect on the growth and migration of H. pylori-infected gastric cancer cells, we constructed the miR-30a knockout mouse mo del to further investigate the function of miR-30a in vivo. [score:1]
Inhibitory effect of miR-30a-3p on the growth and migration of H. pylori-infected gastric cancer cellsConsidering the importance of miR-30a-3p, we performed further investigation in H. pylori-infected MKN45 cells. [score:1]
miR-30a is located on human chromosome 6q13, and is an important member of the miR-30 family. [score:1]
After 72 weeks, several of the 20 WT/ H. pylori mice or the 20 miR-30a [KO]/ H. pylori mice died of natural causes. [score:1]
After 10 weeks, 25 weeks and 45 weeks, several of the 20 WT/ H. pylori mice or the 20 miR-30a [KO]/ H. pylori mice died of natural causes. [score:1]
According to the compared results, F0 generation mice with miR-30a knockout efficiently were screened out. [score:1]
In addition, the IHC staining and real-time PCR results of COX-2, BCL9, VEGF, CD34, miR-30a-5p and miR-30a-3p in human tissue samples from patients with H. pylori gastritis, H. pylori-related gastric cancer and healthy controls were also in agreement with those findings in vitro and in vivo. [score:1]
Additionally, the nuclear quantities of β-catenin protein significantly increased in the H. pylori-infected miR-30a knockout mouse mo del compared with the H. pylori-infected wild-type mouse mo del (Fig.   7G). [score:1]
Moreover, compared with the control wild-type mice mo del, 72 weeks after H. pylori infection, the miR-30a knockout mouse mo del displayed more chronic atrophic gastritis and dysplasia in the antral mucosa, and increased shrinking, dysplasia, and adenocarcinoma in the gastric mucosa (Fig.   7B, Table  2). [score:1]
[1 to 20 of 109 sentences]
2
[+] score: 339
Furthermore, we found that over -expression of miR-30a, which is frequently down-regulated in CRC, suppresses proliferation and promotes apoptosis of CRC cells through down -regulating the expression of CD73 in vitro. [score:11]
Zhang et al. [12] reported that miR-30a could suppress the growth of colon cancer cell by inhibiting the expression of insulin receptor substrate 2. However, the specific function of miR-30a in CRC is still largely unknown because of the lack of information on the target genes. [score:9]
The proliferation ability of CRC cells was suppressed and the apoptosis of cells was promoted when miR-30a is over-regulated, however, the biological effects would be inverse since the miR-30a is down-regulated. [score:7]
We revealed that over -expression of miR-30a could inhibit proliferation and promote apoptosis of CRC cell both in vitro and in vivo, whereas down -expression of miR-30a showed reverse outcomes. [score:7]
c CCK-8 assays of the cells In the present study, our data provide evidence that exogenously expressing miR-30a can significantly down-regulate the expression of CD73 mRNA and protein in CRC cells. [score:7]
Furthermore, using xenograft tumor assays, we showed that down -expression of miR-30a not only suppressed the expression of CD73, but also significantly promoted the growth of xenograft tumor. [score:6]
Recently, several studies indicated that miR-30a is down-regulated in multiple cancers [10– 13] and that down -expression of miR-30a is correlated with a worse prognosis [13]. [score:6]
The proliferation suppression of the CRC cells mediated by miR-30a could be rescued after up -regulating the expression of CD73. [score:6]
Over -expression of CD73 can reverse the results of miR-30a up-regulation to enhance the proliferation of CRC cells. [score:6]
As shown in Fig. 1a, over -expression of miR-30a could significantly inhibit the proliferation ability of SW480 and DLD1 cells in CCK-8 assays, while down -expression of miR-30a displayed an opposite effect. [score:6]
CD73 is thought to be a target binding gene of miR-30a because miR-30a can bind directly to the 3′-UTR of CD73 mRNA, subsequently reducing its expression. [score:6]
Xenograft tumor assays showed that it could significantly promote the growth of CRC when down-regulated the expression of miR-30a in vivo. [score:5]
Therefore, miR-30a may participate in the occurrence and development of CRC by regulating the expression of CD73. [score:5]
As these results shown, re -expression of CD73 can reverse the effect of miR-30a over -expression. [score:5]
Furthermore, we found that over -expression of miR-30a caused a G1 arrest and down -expression of miR-30a caused a G2 arrest by cell cycle analysis (Fig. 1c). [score:5]
Fig. 4Over -expression of CD73-ORF rescues the ability of proliferation of the miR-30a over -expression CRC cells. [score:5]
Exogenously expressing miR-30a could significantly decrease the expression of CD73 mRNA and protein in CRC cells. [score:5]
At the mRNA level, tumor tissues showed lower expression levels of miR-30a and higher expression levels of CD73 than the corresponding adjacent control tissues, indicating a potential correlation between miR-30a and CD73 in CRC (Fig. 3a and b). [score:5]
Over -expression of miR-30a blocked G1/S transition, while down -expression of miR-30a accelerated G2/M transition of CRC cells. [score:5]
Ouzounova et al. [22] showed that the expression of miR-30a was reduced in breast cancer via comprehensively analyzing the miR-30 family targets. [score:5]
In this study, we hypothesized that miR-30a inhibits proliferation and accelerates apoptosis in CRC via suppression of CD73. [score:5]
We think this result may because the basal expression of miR-30a is already very high in SW480 cells, and then over -expression of the gene may have little influence on its function. [score:5]
On the other hand, reverse results were confirmed by inhibiting the expression of miR-30a. [score:5]
As shown in Fig. 4c, The CCK-8 assays indicated that ectopically expressing CD73 significantly promoted the proliferation of miR-30a over -expression SW480 cells. [score:4]
Moreover, miR-30a may play a critical role in the occurrence and progression of CRC by regulating the expression of CD73. [score:4]
In TUNEL assays (Fig. 1b), over -expression of miR-30a showed that it can significantly accelerate the apoptosis of CRC cells, and down -expression of miR-30a showed inverse results. [score:4]
Firstly, we injected different miR-30a expression (over, down and non-regulated control) SW480 cells into mice by subcutaneous injections. [score:4]
Using lentivirus transfection to regulate the miR-30a expression, we showed that miR-30a and CD73 may have an important influence on both proliferation and apoptosis of CRC cells. [score:4]
Fig. 2CD73 was a direct target of miR-30a. [score:4]
Furthermore, the results of qRT-PCR and western blot analysis suggested that miR-30a has a negative effect in regulating the expression levels of CD73 mRNA and protein (Fig. 2c and d). [score:4]
The result showed that the mean weights of xenograft tumors between miR-30a down -expression and non-regulated control groups was significantly different. [score:4]
Our results firstly showed that miR-30a is down-regulated in CRC. [score:4]
Furthermore, we proved that CD73 may serve as a direct and functional target of miR-30a. [score:4]
In addition, our results indicated that miR-30a down-regulated the endogenous CD73 in CRC tissues as well. [score:4]
There were significantly differences in the mean weights of xenograft tumors between miR-30a down -expression and non-regulated control groups (Fig. 1d). [score:4]
CD73 is a direct target of miR-30a. [score:4]
In our present investigation, we found that miR-30a can suppress cell proliferation as well as tumor growth of CRC by regulating the expression of CD73. [score:4]
As shown by these results, CD73 is a direct target gene of miR-30a in CRC cells. [score:4]
d Densitometry analysis of western blot data normalized with GAPDH in all specimens (** P < 0.01) To further determine whether miR-30a regulates the proliferation and survival of CRC cells through CD73, we transfected miR-30a over -expression SW480 cells with CD73-ORF fragment (without 3′-UTR). [score:4]
While there were not significantly different between miR-30a over -expression and non-regulated control groups. [score:4]
The TUNEL assays were calculating the numbers of apoptotic cells in one field, and we chose eight fields to calculate for each sample In order to determine the mechanism of miR-30a in regulating the proliferation and apoptosis of CRC cells, we next used several target prediction programs, TargetScan, miRWalk and PicTar, to explore the potential target gene of miR-30a. [score:3]
d CD73 mRNA expression levels in CRC cells infected with miR-30a precursor or miR-30a sponge were determined by qRT-PCR. [score:3]
c CD73 protein expression levels in CRC cells infected with miR-30a precursor or miR-30a sponge were determined by western blotting. [score:3]
a CCK-8 assays of SW480 (left) and DLD1 (right) cells with regulated expression of miR-30a. [score:3]
CD73 is involved in miR-30a for inhibiting the proliferation of CRC cells. [score:3]
c Over -expression of miR-30a in CRC cells blocked G1/S transition. [score:3]
B. The miR-30a target sequence from CD73 was cloned into the 3′-UTR of a luciferase reporter gene. [score:3]
Our results indicated that CD73 is a target gene of miR-30a. [score:3]
These results demonstrate that miR-30a can suppress the proliferation and survival of CRC cells in vitro. [score:3]
All the above results demonstrated that miR-30a is critical in disease progression of CRC. [score:3]
Secondly, by using target prediction programs, we predicted that the 3′-UTR of CD73 mRNA includes two complementary binding sites for the seed region of miR-30a. [score:3]
A. Wild-type (WT) and mutant (Mut) of putative miR-30a targeting sequences in CD73 mRNA. [score:3]
It has been proven that miR-30a is one of important tumor-suppressor factors in various human cancers. [score:3]
Boufraqech et al. [10] demonstrated that miR-30a decreases the expression level of lysyl oxidase in human anaplastic thyroid cancer. [score:3]
Fig. 3The inverse correlation between the expression levels of miR-30a and CD73 in 27 pairs of clinical specimens. [score:3]
CD73 is involved in miR-30a inhibited proliferation and survival of CRC cells. [score:3]
We also identified that there is a negative correlation between the expression of miR-30a and CD73 in human CRC tissues. [score:3]
The quantitative real-time PCR and western blot analysis were used to detect the expressions of miR-30a and CD73 in CRC cell lines and clinical tissues. [score:3]
As previously described, the cells that stably express miR-30a or miR-30a sponge (sequence: 5′-CTTCCAGTCACGATGTTTACACCGGCTTCCAGTCACGATGTTTACACCGGCTTCCAGTCACGATGTTTACACCGGCTTCCAGTCACGATGTTTACACCGGCTTCCAGTCACGATGTTTACACCGGCTTCCAGTCACGATGTTTACA-3′) were obtained though retroviral infection using the HEK293T cells [20]. [score:3]
a Western blot analyses of CD73 protein expression in SW480-vector cells, SW480-miR-30a cells, SW480-miR-30a cells transfected with control vector or CD73-ORF vector from three independent experiments. [score:3]
qRT-PCR analyses of miR-30a (a) and CD73 (b) expression in CRC and corresponding adjacent control tissues. [score:3]
Therefore, miR-30a can be regarded as potential target for CRC therapy. [score:3]
of analysis revealed that the 3′-UTR of CD73 mRNA has two complementary sites for miR-30a targeted binding (Additional file 2: Figure S2). [score:3]
a Predicted miR-30a target sequences in the 3′-UTR of CD73 and its mutant containing altered nucleotides in the 3′-UTR. [score:3]
The different expression levels of miR-30a and CD73 were firstly screened in 8 strain cell lines of CRC (SW480, HCT116, LoVo, CaCo2, HT29, R KO, DLD1 and HCT8) by qRT-PCR and western blot analysis (Additional file 1: Figure S1). [score:3]
Several oncogenes have been identified as miR-30a targeted genes [10, 12, 13]. [score:3]
The expression of miR-30a was significantly reduced in tumor cells and tissues of CRC. [score:3]
Our data first showed that miR-30a may directly bind to the 3′-UTR of CD73 to regulate the proliferation of CRC cells both in vitro and in vivo. [score:3]
A. miR-30a expression assessed by Real-time PCR in eight CRC cell lines. [score:3]
The down -expression of miR-30a cells were activated in G2 phase of the cell cycle. [score:3]
We identified that CD73 was one of the direct target genes of miR-30a in CRC cells by luciferase reporter assay. [score:3]
b The miR-30a target sequence from CD73 was cloned into the 3′-UTR of a luciferase reporter gene. [score:3]
To further investigate whether miR-30a shows the same effect in vivo, we injected SW480 cells with different expression of miR-30a (over, down and non-regulated control) into nude mice by subcutaneous injections. [score:2]
Moreover, our results of cell cycle assays showed that the expression of miR-30a has a close association with the cell cycle of CRC cells. [score:2]
Ten million of tumor cells per mouse, including SW480-non-regulated control (NC), SW480-miR-30a, and SW480-miR-30a sponge were injected into the dorsal skin of 4–6 week-old BALB/c nu/nu mice (purchased from Experimental Animal Center of Sun Yat-sen University, six mice per group). [score:2]
MiR-30a and CD73 expression levels in CRC tissue. [score:2]
Nevertheless, the definite effect of miR-30a in regulation of CD73-adenosinergic pathway in CRC is unclear. [score:2]
c CCK-8 assays of the cells The different expression levels of miR-30a and CD73 were firstly screened in 8 strain cell lines of CRC (SW480, HCT116, LoVo, CaCo2, HT29, R KO, DLD1 and HCT8) by qRT-PCR and western blot analysis (Additional file 1: Figure S1). [score:2]
On the whole, the above results indicate that miR-30a plays an important role in regulating the proliferation and apoptosis of CRC cells both in vitro and in vivo. [score:2]
b Detection of apoptosis by TUNEL assays in different miR-30a expression CRC cells. [score:2]
To investigate whether miR-30a can affect CRC cell proliferation and survival, we stably over and down expressed miR-30a in SW480 and DLD1 cells. [score:1]
The results showed potential inverse correlations between the levels of miR-30a and CD73. [score:1]
To verify this prediction, human CD73 3′-UTR fragment with the wild-type or mutant miR-30a -binding site was inserted to the downstream of the open reading frame of luciferase. [score:1]
The pLV-puro lentivirus vector was chosen as a genetic vector, and the miR-30a precursor was cloned into its restriction enzyme cutting site. [score:1]
Among the numerous microRNAs, microRNA-30a (miR-30a) is thought to play an important role in the processes of various human tumors. [score:1]
In this study, we aimed to explore the role of miR-30a in the process of colorectal cancer (CRC). [score:1]
The functions of miR-30a and CD73 in the complex signal path network of cell proliferation and apoptosis should be further explored. [score:1]
The level of miR-30a is significantly decreased in multiple human tumors [21, 22]. [score:1]
MiR-30a sponge which contains 6 tandem “bulged” miR-30a binding motifs was designed and cloned into the pLV-puro vector for the following experiments. [score:1]
We designed different experiments in order to confirm the specific role of CD73 companied with miR-30a in mediating the functions associated with cell proliferation and tumor growth of CRC. [score:1]
The nude mouse tumorigenicity experiment was used to clarify the biological role of miR-30a in vivo. [score:1]
Although there are several studies suggested that miR-30a and CD73 are respectively connected with CRC, no experiment is sufficiently definite the relationship between miR-30a and CD73 in CRC. [score:1]
MiR-30a regulates cell proliferation and apoptosis in CRC cells. [score:1]
As shown in Fig. 2b, the relative activity of luciferase in the reporter containing a wild-type CD73 3′-UTR was markedly decreased upon miR-30a co-transfection, whereas the reporter containing the mutant binding site was unaffected in the luciferase activity. [score:1]
d SW480-NC, SW480-miR-30a, and SW480-miR30a sponge cells were injected into the flanks of nude mice (n = 6). [score:1]
In conclusion, the data of this work provide new viewpoints about the role of miR-30a in human CRC. [score:1]
This finding was confirmed by measuring the expression level of miR-30a in 27 clinical CRC specimens and their corresponding adjacent normal tissues using the method of qRT-PCR. [score:1]
Studies based on large-scale samples are warranted to investigate the relevance of miR-30a expression levels to the prognosis and clinicopathological features of CRC patients. [score:1]
However, we only verified one of the two sites, position 1442–1449 of CD73–3’UTR, in which miR-30a can bind to the 3′-UTR of CD73 mRNA. [score:1]
In the present study, we revealed that miR-30a is also significantly reduced in CRC cell lines. [score:1]
MiR-30a plays an important role on regulating the cell proliferation and apoptosis, thus affecting the growth of the tumor in CRC. [score:1]
CD73 sequence analysis indicated that putative miR-30a -binding sites were at 238–335 and 1442–1449 sequences of the CD73 3′-UTR. [score:1]
[1 to 20 of 102 sentences]
3
[+] score: 334
This observation also raises the intriguing possibility that miR-30 mediated regulation of the miRNA pathway is a mechanism not specific to muscle cells, but rather a mechanism in all cells expressing miR-30 to antagonize the expression of all miRNA-regulated targets. [score:9]
To identify direct miR-30 family targets, we first utilized TargetScan 6.2 [20] to identify predicted targets. [score:8]
To determine whether modulating miR-30 family miRNA levels affects miRNA repression, we tested the ability of muscle-specific miR-206 to repress a known target, cyclin D1 (Ccnd1)[31], during miR-30 family over -expression or inhibition. [score:7]
Putative direct miR-30 family targets include epigenetic, transcriptional, and post-transcriptional regulators of gene expression. [score:7]
If miR-30 directly regulates the expression of these candidates at the mRNA level, one could expect de-repression in mdx4cv muscles where miR-30 family expression is reduced. [score:7]
Transcriptional, post-transcriptional and epigenetic regulation of gene expression are the most highly enriched GO terms in the set of predicted miR-30 family targets. [score:6]
While no change was observed for Nfyb and Ppargc1a, we found that Runx1, Smarcd2, and Tnrc6a were increased in their expression in the gastrocnemius muscles and that Snai2 trended towards an increase (P = 0.07) (Fig. 6C), indicating that these may be direct miR-30 targets. [score:6]
As expected, over -expression of miR-30a/b/c de-repressed Ccnd1 luciferase reporter activity (Fig. 7A), and miR-30 family inhibition enhanced Ccnd1 repression by miR-206 (Fig. 7B), showing that miR-30 family miRNAs can negatively regulate the activity of other miRNAs. [score:6]
miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animalsIn order to identify miRNAs that are dysregulated during muscle pathogenesis, we hypothesized that, as dystrophic muscle is undergoing constant cycles of degeneration/regeneration, miRNAs differentially expressed between dystrophic and healthy muscle may represent novel biomarkers of muscle homeostasis. [score:6]
Given these dynamic expression changes during adult myogenesis in vitro, changes in miR-30 family expression could also be expected during developmental myogenesis. [score:6]
Note miR-206 and miR-21 (red, overexpressed in mdx4cv) and miR-30 family (green, down-regulated in mdx4cv). [score:6]
When sorted for P-value, the functionally annotated biological processes that are most enriched in the list of predicted miR-30 family targets include the regulation of transcription, gene expression, and macromolecule synthesis (Fig. 6A). [score:6]
To narrow the candidate target list as well as gain insight into the biological processes and pathways that may be regulated by the miR-30 family, we took the 1133 predicted targets and performed gene ontology (GO) analysis using the Database for Annotation, Visualization and Integrated Discovery (DAVID) [21]. [score:6]
Again we found high levels of miR-30a/b/c expression in the fully mature, adult tissue and low levels (∼10 fold lower on average for miR-30a/b/c) in the developing muscle (Fig. 4B), indicating that increased miR-30a/b/c expression is a feature of both adult and developmental myogenesis. [score:6]
If miR-30 family miRNAs control miRNA repression by targeting Tnrc6a, we could expect that high levels of miR-30 would repress Tnrc6a levels resulting in global de-repression of miRNA targets and increased protein synthesis. [score:5]
Given our observed decrease in miR-30 family expression in a pathological setting of constant degeneration/regeneration (mdx4cv), we wanted to examine miR-30 family expression in other mo dels of skeletal muscle pathology, including regeneration after acute injury and muscle disuse atrophy. [score:5]
Numerous functions have been described for the miR-30 family, including regulation of fibrosis, apoptosis, and hypertrophy in cardiomyocytes [32– 34], regulation of pronephros development in the kidneys [35], as well as the regulation of the epithelial-to-mesenchymal transition in hepatocytes [36]. [score:5]
Additionally, miR-30 family miRNAs provide negative feedback on the miRNA pathway by targeting TNRC6A, leading to derepressed miRNA targets and increased protein synthesis. [score:5]
While smoothened is not predicted to be a conserved miR-30 family target in mice, the possibility exits that miR-30 family miRNAs play a critical role in the regulation of embryonic muscle development and fiber type specification. [score:5]
While others have identified Tnrc6a as a miR-30 family target [46], we are the first to show that miR-30 expression modulates the activity of other miRNAs and levels of protein synthesis. [score:5]
’ Therefore, by repressing the set of miR-30 targets present in the given cellular milieu while at the same time reducing the extent of other miRNA -mediated repression, miR-30 family can repress a current gene expression pattern and pave the way for a change in cellular state (Fig. 8). [score:5]
In human DMD patient biopsies, we did not observe a significant difference in miR-30a/b/c levels between healthy and diseased samples (Fig. 1D), but we did observe an increase in the variability of miR-30a/b/c expression, in agreement with the clinical heterogeneity of DMD patient biopsies [17]. [score:5]
Following withdrawal of serum from the medium, we observed increases in miR-30a-5p (∼1.5 fold), miR-30b (∼2 fold) and miR-30c (∼2 fold) expression as differentiation progressed (Fig. 4A), indicating that the miR-30 family is expressed in myoblasts. [score:5]
To test if the reduction in miR-30 family miRNA expression found in dystrophic, injured and atrophic muscle correlates with expression changes in myoblasts, we measured miR-30a/b/c expression during C [2]C [12] myoblast differentiation in vitro. [score:5]
0118229.g006 Fig 6 (A) GO analysis of predicted miR-30 targets (TargetScan 6.2) is shown sorted by P-value for enriched biological processes. [score:5]
Interestingly, we found that inhibition of Tnrc6a expression by miR-30 family miRNAs reduces the activity of muscle-enriched miR-206, indicating that the miR-30 family constitutes a negative feedback mechanism on the miRNA pathway. [score:5]
Tnrc6a, Smarcd2, and Snai2 are regulated by miR-30a/b/cTo validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture. [score:4]
0118229.g008 Fig 8 To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis. [score:4]
0118229.g002 Fig 2qRT-PCR analysis of RNA isolated from whole (A) gastrocnemius, (B) tibialis anterior (TA), and soleus (C) muscles of 3-month old WT and mdx4cv animals validates down-regulation of miR-30a-5p, miR-30b and miR-30c (miR-30a/b/c) by. [score:4]
After finding that the Tnrc6a 3’-UTR was repressed ∼60% by miR-30a/b/c overexpression, we wondered if Tnrc6a repression may play a key role in regulating global miRNA -mediated repression. [score:4]
analysis of RNA isolated from whole (A) gastrocnemius, (B) tibialis anterior (TA), and soleus (C) muscles of 3-month old WT and mdx4cv animals validates down-regulation of miR-30a-5p, miR-30b and miR-30c (miR-30a/b/c) by. [score:4]
For miRNA knockdown/overexpression, 40–50% confluent cells were transfected with indicated concentrations of antimiRs (miRagen Therapeutics) or pre-miRs (Ambion pre-miR-control [AM17110] or an equimolar mix of pre-miR-30a-5p [PM11062], pre-miR-30b [PM10986] and pre-miR-30c [PM11060]) using Lipofectamine 2000 transfection reagent (Life Technologies) according to the manufacturer’s instructions. [score:4]
Indeed, after normalizing to protein content, we found a significant ∼2-fold increase (P ≤ 0.05) in [3]H-tyrosine incorporation in miR-30b/d over -expressing myotubes when compared to controls (Fig. 7C), indicating that miR-30 family miRNAs promote high levels of protein synthesis, likely through de-repression of miRNA targets. [score:4]
To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis. [score:4]
In addition, we identify the chromatin remo deling component Smarcd2, the transcriptional repressor Snai2 and the miRNA pathway component Tnrc6a as direct miR-30 targets. [score:4]
The miR-30 family miRNAs belong to the same seed family and thus share identical seed sequences (S1 Fig. ) and likely regulate an overlapping set of targets. [score:4]
Through in vitro experiments and bioinformatic analysis, we have proposed a novel mechanism whereby miR-30 promotes the differentiation of myoblasts by both restricting the expression of Smarcd2 and Snai2 (both negative regulators of the myogenic gene program), as well as by antagonizing the miRNA pathway through repression of Tnrc6a. [score:4]
In zebrafish, Ketley et al. recently showed that the miR-30 family promotes a fast muscle phenotype during embryonic muscle development and that inhibition of the miR-30 family in zebrafish embryos increased the percentage of slow fibers [37]. [score:4]
miR-30a/b/c expression increases during myogenesis. [score:3]
After injury, miR-30 family expression is reduced and reaches a minimum on day 3 post-injury (∼4–5 fold reduction in miR-30a/b/c) (Fig. 3A) corresponding to a time point at which the muscle is largely degenerating (S3 Fig. ), indicating a correlation between low miR-30a/b/c levels and muscle degeneration. [score:3]
Human miR-30 family expression. [score:3]
miR-30 regulates miRNA -mediated post-transcriptional regulation and protein synthesis. [score:3]
Here we show that the expression of miR-30 family miRNAs is dynamic in skeletal muscle pathologies, with low miR-30 being correlated with degeneration and muscle mass loss, and high miR-30 associated with myogenesis and protein synthesis. [score:3]
Identifying the cell-type specific expression pattern of the miR-30 family in WT and mdx4cv animals will be necessary to ascertain the pathogenic role of the miR-30 family. [score:3]
miR-30a/b/c expression decreases during acute injury and muscle disuse atrophy. [score:3]
Notably, little has been published about the expression and role of the miR-30 family in skeletal muscle. [score:3]
miR-30 family target identification and validation. [score:3]
By deep sequencing small RNAs from wild-type C57Bl/6 (WT) and dystrophic mdx4cv gastrocnemius muscles, we found the miR-30 family miRNAs to be coordinately down-regulated when compared to WT. [score:3]
Expression displayed as miR-30a/b/c level in unloaded calf complex relative to contralateral control for indicated time point. [score:3]
miR-30 family miRNAs promote a myogenic program in vitro To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts. [score:3]
0118229.g007 Fig 7 (A) Luciferase reporter activity of a Ccnd1 3’-UTR reporter during miR-206 and miR-30a/b/c overexpression. [score:3]
Our results indicate that expression of the miR-30 family miRNAs is perturbed during alterations in muscle homeostasis in vivo, and that the miR-30 family miRNAs promote myoblast terminal differentiation and restrict proliferation in vitro. [score:3]
Additionally, we found significant (P ≤ 0.05) ∼50% reductions in luciferase activity for Smarcd2 and Snai2, known negative regulators of the myogenic gene program, indicating that miR-30a/b/c may promote myogenesis through regulation of these factors. [score:3]
To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts. [score:3]
While these findings are in agreement with our observations of miR-30 family effects on proliferation and differentiation in vitro, we were unable to assess the expression pattern and function of miR-30 family members in non-muscle cell types in vivo. [score:3]
Another outcome of this hypothesis would be a general increase in protein synthesis in the presence of high miR-30 family miRNA levels, mediated by the de-repression of miRNA targets. [score:3]
We thus wondered whether ectopic miR-30 family miRNA expression could decrease the proportion of proliferating cells. [score:3]
In comparison to a scrambled pre-miR control at equivalent concentrations, EdU incorporation was reduced dose -dependently by 10% and 15% (P ≤ 0.05) in 10nM and 50nM transfected cells, respectively (Fig. 5C), indicating that high miR-30 family expression reduces the proportion of proliferating myoblasts in vitro. [score:3]
miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animals. [score:3]
We also show that miR-30 family expression is reduced in acute pathological conditions including BaCl [2] -induced injury and disuse atrophy. [score:3]
To test if the inverse is true, we utilized chemically modified, antisense oligonucleotides to inhibit miR-30 family function. [score:3]
In agreement with this argument, the validated miR-30 targets include the epigenetic SWI/SNF component Smarcd2, the transcription factor Snai2, and the post-transcriptional miRNA pathway component Tnrc6a. [score:3]
To validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture. [score:3]
miR-30 family expression displayed relative to 15.5 dpc miR-30a-5p levels. [score:3]
validation of reduced miR-30 family miRNA expression. [score:3]
Given that fast twitch fiber-types are preferentially affected in DMD [38], it is tempting to speculate that the decrease in miR-30 family expression in mdx4cv muscle is a compensatory mechanism to promote an increase in slow-twitch, fatigue resistant fiber types. [score:3]
0118229.g004 Fig 4. (A) Relative miR-30a/b/c expression levels measured using indicate increased expression during C [2]C [12] differentiation. [score:3]
To further sort these candidates, we measured the expression levels of their mRNAs in mdx4cv skeletal muscles by, including Galnt7 as a positive control miR-30 target [28]. [score:3]
Interestingly, we also found that the normalized read counts for the entire miR-30 family were strikingly reduced in mdx4cv animals (Fig. 1B), and that the miR-30 family is the 5th most highly expressed miRNA family in skeletal muscle (Fig. 1C). [score:3]
Given the high abundance in skeletal muscle and differential expression, we decided to further investigate the expression and function of miR-30 family miRNAs in mammalian skeletal muscle. [score:3]
In conclusion, we present a miRNA-seq dataset identifying a reduction in miR-30 family miRNA expression in dystrophic mdx4cv skeletal muscles. [score:3]
In another recent publication, Soleimani et al. proposed that miR-30 -mediated regulation of the transcriptional repressor SNAI1 facilitates entry into the myogenic gene program and promotes differentiation of primary mouse myoblasts [26]. [score:2]
Tnrc6a, Smarcd2, and Snai2 are regulated by miR-30a/b/c. [score:2]
miR-30 regulates miRNA -mediated repression and protein synthesis. [score:2]
Many of the studies published on various miR-30 family functions indeed report the regulation of transcription factors [26, 33, 35, 39, 40], indicating that the generalized function of miR-30 may be to control the switch from one cellular state (i. e. proliferating, differentiating, quiescent, etc. ) [score:2]
To test this, we isolated limb buds from WT 15.5 days post-coitum embryos and compared the levels of miR-30a/b/c expression to those in the adult gastrocnemius. [score:2]
While the miR-30 family includes 5 mature miRNAs (miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e [NCBI: NR_029533, NR_029534, NR_029716, NR_029718, NR_029602]), for this study we have focused on miR-30a-5p, miR-30b and miR-30c (“miR-30a/b/c”) due to sequence similarity of miR-30a-5p, miR-30d and miR-30e (differing by only one nucleotide each) (S1 Fig. ). [score:1]
Twenty-four hours after transfection, quantification of myogenin -positive (MYOG+) nuclei indicated a striking 65% increase (P = 5e-5)(Fig. 5A), indicating that the miR-30 family promotes terminal differentiation of myoblasts in vitro. [score:1]
In order to confirm these results, we performed on a larger (n = 4) cohort of animals, and similarly found a marked reduction in the levels of miR-30a/b/c in the dystrophic gastrocnemius, soleus, and tibialis anterior (TA) muscles (Fig. 2). [score:1]
To this end we transfected proliferating C [2]C [12] with a representative synthetic miR-30 family member, miR-30a-5p, then performed 5-ethynyl-2’-deoxyuridine (EdU) proliferation analysis. [score:1]
As indicated by the percentage of MyHC+ area, 24 hours following transfection antimiR-30 restricted the differentiation of C [2]C [12] myoblasts (Fig. 5B), again indicating that miR-30 family miRNAs promote myoblast differentiation. [score:1]
Thus, we transfected C [2]C [12] myoblasts with an equimolar mix of synthetic pre-miR-30a-5p, pre-miR-30b and pre-miR-30c at 10nM total concentration. [score:1]
miR-30 family miRNAs promote a myogenic program in vitro. [score:1]
miRNA-seq reveals reduced miR-30 family miRNAs in mdx4cv muscles. [score:1]
Accordingly, we first performed barium chloride injury in the gastrocnemius muscles of WT animals to test regeneration after injury in vivo and measured miR-30 family expression on 1, 3, 7 and 14 days post-injury (DPI) in comparison to uninjured contralateral controls. [score:1]
This reduction was least pronounced in the slow-twitch soleus muscle, where baseline miR-30 levels are lower than in the gastrocnemius and TA muscles (S2 Fig. ). [score:1]
miR-30a/b/c promote differentiation of myoblasts in vitro. [score:1]
Interestingly, we found the highest level of repression for Tnrc6a, with ∼50% and ∼60% reductions in activity for 0.5nM and 5nM pre-miR-30a/b/c, respectively (Fig. 6D). [score:1]
24 hours after electroporation of pre-miR-30a-5p and scrambled controls at indicated concentrations, C [2]C [12] cells were pulsed with EdU for 2 hours, then stained for EdU incorporation and DAPI. [score:1]
Abundance of miR-30a/b/c in WT skeletal muscle. [score:1]
0118229.g003 Fig 3 (A) of miR-30a/b/c from BaCl [2]-injured WT gastrocnemius muscles. [score:1]
After beginning hindlimb suspension miR-30a/b/c levels decreased after only 1 day (Fig. 3B) and remained decreased throughout the 14 day experiment. [score:1]
Sequence and organization of miR-30 family miRNAs. [score:1]
Mo del for miR-30 family mechanism of action. [score:1]
After reaching a minimum on day 3 post-injury (DPI), miR-30 levels begin to return towards uninjured levels on days 7 and 14. [score:1]
Addition of miR-30a/b/c relieves repression of the Ccnd1 3‘-UTR luciferase reporter by miR-206. [score:1]
48 hours following the induction of differentiation, myotubes were infected with empty adenovirus (control) or adenoviruses encoding the miR-30a hairpin and the miR-30b/d cluster (kind gift of Dr. [score:1]
S1 Fig (A) Alignment of miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e shows conserved positions in bold and positions differing from miR-30a-5p in red. [score:1]
Indicated concentrations of pre-miR-30a/b/c or pre-miR-control were transfected along with full-length 3’-UTR luciferase reporter constructs into C [2]C [12] cells. [score:1]
Twenty-four hours after transfection with increasing dosages of antimiR-30, we found that antimiR-30 dose -dependently reduced miR-30a/b/c compared to an antimiR directed against a non-mammalian miRNA (antimiR-control) (S4 Fig. ). [score:1]
miR-30a/b/c are decreased after acute injury and muscle disuse atrophy. [score:1]
[1 to 20 of 101 sentences]
4
[+] score: 328
miR-30a-5p suppresses GBC cell proliferation, migration and invasion in vivoGiven that miR-30a-5p overexpression inhibited tumour growth in our in vitro studies, we subsequently explored the effects of miR-30a-5p on tumour growth in vivo by IHC, the results of which showed that tumour growth and tumour weight were significantly decreased in the miR-30a-5p-overexpression group compared with the negative control group (Fig.   4a and Supplementary Figure  S1e) and that Ki-67 and PCNA expression levels in the miR-30a-5p-overexpression group were lower than those in the negative control group (Fig.   4b). [score:12]
Scale bar = 100 μm Given that miR-30a-5p overexpression inhibited tumour growth in our in vitro studies, we subsequently explored the effects of miR-30a-5p on tumour growth in vivo by IHC, the results of which showed that tumour growth and tumour weight were significantly decreased in the miR-30a-5p-overexpression group compared with the negative control group (Fig.   4a and Supplementary Figure  S1e) and that Ki-67 and PCNA expression levels in the miR-30a-5p-overexpression group were lower than those in the negative control group (Fig.   4b). [score:10]
We subsequently analysed the expression levels of several protein candidates involved in EMT by western blotting, the results of which showed that E-cadherin and vimentin protein expression levels were affected by the ectopic expression or knockdown of miR-30a-5p and that these effects were partially attenuated by the re-introduction or inhibition of E2F7, respectively (Fig.   6d). [score:10]
Moreover, we found that miR-30a-5p upregulation inhibited E2F7 expression in different GBC cell lines. [score:8]
Dual luciferase reporter assay showed that cells transfected with miR-30a-5p specifically inhibited E2F7-3′-UTR-WT luciferase reporter expression but not E2F7-3′-UTR-Mut reporter expression (Fig.   5c), and the western blotting and qRT-PCR results showed that miR-30a-5p repressed endogenous E2F7 mRNA and protein expression in GBC cells (Fig.   5d). [score:8]
Scale bar = 100 μm Western blotting and immunofluorescence assay showed that downregulation of miR-30a-5p significantly decreased the expression of E-cadherin and increased vimentin expression (Fig.   3c–d and Supplementary Figure  S2c-d). [score:7]
These results indicate that miR-30a-5p negatively regulates E2F7 expression by directly targeting its 3′-UTR region. [score:7]
To elucidate the molecular mechanisms by which miR-30a-5p suppresses proliferation and metastasis in GBC cells, we searched the TargetScan database to identify the potential target genes of miR-30a-5p. [score:7]
Scale bar = 100 μmWestern blotting and immunofluorescence assay showed that downregulation of miR-30a-5p significantly decreased the expression of E-cadherin and increased vimentin expression (Fig.   3c–d and Supplementary Figure  S2c-d). [score:7]
We found that the transcription factor E2F7 is a novel, direct target of miR-30a-5p in GBC and that an inverse correlation exists between miR-30a-5p and E2F7 expression mRNA levels in GBC tissues. [score:6]
As a group of tumour suppressors, the miR-30 family has been reported to be downregulated in many human cancers, including colorectal cancer [21], lung cancer 22, 23, thyroid cancer [24], renal cell carcinoma [25] and gastric cancer [26]. [score:6]
Although we lack the evidence that miR-30a-5p targets 3′-UTR of these genes, our present data indicate that miR-30a-5p downregulation may drive EMT in cancer cells, resulting in metastasis. [score:6]
Scale bar = 100 μm Downregulation of miR-30a-5p in representative GBC cell lines (GBC-SD and NOZ) by transfection with miR-30a-5p inhibitor promoted cell growth and colony formation. [score:6]
Our results demonstrated that E2F7, which is known to play an essential role in regulating cell cycle progression [35], is a novel target of miR-30a-5p and that miR-30a-5p exerts its tumour-suppressive effects in GBC cells at least in part by repressing E2F7. [score:6]
miR-30a-5p expression is significantly downregulated in GBC and is negatively correlated with patient survival. [score:6]
f The correlation between miR-30a-5p expression levels and E2F7 expression levels was determined by linear regression analysis (P = 0.0087, R = −0.5642; Pearson’s correlation coefficient). [score:5]
We subsequently performed Person correlation analysis, which showed that miR-30a-5p expression levels were significantly inversely correlated with E2F7 expression levels in GBC samples (R = −0.5642, P = 0.0087; Fig.   5f). [score:5]
b Venn diagram of potential miR-30a-5p targets, as predicted by the TargetScan database and gene microarray. [score:5]
Moreover, restoration of E2F7 expression significantly reversed the inhibitory effects of miR-30a-5p on cell migration and invasion (Fig.   6b, c and Supplementary Figure  S4c). [score:5]
In contrast, inhibiting E2F7 expression restored the effects of miR-30a-5p on GBC cell proliferation and colony-formation capacity (Fig.   6a and Supplementary Figure  S4a-b). [score:5]
miR-30a-5p expression is negatively correlated with E2F7 expression in patients with GBC. [score:5]
We found that miR-30a-5p expression was downregulated in GBC tissues compared with normal gallbladder tissues. [score:5]
a Cell proliferation ability was assessed in GBC-SD cells and NOZ cells infected with miR-30a-5p inhibitors or negative control miRNA inhibitors and miR-30a-5p mimics or negative control miRNA mimics. [score:5]
In addition, inhibiting E2F7 expression also abrogated the stimulatory effects of anti-miR-30a-5p on GBC cell migration and invasion (Fig.   6b, c and Supplementary Figure  S4c). [score:5]
miR-30a-5p overexpression suppresses tumour growth and metastasis in vivo. [score:5]
Boufraqech M miR30a inhibits LOX expression and anaplastic thyroid cancer progressionCancer Res. [score:5]
d Cell migration and invasion were assessed in GBC cells in which miR-30a-5p was inhibited or overexpressed. [score:5]
Consistent with these results, the IHC results showed that the expression levels of E-cadherin were increased, and the expression of vimentin and N-cadherin was decreased in the miR-30a-5p -treated group compared with the control group (Fig.   4e, f). [score:4]
However, to the best of our knowledge, little is known regarding the mechanisms regulating E2F7 expression and the relationship between E2F7 and miR-30a-5p in GBC have not previously been elucidated. [score:4]
In summary, our study has demonstrated for the first time that miR-30a-5p plays pivotal roles in GBC proliferation and metastasis in vitro and in vivo, probably by directly targeting E2F7. [score:4]
miR-30a-5p expression levels were compared between tumour tissues and paired non-tumour tissues using paired Student’s t tests, and the difference in the mean expression level between the two groups was assessed by independent Student’s t tests. [score:4]
E2F7 is a direct target of miR-30a-5p in GBC cells. [score:4]
2015.123 25996293 8. Wang XPRDM1 is directly targeted by miR-30a-5p and modulates the Wnt /β-catenin pathway in a Dkk1 -dependent manner during glioma growthCancer Lett. [score:4]
E2F7 is a direct target of miR-30a-5p. [score:4]
miR-30a-5p expression deregulation is correlated with poor survival. [score:4]
To determine the role of miR-30a-5p in GBC development, we analysed miR-30a-5p expression levels in five GBC cell lines (Supplementary Figure  S1a). [score:4]
Given real-time PCR results showing that E2F7 has a significant downregulation after miR-30a-5p overexpression, we finally focused on E2F7 for evaluation in subsequent experiments (Fig.   5b and Supplementary Figure  S3a). [score:4]
These findings support the idea that E2F7 plays an important role in the mechanisms underlying the tumour-suppressive functions of miR-30a-5p in GBC. [score:3]
Interestingly, in our study, we identified E2F7 as a tumour-promoting protein, as it can induce tumour cell proliferation, invasion and metastasis, and also has the ability to rescue tumour invasive behaviour inhibited by miR-30a-5p in GBC. [score:3]
miR-30a-5p levels were assessed by qRT-PCR, and the median value for all 42 cases was chosen as the cutoff point with which the cases were separated into high (n = 21) and low (n = 21) miR-30a-5p expression groups. [score:3]
All the clinical data suggest that miR-30a-5p may function as a tumour suppressor in the progression of GBC. [score:3]
The subjects with low miR-30a-5p expression had larger tumour size (P = 0.029) and higher rate of lymph node metastasis (P = 0.001) (Table  1). [score:3]
These findings supported the hypothesis that miR-30a-5p overexpression may block EMT in cancer metastasis. [score:3]
In contrast, the GBC-SD and SGC-996 cell lines, which possess the lowest metastatic potential of the cell lines analysed herein, expressed miR-30a-5p at higher levels than the other cell lines. [score:3]
miR-30a-5p inhibits GBC cell proliferation, migration and invasion in vitro. [score:3]
Remarkably, we found that the NOZ cell line, which possesses the highest metastatic potential of the five GBC cell lines analysed herein, expressed miR-30a-5p at lower levels than the other cell lines. [score:3]
c Representative example of liver metastases at 4 weeks after NOZ cells overexpressing miR-30a-5p were injected into the spleens of mice. [score:3]
b Relative miR-30a-5p expression levels in GBC tissues (Tumour) (n = 42) and non-tumour adjacent tissues (NATs) (n = 42) {P < 0.001). [score:3]
The expression of miR-30a-5p in tissue specimens was observed by ISH using digoxigenin -labelled probes (Boster Biotech, Wuhan, China). [score:3]
d Kaplan–Meier curves for DFS in patients with GBC with high and low miR-30a-5p expression levels (P < 0.001). [score:3]
The results showed that restoring E2F7 expression partially abrogated the reductions in proliferation and colony formation induced by miR-30a-5p in NOZ cells (Fig.   6a and Supplementary Figure  S4a-b). [score:3]
In contrast, miR-30a-5p mimics inhibited cell growth and colony formation in both cell lines (Fig.   2a, b and Supplementary Figure  S1c). [score:3]
d E-cadherin and vimentin protein expression levels in GBC cells transfected with miR-30a-5p plus E2F7 or anti-miR-30a-5p plus si-E2F7 or anti-miR-30a-5p plus E2F7. [score:3]
In this study, we found that miR-30a-5p altered the expression of EMT-related proteins, including E-cadherin and vimentin. [score:3]
Fig. 1 a Relative miR-30a-5p expression levels in 42 patients with GBC. [score:3]
These results are consistent with the experiments in which a negative correlation between miR-30a-5p expression levels and lymph node metastasis was observed in the GBC tissue samples. [score:3]
d RT-qPCR and western blot analyses of E2F7 expression levels in GBC-SD and NOZ cells transfected with miR-NC and miR-30a-5p or anti-NC and anti-miR-30a-5p. [score:3]
Thus, in this study, we explored the tumour suppressor role of miR-30a-5p in GBC cell lines. [score:3]
Nonetheless, our study has provided strong evidence pointing to the novel regulatory axis of miR-30a-5p/E2F7 in the development of GBC. [score:3]
e Kaplan–Meier curve for OS in patients with GBC with high (n = 21) and low (n = 21) miR-30a-5p expression levels (P < 0.001). [score:3]
To determine the role of miR-30a-5p in GBC, we transfected miR-30a-5p mimics and a specific miR-30a-5p inhibitor, anti-miR-30a-5p, into GBC-SD and NOZ cells and then measured miR-30a-5p expression levels by real-time PCR (Supplementary Figure  S1b). [score:3]
A Kaplan–Meier analysis showed shorter disease-free survival (DFS) and overall survival (OS) in the subjects with low miR-30a-5p (below sample median) (P < 0.001 vs. [score:3]
Here we demonstrated that miR-30a-5p significantly inhibited GBC cell proliferation and migration and attenuated tumour growth and metastasis in xenografted mice. [score:3]
a Representative example of nude mice at 3 weeks post-injection with subcutaneous xenografts of NOZ cells overexpressing miR-30a-5p (five mice per group). [score:3]
miR-30a-5p suppresses GBC cell proliferation, migration and invasion in vivo. [score:3]
Fig. 6Cell viability, wound closure, and cell migration and invasion ability were assayed in GBC cells transfected with miR-30a-5p and E2F7-overexpression vectors or anti-miR-30a-5p and E2F7 siRNA. [score:2]
Among these miRNAs, miR-30a-5p, which is located in the chromosomal region 6q13, has been reported to be deregulated in several human cancers 8– 11. [score:2]
high miR-30a-5p; Fig.   1d, e). [score:1]
We then cloned E2F7 3′-UTRs containing wild-type or mutant miR-30a-5p -binding sites into luciferase reporter plasmids (Fig.   5a). [score:1]
The associations between miR-30a-5p expression levels and clinicopathologic characteristics were analysed by Pearson’s Χ [2] test, and survival analysis was performed with Kaplan–Meier plots and the log-rank test. [score:1]
qRT-PCR showed lower miR-30a-5p in the primary GBC lesions vs. [score:1]
However, the precise role of miR-30a-5p in tumourigenesis was largely unknown prior to this study. [score:1]
A 2047-bp fragment of the E2F7 3′UTR containing three conserved miR-30a-5p -binding sites was inserted into a luciferase reporter plasmid (LQbiotech, Shanghai, China), and a synthetic E2F7 3′-UTR mutant fragment was inserted into an equivalent reporter plasmid. [score:1]
However, the pathological relevance and clinical significance of miR-30a-5p in GBC remain unknown. [score:1]
miR-30a-5p represses GBC cell cycle progression and EMT in vitro. [score:1]
c Representative images of the ISH staining analyses of GBC tissues and NATs using anti-miR-30a-5p probe. [score:1]
Moreover, we found that lower miR-30a-5p expression was significantly correlated with unfavourable clinicopathological characteristics, and shorter DFS and OS in patients with GBC, which strongly suggests that miR-30a-5p may serve as a novel diagnostic and prognostic biomarker for GBC. [score:1]
In contrast, miR-30a-5p mimics decreased β-catenin in the nuclear fraction and increased β-catenin in the cytosolic fraction (Fig.   3b and Supplementary Figure  S2e). [score:1]
Our results showed that miR-30a-5p increased β-catenin in the cytosolic fraction and decreased β-catenin in the nuclear fraction. [score:1]
Our findings have provided new insights into the mechanisms underlying GBC progression and indicate that miR-30a-5p may have potential as a novel prognostic biomarker for GBC and that the miRNA may also be useful as a therapeutic agent for the treatment of GBC. [score:1]
MiR-30a is a member of miR-30 family, which also includes miR-30b, miR-30c, miR-30d, and miR-30e. [score:1]
In situ hybridisation (ISH) staining confirmed lower miR-30a-5p in the primary lesions (Fig.   1c). [score:1]
Moreover, haematoxylin and eosin staining showed that more metastatic tumour nodules were present in the livers of the control group than in the miR-30a-5p -treated group. [score:1]
As shown in Fig.   4c, d, control mice displayed a higher metastasis rate than miR-30a-5p mimic -treated mice. [score:1]
a The 3′-UTR of E2F7 mRNA contains wild-type or mutant miR-30a-5p -binding sequences. [score:1]
Zhou J Urinary microRNA-30a-5p is a potential biomarker for ovarian serous adenocarcinomaOncol. [score:1]
miR-30a-5p mimics blocked G1/S transition (as reflected by higher percentage of cells in the G1 phase) in both cell lines (Fig.   3a and Supplementary Figure  S2a). [score:1]
a Representative results of the cell cycle analysis in which specific cell lines were treated with miR-NC and miR-30a-5p. [score:1]
Anti-miR-30a-5p increased β-catenin in the nuclear fraction and decreased β-catenin in the cytosolic fraction. [score:1]
c was performed in 293T cells co -transfected with miR-30a-5p and pGLO-E2F7 WT or pGLO-E2F7 MΜT vectors. [score:1]
To further determine if E2F7 can rescue the phenotype induced by altered miR-30a-5p in the cells, we co -transfected GBC cells with either miR-30a-5p together with pCMV-E2F7, or anti-miR-30a-5p together with si-E2F7. [score:1]
MiR-30a-5p was chosen as the subject of this study, which showed that miR-30a-5p plays an important role in GBC initiation and progression. [score:1]
Gain and loss of E2F7 function abrogates and enhances the impact of miR-30a-5p on cell proliferation and metastasis, respectively. [score:1]
Collectively, these results strongly indicated that the newly discovered miR-30a-5p/E2F7 axis plays a significant role in GBC progression and thus may serve as a valuable predictor of GBC recurrence and poor survival in patients with GBC. [score:1]
Briefly, NOZ cells were transfected with miR-30a-5p mimics or miR-NCs, and then the indicated cells were subcutaneously injected into the left armpit of each mouse (five mice/group). [score:1]
[1 to 20 of 95 sentences]
5
[+] score: 302
The targeting of Slug mRNA by miR-30 results in downregulation of fascin and upregulation of the tight junction proteins CLDN-1, CLDN-2, and CLDN-3, which downregulates EMT and, ultimately, reduces the rate of breast cancer progression. [score:12]
Indeed, decreased luciferase activity in a reporter assay showed that the 3′-UTR of Snail mRNA is a direct target of miR-30a in breast cancer cells (Supplementary Figure S2), and this is consistent with a previous report that miR-30a overexpression downregulates Snail and thereby inhibits invasion and metastasis of lung carcinomas [12]. [score:10]
Notably, this inhibition of invasion by sh-Slug treatment did not change in the presence of miR-30a overexpression (or miR control) (Figure 4C), and no changes in fascin or claudin expression were seen in sh-Slug cells overexpressing miR-30a (miR-30a -mimic) (Figure 4D). [score:9]
Additional miR-30a–regulated targets have been identified and their functions defined, including involvement in tumor cell autophagy [28], mediating cis-platinum chemosensitivity [29], suppressing metastatic colorectal cancer by inactivating the Akt/mTOR pathway [30], and inhibiting breast cancer metastasis by decreasing metadherin [31]. [score:8]
Because (a) claudin -based tight junction proteins are crucial for the barrier function of epithelial cell sheets in mammals [15] and (b) the E-box motif (CANNTG) in the human CLDN1 promoter region (Figure 3A) is bound by Snail family members and Slug overexpression decreases CLDN1 mRNA and protein [16], we thus examined whether the repression of Slug through miR-30a overexpression could increase CLDN-1 expression. [score:7]
In parallel, Slug expression was restored in conjunction with decreased levels of the CLDNs in plemiR-30a–transduced MD-MBA-231 cells upon transfection with an inhibitor against miR-30a (anti-miR-30a) compared with expression in the negative control (anti-miR(NC)) (Figure 3C). [score:6]
Because these two cell lines are intrinsically deficient in expression of E-cadherin [11], which is a key protein contributing to cell-cell adhesion, we hypothesized that miR-30a targets other mRNAs involved in regulating EMT. [score:6]
The tumor-suppressive function of miR-30a reverses EMT in breast cancer by directly targeting the 3′-UTR of Slug. [score:6]
Labeling of MDA-MB-231 and Hs578T cells with Alexa Fluor 488–conjugated phalloidin revealed substantial disorganization of microfilaments in cells overexpressing miR-30a (Figure 3D); notably, fewer filopodia per cell were counted in miR-30a–expressing cells compared with expression of the vector alone (Figure 3E). [score:6]
Thus, miR-30a may have a tumor-suppressive function to inhibit the development of the mesenchymal phenotype during EMT via an E-cadherin–independent mechanism in aggressive breast cancer cells. [score:6]
Ectopic expression of miR-30a inhibits tumor growth and metastatic lung colonization of breast cancer xenografts. [score:5]
The resultant positive staining for CLDN-1, -2, and -3 that was associated with decreased expression of Slug and fascin differentiated the orthotopic tumor tissues with miR-30a overexpression from those carrying vector alone (Figure 5E). [score:5]
46)miR-30a [low]/CLDN2 [low] 18 (62.1) 11 (37.9) 3.51 (1.09−11.29)* 21 (72.4) 8 (27.6) 5.62 (1.67−18.89)** 17 (58.6) 12 (41.4) 8.97 (2.16−37.28)** P for trend = 0.051 P for trend = 0.012 P for trend = 0.002 a Expression status of the individual mRNAs was defined by comparing target mRNA expression in tumor cells and adjacent non-tumor cells captured from the primary tumor site of the same patient and was calculated by the comparative CT method. [score:5]
Our results at the molecular and cellular levels were thus consistent with those from an animal mo del, all of which indicated that increased expression of CLDN-1, CLDN-2, and CLDN-3 and decreased expression of fascin are controlled by the miR-30a/Slug axis. [score:5]
miR-30a overexpression inhibits lung colonization and tumor growth in xenograft transplantation mo dels of human breast cancer. [score:5]
The miR-30a [low]/ CLDN [low]/ FSCN [high] genotype in association with breast cancer progressionOur results at the molecular and cellular levels were thus consistent with those from an animal mo del, all of which indicated that increased expression of CLDN-1, CLDN-2, and CLDN-3 and decreased expression of fascin are controlled by the miR-30a/Slug axis. [score:5]
To examine a causal link between miR-30a expression and invasiveness in Hs578T and MDA-MB-231 cells, we created a lentiviral vector that is based on plemiR; the vector contained a 551-bp fragment of the pre-miR-30a sequence (plemiR-30a) and was expressed in Hs578T and MDA-MB-231 breast cancer cells. [score:5]
miR-30 family members, including miR-30a, are downregulated in estrogen receptor–negative and progesterone receptor–negative breast tumors, suggesting that these hormones are involved in de novo synthesis of miR-30 family members [26, 27]. [score:4]
Figure 4(A) MDA-MB-231 cells were transfected with plemiR or plemiR-30 and then treated with miR-30a inhibitor (anti-miR-30a) or underwent Slug knockdown with a Slug-specific short hairpin RNA (sh-Slug) or sh-Luc, a control shRNA. [score:4]
In addition, the regulator Snail (SNAI1), which mediates EMT activation for metastatic dissemination of cancer cells from the primary tumor, is targeted by miR-30a [12]. [score:4]
We are currently mapping the specific region that harbors the hormone-response element(s) in the miR-30 promoter and will identify the hormonal mechanism that regulates miR-30 expression, which could help determine the clinical benefit of endocrine therapy in individuals with hormone receptor–positive breast cancer. [score:4]
To assess the prognostic prediction of the interaction between miR-30a and FSCN or between miR-30a and CLDN2 in breast cancer, we defined expression status as “high” (≥ 4.90-fold increase in FSCN mRNA compared with the median) or “low” (< 2.40-fold decrease in CLDN2 mRNA) by comparing expression in cancer cells and adjacent non-cancerous cells. [score:4]
Furthermore, we proposed that miR-30a/Slug is linked to reduced levels of fascin (FSCN gene); an actin-bundling protein localized to the tips of filopodia, and thus inhibits the development of the mesenchymal tumor phenotype in breast cancer. [score:4]
miR-30a levels are expressed as the mean ± SD from three independent experiments. [score:3]
Our present miRNA study demonstrates that Slug, as well as vimentin [10], is a miR-30a target that is particularly important in breast cancer progression. [score:3]
The exclusively tumor-suppressive effect of miR-30a in the regulation of multiple important tumorigenic genes/pathways involved in cancer cell heterogeneity may drive the development and evaluation of miR-30a as a therapeutic for breast cancer. [score:3]
miR-30a inhibits EMT in different types of cancer, including gastric, liver, and lung cancer [12, 20, 21]. [score:3]
miR-30a inhibits EMT by binding to Slug. [score:3]
Moreover, our clinical analysis and experimental mo dels demonstrate that the miR-30a/Slug axis is a potential therapeutic target in human breast cancer. [score:3]
In vitro binding of miR-30a to Slug mRNA increased expression of the tight-junction proteins CLDN-1, -2, and -3 and decreased the metastatic capability of those cells owing to its effects on the reduction of F-actin polymerization. [score:3]
In the immunohistochemical analysis (n = 10), tissues that expressed high levels of miR-30a (tumor-to-normal (T/N) ratio ≥ 0.50-fold as defined in [10]), had intense positive staining for the three claudin proteins, and had reduced or undetectable levels of Slug and fascin were from well-differentiated, lymph node metastasis (LNM) -negative, and non-invasive tumors. [score:3]
We established a xenograft mo del of human breast cancer metastasis by injection of MDA-MB-231 cells transfected with empty vector (control) or the miR-30a overexpression vector into the tail vein of 6-week-old mice. [score:3]
According to data sorting of the mRNA sequences bound to miRNAs, miR-30 family members (miR-30a, -30b, -30c, -30d, and -30e) share the same seed sequence (Supplementary Figure S1), suggesting that other miR-30 family members may also suppress Snail or Slug. [score:3]
In addition, we used mouse xenotransplantation assays to demonstrate the effect of suppressing the miR-30a–directed repression of Slug on cancer cell progression. [score:3]
This suggests that miR-30a cannot inhibit cancer cell invasion in the absence of Slug. [score:3]
We also injected breast tumor cells into the mammary fat pads of mice to study the effect of miR-30a on inhibition of tumor outgrowth. [score:3]
miR-30a targets the 3′-UTR of Slug mRNA. [score:3]
Here we propose a mechanism for this effect by which miR-30a counteracts the aggressiveness and metastasis of cancer cells by increasing tight junction molecules—CLDN-1, CLDN-2, and CLDN-3—via targeting the 3′-UTR of Slug mRNA. [score:3]
The decrease in Slug levels by miR-30a in invasive breast cancer cells resulted in a transformation to a cobblestone-like epithelial phenotype, and ectopic administration of miR-30a led to increased claudin expression, which is transcriptionally inactivated by Slug [14]. [score:3]
Clinically, RNA expression profiles and immunohistochemical analyses confirmed that the miR-30a [low]/Claudin [low]/Fascin [high] link correlated with poor prognosis for breast cancer. [score:3]
Figure 2Identification of Slug as a downstream target for miR-30a(A) Predicted binding sites for miR-30a within the 3′-UTR of Slug mRNA. [score:3]
Figure 5(A) Representative lungs and HE staining of metastatic tumor (M) and normal (N) lung tissues from mice 5 weeks after tail vein injection of MDA-MB-231 cells overexpressing miR-30a or plemiR vector (control). [score:3]
Tumors with high expression of miR-30a formed only a few pulmonary metastatic nodules on average (16.0 ± 10.8) in all mice analyzed and significantly fewer than the number of nodules formed in the control group (139.2 ± 35.2, P = 0.0028) (Figure 5B). [score:3]
The miR-30a/Slug axis inhibited filopodial assembly during EMT in breast cancer cells, which resulted in reduced levels of mesenchymal proteins, e. g., vimentin and fascin. [score:3]
We thus examined the effect of miR-30a overexpression on the blockage of F-actin polymerization in invasive breast cancer. [score:3]
We first assessed whether decreased miR-30a expression was significantly associated with breast cancer aggressiveness in different breast cancer cell lines. [score:3]
miR-30a represses Slug to inhibit invasiveness of breast cancer. [score:3]
After 4 weeks, the subsequent tumors in the mice injected with MDA-MB-231 cells that overexpressed miR-30a were significantly smaller than those in the control group (P < 0.001) (Figure 5C–5D). [score:3]
Decreased miR-30a expression is associated with invasiveness of breast cancer cell lines. [score:3]
Identification of Slug as a downstream target for miR-30a. [score:3]
org/) predicted that Slug mRNA may be a target of miR-30a, and Slug contains two evolutionarily conserved domains in its 3′-UTR that have complementarity with human miR-30a (Figure 2A). [score:3]
This supported a suppressive function for miR-30 in breast cancer invasiveness and metastasis in vivo. [score:3]
miR-30a targets the 3′-UTR of Slug mRNAOur initial in silico analysis using computational prediction algorithm software, including miRanda (http://www. [score:3]
The in silico prediction, luciferase reporter assay, and western blotting all indicated that Slug mRNA is a direct target of miR-30a. [score:3]
Lentivirus carrying hsa-miR-30a (plemiR-30a) or control (plemiR) was packaged with a lentivirus expression system (Thermo Fisher Scientific) and the Trans-Lentiviral [TM] GIPZ Packaging System (Open Biosystems, Huntsville, AL, USA). [score:3]
Importantly, miR-30a inhibits the attachment-independent growth of breast tumor–initiating cells identified in a subset of tumors with unlimited self-renewal and differentiation heterogeneity [32]. [score:3]
We thus hypothesized that miR-30a binds to the 3′-UTR of Slug mRNA to inhibit EMT -driven invasion and migration in breast cancer. [score:3]
More specifically, the differences in the expression of the proteins encoded by these genes were validated by immunohistochemistry in breast cancer tissue specimens, and the results were stratified based on the miR-30a level (Figure 7A). [score:3]
In addition, Slug and fascin protein levels were restored in plemiR-30a–expressing/MDA-MB-231 cells transfected with anti-miR-30a. [score:3]
Claudin expression is enhanced by the miR-30a/Slug axis. [score:3]
Establishment of breast tumor cells stably expressing miR-30a. [score:3]
Our previous breast cancer study revealed that miR-30a inhibits the invasion and migration of Hs578T and MDA-MB-231 breast cancer cells in vitro [10]. [score:3]
In accordance with this phenotypic change, analysis of fluorescence images also revealed strong staining for claudins along the cell boundaries of both MDA-MB-231 and Hs578T cells stably expressing miR-30a (Figure 3F). [score:3]
Cells were treated with anti-miR-30a or anti-miR -mimic (NC), and after which a sterile 10-μL tip was used to scratch the monolayer of cells to form a bi-directional wound. [score:2]
Two miR-30a sites complementary to the GTTTAC sequence in the Slug 3′-UTR were mutated individually or in combination to remove complementarity to miR-30a using the QuikChange II XL site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) with pGL4.13/Slug 3′-UTR/wt as the template. [score:2]
Based on chromatin immunoprecipitation (ChIP) with an antibody against Slug, capture of the CLDN1 fragment (Figure 3B) was reduced in MDA-MB-231 cells stably expressing miR-30a as compared with cells containing the plemiR empty vector. [score:2]
Thus, the reduction of Slug and fascin protein levels in the miR-30a–transduced breast cancer cells was abrogated upon transfection with the miR-30a inhibitor (anti-miR-30a), which resulted in enhanced tumor cell invasion as compared with control oligonucleotide–transfected cells (Figure 4A–4B). [score:2]
In contrast, MCF-7 breast cancer cells treated with inhibitor against miR-30a (anti-miR-30a) had enhanced tumor cell motility (Figure 1E–1G), which is considered a prerequisite for retaining metastatic potential. [score:2]
To test this hypothesis, we used an in vitro mo del of the mesenchymal-to-epithelial transition (MET) that is regulated by the miR-30a/Slug axis. [score:2]
In addition, the promoter regions of CLDN2 (nt −803 to −717) and CLDN3 (nt −462 to −363) share the E-box motifs for Slug binding (Figure 3A), and indeed the assay showed a similar decrease in the CLDN2- and CLDN3-captured fragments in cells overexpressing miR-30a (Figure 3B). [score:2]
A dual-luciferase reporter assay showed that overexpression of miR-30a reduced the activity of the luciferase gene fused to the full-length Slug 3′-UTR (pGL4.13/ Slug 3′-UTR/wt) by > 30% as compared with the Hs578T-pcDNA3 cells (control group) (P < 0.01) (Figure 2B–2C). [score:1]
Appropriate probes and primer sets were used to detect expression of genes encoding hsa-miR-30a (AB assay ID: 000417), FSCN (Hs00362704_m1), and CLDN2 (Hs01549234_m1) according to the procedure described by Applied Biosystems. [score:1]
A joint effect of higher risk associated with poor clinicopathological features of breast cancer was observed in patients who more closely adhered to the miR-30a [low]/ CLDN2 [low]/ FSCN [high] genotype (Table 3). [score:1]
As we demonstrated, miR-30a induction led to a diminution of the elongated and spindle-like fibroblastic phenotype in Hs578T and MDA-MB-231 invasive breast cancer cell lines (Figure 1D), in which E-cadherin is intrinsically deficient (ref. [score:1]
Correlation between miR-30a and EMT markers. [score:1]
Figure 7(A) The cellular phenotype of miR-30a [low]/Slug [high]/Fascin [high]/Claudin [low] correlates with poor clinicopathological features in breast cancer. [score:1]
The miR-30a [low]/ CLDN [low]/ FSCN [high] genotype in association with breast cancer progression. [score:1]
In addition, the T/N ratio for miR-30a was < 0.50 in columns c and d and was ≥ 0.50 in columns a and b. Clinicopathological features of the tumors were determined according to the sixth edition of the AJCC Cancer Staging Manual [40]. [score:1]
Figure 1(A) Comparison of miR-30a levels among normal breast epithelial cells (H184B5F5/M10 and MCF-10A) and breast cancer cell lines that are non-metastatic (BT-474 and MCF-7) or metastatic (Hs578T and MDA-MB-231). [score:1]
In addition, a significant reduction in luciferase activity was observed in the presence of pre-miR-30a using the reporter construct containing the Slug 3′-UTR/mut2 clone (Figure 2C). [score:1]
Thus, miR-30a may be useful as a therapeutic strategy for breast cancer treatment. [score:1]
miR-30a represses Slug to increase claudins in conjunction with the MET reversion. [score:1]
We therefore determined whether there is an association between miR-30a/claudin/fascin and clinicopathological significance of breast cancer. [score:1]
Decreased miR-30a levels in metastatic breast cancer. [score:1]
With miR-30a [high]/ FSCN [low] and miR-30a [high]/ CLDN2 [high] as the reference, there was a greater proportion of the miR-30a [low]/ FSCN [high] and miR-30a [low]/ CLDN2 [low] genotype, respectively, in cancer patients with a large tumor size, advanced tumor stage, or lymph node involvement (P for trend < 0.05) at the time of diagnosis (Table 2). [score:1]
Thus, the region from 13 to 20 is the crucial site within the 3′-UTR of Slug that is required for miR-30a binding. [score:1]
We next addressed the question regarding joint effects of miR-30a [low]/ CLDN2 [low]/ FSCN [high] on prognostic assessment of breast cancer. [score:1]
A puromycin-resistant selectable marker was used to select against non-transduced cells to amplify miR-30a from the Hs578T and MDA-MB-231 cells. [score:1]
Additional studies are needed to determine whether defects in miR-30 family members act independently or jointly to drive the progression of breast cancer. [score:1]
miR-30a was quantified by TaqMan real-time PCR, and the relative levels of miR-30a were normalized to RNU6B. [score:1]
Interestingly, although both breast cancer cell lines are intrinsically deficient in E-cadherin (Figure 1C), indicating that they had lost an epithelial cell characteristic, the morphological change from an elongated and spindle-like fibroblastic shape to a cobblestone-like epithelial phenotype was observed when miR-30a was overexpressed (Figure 1D). [score:1]
miR-30a decreases the invasiveness of breast cancer cells. [score:1]
6) 19 (86.4) 1.00 (Ref)miR-30a [high]/CLDN2 [low] 8 (57.1) 6 (42.9) 2.85 (0.71−11.43) 8 (57.1) 6 (42.9) 2.85 (0.71−11.43) 5 (35.7) 9 (64.3) 3.52 (0.70−18.07)miR-30a [low]/CLDN2 [high] 11 (52.4) 10 (47.6) 2.36 (0.68−8.15) 9 (42.9) 12 (57.1) 1.61 (0.46−5.58) 7 (33.3) 14 (66.7) 3.17 (0.72−14. [score:1]
In contrast, the advanced breast tumor tissues (late stage and LNM -positive) with decreased (T/N ratio < 0.50-fold) or undetecTable miR-30a (T/N ratio < 0.10-fold) had low-intensity staining for claudins but strong intensity for Slug and fascin (Supplementary Table S1). [score:1]
In addition, clinical observations, including those of our breast cancer cohort [10, 31], showed that miR-30a reduction is associated with lymph node and lung metastases in patients with breast cancer. [score:1]
In our breast cancer cohort (n = 86) (Table 1), CLDN2 mRNA transcripts were significantly and positively associated with miR-30a levels in cancerous tissues (Pearson correlation coefficient, 0.375; P = 0.0004) (Figure 6A). [score:1]
Results were normalized against GAPDH (for FSCN and CLDN2) and RNU6B (for miR-30a). [score:1]
We therefore examined the suppressive function of miR-30a in breast cancer progression in conjunction with characteristic changes in EMT markers. [score:1]
In contrast, FSCN mRNA had an opposite correlation with miR-30a (Pearson correlation coefficient, −0.424; P < 0.0001) (Figure 6B). [score:1]
The 3′-UTR of Slug contains two binding regions for miR-30a (in red) across different vertebrate species. [score:1]
MDA-MB-231 cells in 24-well plates were co -transfected with 100 ng Slug reporter construct containing wild-type or mutated 3′-UTR and pcDNA3 (control) or pcDNA3/miR-30a. [score:1]
Effect of interaction between miR-30a and FSCN or between miR-30a and CLDN2 transcripts on poor prognosis in breast cancer. [score:1]
The wild-type miR-30a–binding sequences are underlined. [score:1]
[1 to 20 of 103 sentences]
6
[+] score: 294
miR-30s are abundant in podocytes and are downregulated by TGF-β in vitro and in vivo Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice. [score:15]
B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice. [score:14]
The important role of TGF-β in controlling epithelial plasticity by promoting epithelial-to-mesenchymal transition (EMT) is well-documented [34] and is dependent on the coordinated upregulation of miR-155 and the subsequent inhibition of its target, RhoA, and the downregulation of miR-30 in mouse mammary epithelial cells [35]. [score:11]
Together, these results suggest that among the various miRs regulated by TGF-β in kidney disease, the TGF-β -induced downregulation of miR-30 may regulate apoptosis -associated target genes and their associated apoptotic pathways. [score:10]
Overexpression of miR-30 induced, while miR-30 reduction inhibited, the apoptosis of BT-ICs cells through affecting target Itgb3 expression. [score:9]
In silico predictions of miR-30 targets and functionTo obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www. [score:9]
Among the 190 genes that are upregulated in the glomeruli of Dicer [fl/fl]:NPSH2-Cre mice, the predicted miR-30 targets were highly enriched, suggesting a role for miR-30 in the gene expression and homeostasis of podocytes [16]. [score:8]
These findings demonstrate that miR-30s are abundantly expressed in the podocytes and parietal epithelial cells of glomeruli, and TGF-β downregulates miR-30 expression in podocytes both in vivo and in vitro. [score:8]
Moreover, we examined the precursors of these miR-30s in these RNA samples by qPCR, and the result showed that they were also downregulated in the glomeruli of Alb-TGF-β mice (Figure S2), suggesting that TGF-β regulates miR-30 expression at the transcription level. [score:7]
To obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www. [score:7]
Interestingly, miR-30 has recently been shown to target p53 directly in human cardiomyocytes, resulting in inhibition of Drp1 -mediated mitochondrial fission and apoptosis in response to oxidative stress [20]. [score:6]
Ongoing and future work will be needed to elucidate at the molecular level the mechanisms that mediate the concerted downregulation of all five miR-30 family members downstream of Smad2 and to determine how miR-30s inhibit the phosphorylation/activation of pro-apoptotic p53. [score:6]
However, the reported inhibitory mechanism of a direct miR-30-p53 target pairing differs from that observed in our results. [score:6]
In the current study, we report that miR-30s are expressed selectively and abundantly in glomerular podocytes in mice and that TGF-β profoundly downregulates miR-30 members in podocytes both in vivo and in vitro. [score:6]
We propose that the miR-30 family represents an attractive novel therapeutic target for the protection of podocytes in glomerular diseases, as our study demonstrated that maintenance of miR-30 levels above critical thresholds prevented podocyte apoptosis in the presence of TGF-β. [score:5]
Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A typical miR is predicted to target hundreds of genes based on the presence of its recognition motif(s) in the 3’ untranslated regions (UTRs) of the genes. [score:5]
Sustained expression of miR-30 inhibits TGF-β induced apoptosis of podocytes. [score:5]
Thus, because the miR-30-p53 target pairing is not evolutionarily conserved and is only observed in primate genomes, our findings provide an important, previously unknown alternative mechanism for the inhibition of p53 -mediated apoptosis by miR-30, at least in glomerular podocytes. [score:5]
File S1 Table S1, 155 miR-30 targets that are commonly predicted by TargetScan, PicTar, and miRbase, and conserved among human, dog, mouse and rat. [score:5]
There were 873 genes predicted to be miR-30 targets by TargetScan, 634 by PicTar, and 1,566 by miRbase. [score:5]
To determine whether a putative functional role of miR-30 could be predicted by in silico analysis of miR-30 target genes, we took a stringent approach and searched for potential miR-30 target genes that not only carry evolutionarily conserved miR-30 recognition motifs in their 3’-UTRs (Figure 2A) but also are consistently predicted by the three independent miR databases. [score:5]
uk/enright-srv/microcosm/htdocs/targets/), and then selected the common genes as our predicted miR-30 targets. [score:5]
miR-30 downregulation is required for activation of pro-apoptotic p53 by TGF-β. [score:4]
miR-30 precursors were downregulated in the glomeruli of Alb-TGF-β transgenic mice. [score:4]
Similarly, our results demonstrated for the first time that the concerted downregulation of all miR-30 members was specifically required for the activation of a central mediator of apoptosis, p53, by TGF-β. [score:4]
Downregulation of miR-30 members was required for TGF-β -induced apoptosis in visceral glomerular epithelial cells (podocytes). [score:4]
The finding that the TGF-β -induced downregulation of miR-30 may selectively promote apoptotic outcomes by permitting the activation of p53 expands our understanding of the emerging role of miRNAs in conferring biological specificity in cell type -dependent pluripotent TGF-β signaling networks. [score:4]
Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A. miR-30d transcripts were abundantly detected by in situ hybridization in podocytes (yellow arrows) and parietal epithelial cells (white arrows) in adult wildtype (wt) control mice, but not in Alb-TGF-β transgenic (Tg) mice; B. miR-30a, -30b, -30c, -30d, and -30e were significantly downregulated in cultured human podocytes after 6 and 24 hr of TGF-β treatment (5 ng/ml). [score:4]
Mechanistic studies demonstrated a novel and selective functional role for Smad2 -dependent downregulation of miR-30 in the TGF-β -mediated activation of pro-apoptotic p53, and this pathway was required for TGF-β -induced podocyte apoptosis. [score:4]
A. miR-30d transcripts were abundantly detected by in situ hybridization in podocytes (yellow arrows) and parietal epithelial cells (white arrows) in adult wildtype (wt) control mice, but not in Alb-TGF-β transgenic (Tg) mice; B. miR-30a, -30b, -30c, -30d, and -30e were significantly downregulated in cultured human podocytes after 6 and 24 hr of TGF-β treatment (5 ng/ml). [score:4]
miR-30 downregulation by TGF-β is mediated by Smad2 -dependent signaling and does not require Smad3. [score:4]
These results suggest that Smad2 -dependent downregulation of miR-30 by TGF-β is required to specifically activate p53 signaling during podocyte apoptosis. [score:4]
TGF-β significantly downregulated levels of miR-30 members in wild-type podocytes and S3 KO podocytes (Figure 6B). [score:4]
In contrast, Smad2 -dependent signaling selectively downregulates miR-30 family transcripts to permit the activation of pro-apoptotic p53, which is required for caspase-3 activation and apoptosis. [score:4]
In contrast, TGF-β had no significant effect on miR-30 levels in S2 KO and D KO podocytes (Figure 6B), demonstrating that Smad2 mediates the TGF-β -induced downregulation of miR-30 in podocytes. [score:4]
In contrast, TGF-β had no effect on the apoptotic rates of podocytes with lentiviral expression of either miR-30a, miR-30d, or miR-30a/30c/30d combined (Figure 5D). [score:3]
B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. The novel findings reported in our work connect for the first time the miR-30 family with the TGF-β/Smad signaling network. [score:3]
Thirty out of 116 (26%) of the annotated miR-30 target genes were associated with apoptosis (Figure 2C, Table S2 in File S1). [score:3]
To validate the in silico predictions experimentally, we generated luciferase reporter vectors containing 3’-UTRs with miR-30 recognition sequences from 7 of the predicted target genes. [score:3]
Our results suggest that a high estimated percentage (~ 86%) of the 155 genes could be experimentally validated as genuine targets of miR-30. [score:3]
Thus, we conclude that an essential miR-30 threshold exists in podocytes, above which miR-30s can suppress pro-apoptotic factors and promote cell survival. [score:3]
Among these genes, 155 were predicted to be miR-30 targets in all three databases and were conserved in human, dog, rat and mouse (Table S1 in File S1). [score:3]
B. Bar graph showing the mean ± S. D. of the activity of luciferase reporter constructs carrying 3’ UTR sequence fragments of seven genes randomly chosen from the 155 predicted miR-30 target genes. [score:3]
Lentiviral miR-30 expression sustains miR-30 levels in podocytes treated with TGF-β. [score:3]
Although the precise physiological roles of miR-30s remain poorly understood, miR-30 members may promote tumor invasion and metastasis by targeting Galphai2 in liver cancer cells [19]. [score:3]
In silico predictions of miR-30 targets and function. [score:3]
C. Quantitation of apoptosis rates under non-permissive differentiating culture conditions (37 °C, - IFN-γ); D. Bar graph demonstrating the fraction of TUNEL -positive nuclei in human podocytes infected with lentiviral vectors to express either scrambled control miR (Scram) or miR-30a (30a), miR-30d (30d), or combined miR-30a, -30c, -30d (30acd) left untreated (blue bars) or treated with TGF-β (5 ng/ml) for 48 hr (red bars). [score:3]
Table S2, List of cell death associated genes from the 155 predicted miR-30 targets according to analyses of Inguinity System. [score:3]
Apoptosis associated genes are highly enriched among the predicted miR-30 targets. [score:3]
Reporter constructs were cotransfected with either a scrambled miR expression construct (control) or a synthetic miR-30 precursor (pre-miR-30a). [score:3]
Next we performed quantitative PCR analyses of miR-30a, -30c and -30d in the glomerular RNA from the mice, and the results indicated that these miR-30s were all downregulated in the glomeruli of Alb-TGF-β mice compared with controls (Figure S1). [score:3]
Functional annotations were available in the Ingenuity Pathway Analysis software for 116 of the 155 predicted miR-30 targets. [score:3]
Maintenance of sufficient miR-30 levels may provide a new therapeutic strategy to promote podocyte survival and prevent podocyte depletion in progressive glomerular diseases. [score:3]
However, Itgb3 is not expressed in podocytes (data not shown), precluding the involvement of miR-30-Itgb3 pair in podocyte apoptosis. [score:3]
Because we demonstrated that miR-30 was specifically controlled by Smad2, but not Smad3, therapeutic supplementation of miR-30 may provide an approach to target pro-apoptotic TGF-β activity without interfering with homeostatic Smad3- or Cd2ap -dependent activities. [score:3]
To investigate whether miR-30 downregulation by TGF-β had any role in podocyte apoptosis, one of the miR-30 family members, miR-30d, was studied as a representative member of the family. [score:2]
Finally, TGF-β treatment of human podocytes cultured under non-permissive or permissive conditions significantly reduced the levels of all five miR-30 family members beginning at 6 hrs, as determined by qRT-PCR (Figure 1B). [score:1]
A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line). [score:1]
Figure S2The same total RNA samples in Figure S1 were used for qPCR analyses of the precursors of miR-30a -30c, and -30d following the method we described previously [16]. [score:1]
The miR-30 family consists of 5 evolutionarily conserved members, miR-30a through -30e. [score:1]
The bar graph shows the mean ± S. D. of the relative abundances of miR-30a, -30c, and -30d in the glomeruli of control and Alb-TGF-β groups. [score:1]
For example, we demonstrated for the first time that to induce apoptosis in podocytes, TGF-β signaling must decrease protective miR-30 levels specifically through the Smad2 -dependent pathway, whereas Smad3 is not required. [score:1]
miR-30 quantification in the RNA samples was conducted by qRT-PCR using the Ncode miRNA Amplification System (Invitrogen, Carlsbad, CA). [score:1]
Indeed, therapeutic maintenance of miR-30 may protect epithelial cells, including podocytes, from multiple pro-apoptotic stressors, including TGF-β (this work) and oxidative stress and hypoxia [20]. [score:1]
Finally, we repeated these experiments using lentiviral miR-30a or a combination of miR-30a, -30c, and -30d in comparison with a scrambled miR control and miR-30d (Figure 5D). [score:1]
In addition, miR-30 has been implicated in the epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) via TGF-β signaling in anaplastic thyroid carcinomas [22]. [score:1]
Quantitative PCR analyses of miR-30a, - 30c and -30d were performed with the glomerular RNA samples from two-week old Alb-TGF-β mice (n = 5) and the age-matched controls (n = 4) using the method of magnetic bead perfusion. [score:1]
Thus, it will be interesting to examine whether restoration of homeostatic miR-30 levels by therapeutic miR-30 replacement therapy will protect the survival of podocytes exposed to a range of common mediators of glomerular injury, including metabolic, mechanic, and toxic stressors. [score:1]
Moreover, we showed that sustaining miR-30 levels above this proposed threshold prevented both increases in protein and in phosphorylation of p53 in podocytes. [score:1]
The Bar graph shows the mean ± S. D. of the relative abundance of the precursor of miR-30a, -30c, or -30d in the glomeruli of Alb-TGF-β mice (n = 5) and the controls (n = 4). [score:1]
0075572.g002 Figure 2 A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line). [score:1]
Figure S1Quantitative PCR analyses of miR-30a, - 30c and -30d were performed with the glomerular RNA samples from two-week old Alb-TGF-β mice (n = 5) and the age-matched controls (n = 4) using the method of magnetic bead perfusion. [score:1]
Note that at the age of 2 weeks the Alb-TGF-β mice had a ~ 20% podocyte loss according to our previous studies [8], which contributed to the miR-30 reduction in the glomeruli of Alb-TGF-β mice. [score:1]
Thus, we propose a novel pro-apoptotic TGF-β-Smad2-miR-30-p53 pathway that is necessary for caspase-3 activation and apoptosis in podocytes (Figure 8). [score:1]
[1 to 20 of 74 sentences]
7
[+] score: 213
To further detect whether RUNX3 downregulated vimentin expression through miR-30a, we added the miR-30a inhibitor into gastric cancer cells transfected with the RUNX3 expression vector and found that the miR-30a inhibitor abolished the RUNX3 -mediated downregulation of vimentin and the inhibition of gastric cancer cell invasion. [score:17]
We found that RUNX3 overexpression up-regulated and inhibition downregulated the expression of miR-30a, but had no effect on miR-30e level (Fig.   5B and C). [score:13]
Figure 6 miR-30a directly binds to the 3′ untranslated region (UTR) of vimentin and downregulated vimentin protein expression. [score:9]
miR-30a targeted the vimentin 3′ UTR directly and downregulated vimentin protein expression. [score:9]
Furthermore, overexpression of RUNX3 increased the expression of miR-30a, which directly targeted the 3′ UTR of vimentin and decreased its protein level. [score:8]
We knocked down miR-30a with an inhibitor of miR-30a in RUNX3 -overexpressed gastric cancer cells and detected cell invasion and the expression of vimentin. [score:8]
An miR-30a inhibitor abrogated RUNX3 -mediated inhibition of cell invasion and downregulated vimentin. [score:8]
mir-30a was critical for RUNX3 -mediated cell invasion inhibition and vimentin downregulation. [score:6]
We overexpressed or knocked down RUNX3 in gastric cancer and detected the mRNA expression of miR-30a and miR-30e. [score:6]
Cheng et al. 38 showed that miR-30a could directly bind to the 3′ UTR of vimentin and inhibit its translation, then reduce the protein level of vimentin in breast cancer. [score:6]
Therefore, RUNX3 -mediated cell invasion inhibition and vimentin downregulation depended on miR-30a. [score:6]
Figure S2 miR-30a inhibitor blocked RUNX3 -mediated downregulation of vimentin protein level in AGS cells. [score:6]
Figure 7 Runt-related transcription factor 3 (RUNX3) -mediated inhibition of cell invasion and downregulation of vimentin depends on miR-30a activation. [score:6]
The RUNX3 -mediated downregulation of vimentin protein level was also abrogated with the miR-30a inhibitor (Fig.   7C, Figure S2). [score:6]
Therefore, RUNX3 downregulated vimentin and inhibited gastric cancer cell invasion through an miR-30a–dependent mechanism. [score:6]
miR-30a mimics inhibited and miR-30a inhibitor induced vimentin protein level, but had no effect on its mRNA level (Fig.   6A and B). [score:5]
The miR-30a inhibitor abrogated RUNX3 -mediated inhibition of cell invasion (Fig.   7A and B). [score:5]
Thus, RUNX3 suppressed gastric cancer cell invasion and vimentin expression by activating miR-30a. [score:5]
To further determine whether RUNX3 regulate the expression of miR-30a by directly binding to the corresponding genomic sequences, we used Genomatrix to analyse the upstream region of mature miR-30a and found a consensus binding sequences of RUNX3 ‘TGTGGT’ (RBS) between the nucleotides -3854 to -3861. [score:5]
Human miR-30a and miR-30e mimics, control mimics, and miR-30a inhibitors and control inhibitors were synthesized from RiBoBio (Guangzhou, China). [score:5]
Finally, we determined RUNX3 and vimentin expression in 55 primary tumour samples from gastric cancer patients by western blot analysis and miR-30a expression by qRT-PCR analysis. [score:5]
We transfected the inhibitor or mimics of miR-30a into SGC-7901 cells and used qRT-PCR and Western blot analyses to detect the expression of vimentin. [score:5]
Therefore, we overexpressed or knocked down RUNX3 in BGC-823 and SGC-7901 cells and used qRT-PCR to detect the miR-30a and miR-30e mRNA levels in these cells. [score:4]
We next ascertained whether RUNX3 regulates EMT and vimentin expression via an miR-30a–dependent mechanism. [score:4]
Among these miRNAs, miR-30a and miR-30e were predicted to target to vimentin. [score:3]
The 366-bp miR-30a binding sequence at the 3′ untranslated region (3′ UTR) of human vimentin gene (Vim) was amplified and cloned into the SpeI/HindIII sites of a luciferase gene in the pMIR-REPORT luciferase vector (pMIR-Vim/wt). [score:3]
Figure 8Runt-related transcription factor 3 (RUNX3) expression is associated with miR-30a and vimentin in primary gastric cancer tissues. [score:3]
We searched miRNA databases to analyse these differentially expressed miRNAs and found that among the 15 miRNAs, only miR-30a and miR-30e were partly complementary to the conserved site within the 3′ UTR of vimentin (Fig.   5A). [score:3]
RUNX3 activated miR-30a expression. [score:3]
Overexpression of miR-30a decreased the protein level of vimentin in human gastric cancer cells, but had no effect on the mRNA level. [score:3]
RUNX3 expression was associated with miR-30a and vimentin in primary gastric cancer. [score:3]
In all, 29/55 samples showed the same trend of decreased RUNX3 and miR-30a expression in tumour rather than normal tissue. [score:3]
In contrast, inhibition of miR-30a increased the protein level of vimentin. [score:3]
Figure 5 Runt-related transcription factor 3 (RUNX3) increased miR-30a expression in BGC-823 and SGC-7901 cells. [score:3]
Two mutations were generated at the predicted miR-30a binding sites located in the vimentin 3′ UTR. [score:2]
To further determine whether miR-30a directly targets vimentin mRNA in gastric cancer cells, we inserted the full-length 3′ UTR of vimentin into the pMIR-REPORT luciferase vector (pMIR-Vim; Fig.   6C) and investigated the effect of miR-30a on the luciferase activity of pMIR-Vim. [score:2]
The expression of miR-30a was reduced in 43/55 (78.2%) of the gastric cancer samples as compared with the surrounding normal mucosa (Fig.   8D). [score:2]
To investigate whether miR-30a regulates the expression of vimentin, we transfected gastric cancer cells with miR-30a mimics and detected the protein and mRNA levels of vimentin. [score:2]
Two miR-30a complementary sites with the sequence GTTTAC in the 3′ UTR were mutated to remove complementarity with miR-30a by use of a QuikChange site–directed mutagenesis kit with pMIR-Vim/wt as the template. [score:2]
As well, miR-30a could directly bind to the 3′ UTR of vimentin, which is consistent with the results of Cheng et al. 38 in breast cancer. [score:2]
Only miR-30a was significantly activated by RUNX3. [score:1]
Therefore, the second region of the 3′ UTR of vimentin is important for miR-30a binding. [score:1]
The luciferase activity was significantly reduced in the presence of miR-30a with pMIR-Vim/mut1 but not pMIR-Vim/mut2 (Fig.   6D). [score:1]
Correlation analyses of RUNX3, miR-30a and vimentin in GC samples were made using linear regression. [score:1]
showed that RUNX3 and miR-30a levels were highly correlated in gastric cancer samples (P < 0.0001; Fig.   8E). [score:1]
Next, we investigated whether miR-30a affected the expression of vimentin. [score:1]
In gastric cancer patients, levels of RUNX3 were positively correlated with miR-30a and negatively associated with vimentin. [score:1]
miR-30a significantly reduced the activity of the luciferase reporter of pMIR-Vim (Fig.   6D). [score:1]
[1 to 20 of 48 sentences]
8
[+] score: 208
Furthermore, inhibition of PI3K expression at the time of reperfusion abrogated p-Akt expression and the anti-autophagy effect of miR-30a induced by Sal B. Taken together, these data demonstrate that Sal B can alleviate I–R-injured myocardial cells through miR-30/PI3K/Akt pathway -mediated suppression of autophagy. [score:9]
Given the increase in miR-30a expression by Sal B, we next observed that Sal B could suppress beclin-1 expression, suggesting inhibition of autophagy. [score:9]
After transferring a miR-30a inhibitor into the myocardium to “silence” expression of endogenous miR-30a, beclin-1 expression was increased, suggesting that miR-30a can protect myocardial cells through suppression of autophagy. [score:9]
miR-30a expression was down-regulated remarkably in I–R cells, and this suppression could be reversed by Sal B in a dose -dependent manner. [score:8]
Upregulation of endogenous miR-30a expression induced by Sal B can alleviate I–R -induced myocardial autophagy, and the mechanism of action could involve regulation of the PI3K/Akt signaling pathway. [score:7]
Overexpression of miR-30a could further increase expression of p-Akt to 226.253 ± 20.50 % and reduce beclin-1 expression to 45.505 ± 6.91 %. [score:7]
Inhibition of PI3K expression abrogates protection by Sal B -induced miR-30a expression. [score:7]
Taken together, we deduced that Sal B protects cardiomyocytes through miR-30a upregulation -mediated inhibition of autophagy. [score:6]
In contrast, using quantitative real-time RT-PCR analyses, we found that miR-30a expression was down-regulated by I–R at 2, 6 and 24 h in a time -dependent manner. [score:6]
Sal B could reduce beclin-1 expression, and miR-30a mimics reduced beclin-1 expression further. [score:5]
The results presented here indicate that the potential signal pathway of Sal B inhibited miR-30a mediated cardioprotection might be achieved by targeting PI3K/Akt signaling pathway. [score:5]
Fig. 5Modulations of expression of beclin-1 protein (a) and p-Akt (b) protein in mouse cardiomyocytes treated by miR-30a and the PI3K inhibitor LY294002 as determined by western blotting. [score:5]
It has been reported that PI3K catalytic subunit delta is a direct target of miR-30a because miR-30a binds directly to the 3′-UTR of PI3K catalytic subunit delta mRNA [19]. [score:5]
MiR-30a expression decreases in myocardial cells with an I–R mo del and Sal B increases miR-30a expression. [score:5]
The inhibition of autophagy induced by Sal B was induced by increases in miR-30a expression. [score:5]
Ischemic heart disease Salvianolic acid B Autophagy miR-30a Despite optimal treatment, ischemic heart disease - is the leading cause of death worldwide [1], and the second leading cause of cardiovascular death in China [2]. [score:5]
Fig. 4Sal B reduces the expression of beclin-1, which is reversed by a miR-30a inhibitor. [score:5]
After transferring a miR-30a inhibitor or the scramble sequence into cardiomyocytes, we found that the miR-30a inhibitor (but not the scramble sequence) could attenuate Sal B -induced cardioprotection against the autophagy induced by simulated I–R injury. [score:5]
When the PI3K inhibitor LY294002 was added into the system, beclin-1 expression was increased, suggesting that it abrogated the cardioprotective properties of miR-30a against I–R. [score:5]
Knockdown of miR-30a with a miR-30a inhibitor could reverse the anti-autophagy effect of Sal B against I–R injury. [score:4]
In diseases of the cardiovascular system, miR-30a plays an important part in regulation of autophagy through beclin-1 protein during myocardial injury induced by angiotensin II [32]. [score:4]
From the viewpoint of autophagy,this study demonstrated (indirectly) that a PI3K inhibitor could abrogate the cardioprotective properties of miR-30a. [score:4]
Studies have shown that miR-30a can negatively regulate expression of the beclin-1 gene, resulting in decreased autophagic activity in cancer cell lines such as T98G, MDA-MB-468 and H1299 [16]. [score:4]
These data suggested that Sal B -mediated miR-30a expression might protect myocardial cells against I–R injury, probably through regulation of autophagy. [score:4]
However, compared with the Sal B group, beclin-1 expression in the Sal B with a miR-30a inhibitor group increased by 49.8 %, whereas the scramble sequence had no significant effect on Sal B -induced cardiac protection against autophagy. [score:4]
Several studies have focused on miR-30a target genes and their involvement in pathophysiologic processes. [score:3]
This study was designed to ascertain if miR-30a is involved in the cardioprotective actions of salvianolic acid B (Sal B) against myocardial ischemia–reperfusion (I–R) injury through suppression of autophagy. [score:3]
Circulating miR-30 has been shown to be positively associated with left ventricular wall thickness, and regarded to be an important marker for the diagnosis of left ventricular hypertrophy due to miR-30a -induced alterations in expression of the beclin-1 gene and autophagy in cardiomyocytes [8]. [score:3]
Furthermore, we confirmed that Sal B has a protective role in miR-30a -mediated autophagy through the PI3K/Akt signaling pathway, which was abrogated by the PI3K inhibitor LY294002. [score:3]
b Sal B increases miR-30a expression in a dose -dependent manner. [score:3]
However, the PI3K inhibitor LY294002 could abrogate the cardioprotection of miR-30a against I–R. [score:3]
This finding suggested that reperfusion could suppress the miR-30a level (i. e., a high level of autophagy). [score:3]
A double-stranded pre-miR-30a mimic and a single-strand inhibitor were obtained from GenePharma (Shanghai, China). [score:3]
Sal B -mediated anti-autophagy effect on cardiac cells is reversed by a miR-30a inhibitor. [score:3]
Murine myocardial cells that had undergone primary culture were induced by I–R and incubated with Sal B (25, 50, 100 μM) in the presence of a miR-30a mimic or miR-30a inhibitor. [score:3]
miR-30a expression has been reported to be increased in cultured myocardial cells [6] and in circulating plasma from patients with acute myocardial infarction [33]. [score:3]
miR-30a inhibitor (100 nmol/L), miR-30a mimics (100 nmol/L) or negative control (100 nmol/L) were transfected into myocardial cells for 24 h using siRNA-MATE (GenePharma) according to manufacturer instructions. [score:3]
but few studies have focused on the mechanism of action of miR-30a in the cardioprotective effects of Sal B. We hypothesized that Sal B may have a more important role in cardiovascular disease than currently thought. [score:3]
Other Studies also reported that miR-30a was found to be one of the differentially expressed miRNAs involved in cardiovascular pathophysiology [6– 9]. [score:3]
In summary,both miR-30a and Sal B have a close relationship with cardiovascular disease through autophagy. [score:3]
The present study is the first to demonstrate that miR-30a expression can be mediated by Sal B, which plays an important in protection against cardiac I–R injury in vitro. [score:3]
Expression of miR-30a, beclin-1, LC3-II and p-Akt protein, cell viability, and lactic acid dehydrogenase (LDH) release were assessed. [score:3]
It has been demonstrated that miRNA-30a can bind directly with the 3′-UTR of beclin-1 mRNA and promote degradation of its mRNA [34]. [score:2]
2014.5909 25203395 7. Yang Y, Li Y, Chen X, Cheng X, Liao Y, Yu X. Exosomal transfer of miR-30a between c ardiomyocytes regulates autophagy after hypoxia. [score:2]
In summary, our data suggest that miR-30a has a vital role in Sal B -induced cardioprotection. [score:1]
Hence, to examine the involvement of the miR-30a/PI3K/Akt pathway in ischemic cardiovascular injury and the potential protective effect of Sal B in terms of autophagy, we used an in vitro mo del of I–R to observe the effect of Sal B. Reagents associated with cell culture were obtained from Invitrogen (Carlsbad, CA, USA). [score:1]
These data suggest that miR-30a is involved in Sal B -mediated cardioprotection against I–R injury through the PI3K/Akt signaling pathway. [score:1]
Cell culture and miR-30a transfection. [score:1]
In recent years,the close relationship between miR-30a and autophagy has been observed. [score:1]
Real-time PCR was first conducted to disclose the difference in miR-30a level between normal cultured cells and ischemic myocardial cells. [score:1]
Next, we wished to ascertain if miR-30a was involved in the Sal B -mediated anti-autophagy effects on cardiomyocytes. [score:1]
Pre-miR-30a is chemically modified to guide the selection and stability of strands. [score:1]
Specifically, the miR-30a level in myocardial cells subjected to I–R for 24 h appeared to decrease significantly. [score:1]
Fig. 1 a MicroRNA-30a (miR-30a) level decreases in myocardial cells with I–R injury detected by real time-polymerase chain reaction (RT-PCR). [score:1]
Consequently, this study will continue to identify the role of the PI3K/Akt signaling pathway in miR-30a -mediated autophagy after I–R injury in future studies. [score:1]
[1 to 20 of 55 sentences]
9
[+] score: 199
Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation. [score:12]
The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene. [score:10]
shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c). [score:9]
a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells. [score:9]
Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d). [score:8]
Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells. [score:7]
Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells. [score:6]
To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv. [score:5]
The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation. [score:5]
As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells. [score:5]
Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest. [score:5]
However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30. [score:5]
In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15]. [score:5]
Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15]. [score:5]
Radiation -induced Mcl-1 downregulation was miRNA-30 dependent. [score:4]
Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b. [score:4]
In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells. [score:4]
Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c). [score:3]
The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21]. [score:3]
b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection. [score:3]
Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15]. [score:3]
de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene. [score:3]
Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation. [score:3]
irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15]. [score:3]
However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood. [score:3]
Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14]. [score:3]
d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells. [score:3]
As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter. [score:3]
CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co. [score:3]
However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
In contrast, Bcl-2 expression was not affected by miR-30 in these cells. [score:3]
Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells. [score:2]
In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation. [score:2]
In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation. [score:2]
A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated. [score:2]
Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14]. [score:2]
Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown. [score:1]
β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation. [score:1]
c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated. [score:1]
NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc. [score:1]
There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c. [score:1]
The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d. [score:1]
The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells. [score:1]
Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure. [score:1]
[1 to 20 of 53 sentences]
10
[+] score: 198
The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point. [score:9]
We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e). [score:9]
To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists). [score:9]
Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS. [score:6]
Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:6]
We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases. [score:6]
We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e). [score:6]
” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9. [score:6]
We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium. [score:5]
Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. [score:5]
miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium. [score:5]
Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2). [score:5]
FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium. [score:5]
This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d). [score:5]
To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels. [score:4]
Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein. [score:4]
Up-regulation of miR-30 family members in myoblasts promotes differentiation (53). [score:4]
Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway. [score:4]
Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection. [score:4]
d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels. [score:4]
FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression. [score:4]
We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35). [score:4]
In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust. [score:4]
Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression. [score:4]
Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease. [score:3]
However, the predicted miR-30 target site in UBE3A is human-specific. [score:3]
miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation. [score:3]
Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard. [score:3]
Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
Chang T., Xie J., Li H., Li D., Liu P., and Hu Y. (2016) MicroRNA-30a promotes extracellular matrix degradation in articular cartilage via downregulation of Sox9. [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
At 24 h post-transfection, predicted miR-30 target sites were not enriched. [score:3]
FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation. [score:3]
FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway. [score:3]
Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses. [score:3]
To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:3]
This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b). [score:2]
Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well. [score:2]
Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. [score:2]
f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium. [score:2]
Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54). [score:2]
To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”). [score:2]
Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study. [score:2]
Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway. [score:2]
In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation. [score:2]
Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52). [score:2]
Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation. [score:2]
Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium. [score:2]
More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells. [score:2]
Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation. [score:2]
To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells. [score:1]
To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor. [score:1]
Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members. [score:1]
LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family. [score:1]
[1 to 20 of 55 sentences]
11
[+] score: 148
To further validate that lincRNA-p21 regulates TGFβ/Smad signaling through interacting with miR-30, we co -transfected lincRNA-p21 siRNA with miR-30 antagomir, showing that lincRNA-p21 siRNA failed to reduce KLF11 expression and suppress TGFβ/Smad signaling when miR-30 was inhibited (Fig.   7G). [score:8]
In our previous study, we found that miR-30 blunted TGF-β/Smad signaling in HSCs by targeting KLF11, which suppressed the transcription of inhibitory Smad7 in TGF-β/Smad pathway [31]. [score:7]
The luciferase activity increased in response to pCI-lincRNA-p21 in a dose -dependent manner, suggesting that ectopically expressed lincRNA-p21 sequestered endogenous miR-30 and prevented it from suppressing luciferase expression (Fig.   2E). [score:7]
We reasoned that, if hepatocyte lincRNA-p21 regulates liver fibrosis by interacting with miR-30, inhibition of miR-30 would show inhibitory effects on the protective function of AdH-shlincp21 in liver fibrosis. [score:6]
Here, we further revealed that the inhibition of KLF11 by miR-30 resulted in the upregulation of Smad7 in hepatocytes (Fig.   7A). [score:6]
Consistent with the histology results, hepatic expression of inflammatory genes, including interleukin-6 (IL-6), chemokine ligand 2 (CCL2) and IL-1β, were suppressed in AdH-miR-30 group (Fig.   3F). [score:5]
Ectopic expression of miR-30 greatly inhibited CCl [4] -induced liver fibrosis as observed by histological examination (Fig.   3A), and significantly decreased collagen deposition and hepatic hydroxyproline level (Fig.   3B). [score:5]
Collectively, these results provide convincing evidence that miR-30 can suppress TGF-β/Smad signaling by targeting KLF11 in hepatocyte. [score:5]
To ascertain the underlying mechanism responsible for miR-30 decrease in response to TGFβ, we determined the expression of pri-miR-30s in TGFβ -treated AML12 cells, showing that TGFβ didn’t obviously suppress the transcription of pri-miR-30s (Supplementary Figure  S4C). [score:5]
Here, our results demonstrate that hepatocyte miR-30 greatly inhibits fibrotic TGF-β/Smad signaling by targeting KLF11 and consequently prevents liver fibrosis. [score:5]
Figure 5Inhibition of miR-30 impairs the effects of lincRNA-p21 knockdown on CCl [4] -induced liver fibrosis. [score:4]
Here, we provide the first evidence that TGF-β -induced lincRNA-p21 inhibited miR-30 by directly binding to them. [score:4]
We previously found that hepatic miR-30s decreased in the fibrotic liver and HSC-specific upregulation of miR-30 prevented liver fibrosis [31]. [score:4]
The presence of competitive miR-30 antagomir abolished the inhibitory effects of lincRNA-p21 knockdown on TGF-β signaling and liver fibrogenesis, indicating that lincRNA-p21 functions as a ceRNA. [score:4]
The expression of hepatic profibrogenic markers (α-SMA, Col1a1, TGF-β1, CTGF and TIMP-1) also significantly increased in anti-miR-30 group (Fig.   5C). [score:3]
In contrast, miR-30 antagomir inhibited endogenous miR-30 and increased the luciferase activity (Fig.   2D). [score:3]
The suppression of luciferase activity by lincRNA-p21 siRNA was reversed by miR-30 antagomir (Supplementary Figure  S5C). [score:3]
AdH-miR-30 could significant increased miR-30b expression in AML12, but not in the cultured HSC cell line HSC-T6 (Supplementary Figure  S2B). [score:3]
Basing on these results, we propose that TGF-β -induced lincRNA-p21 in turn strengthens TGF-β signaling by interacting with miR-30, thus forming a positive feedback loop to ensure lincRNA-p21 expression and mediate the role of TGF-β in promoting liver fibrosis. [score:3]
Hepatocyte miR-30 inhibits liver fibrosis. [score:3]
Notably, TGF-β1, Col1a1 and tissue inhibitor of metalloproteinase-1 (TIMP-1) were also greatly reduced in the AdH-miR-30 -injected mice. [score:3]
Moreover, miR-30b expression increased in the hepatocytes of AdH-miR-30 -injected mice, but not in the HSCs (Fig.   3D). [score:3]
To test this, we constructed adenovirus AdH-miR-30 and AdH-NC that can specifically express miR-30b or control in hepatocyte in vivo under the control of albumin promoter. [score:3]
AML12 cells were transfected with lincRNA-p21 siRNA for 24 h and then treated with TGF-β1 for 2 h. (G) Inhibition of miR-30 impairs the effects of lincRNA-p21 siRNA on TGF-β/Smad signaling. [score:3]
To examine the interactions between lincRNA-p21 and miR-30, the nontumorigenic mouse hepatocyte cell line AML12 were transiently transfected with the expression plasmid pCI-lincRNA-p21 that contains the murine lincRNA-p21 cDNA. [score:3]
However, in anti-miR-30 group, AdH-shlincp21 failed to exert the inhibitory effects (Fig.   5A and B). [score:3]
In the isolated hepatocytes from fibrotic liver injected with AdH-miR-30, ectopic expression of miR-30b led to decrease of KLF11 and increase of Smad7 in hepatocyte in vivo (Fig.   7A). [score:3]
In the present study, we find that hepatocyte lincRNA-p21 can function as a ceRNA by binding miR-30, and therefore participating in the regulation of TGF-β signaling and liver fibrosis. [score:2]
Hepatocyte lincRNA-p21 regulates liver fibrosis through interacting with miR-30. [score:2]
To date, the mechanism of miR-30 deregulation in various states is mostly unknown. [score:2]
To test our hypothesis, anti-miR-30, a phosphorothioate -modified antisense oligonucleotides specific for miR-30, and scrambled control (SCR), were intravenously injected into CCl [4] -treated mice weekly during the liver fibrosis development. [score:2]
However, the injection of miR-30 antisense oligonucleotides decreased miR-30b in the hepatocyte (Fig.   5F). [score:1]
Meanwhile, pCI-lincRNA-p21Mut, in which the predicted miR-30 binding site was mutated, failed to increase the luciferase activity (Fig.   2E). [score:1]
Collectively, our results suggest that hepatocyte lincRNA-p21 contributes to liver fibrosis by interacting with miR-30. [score:1]
miR-30 enrichment was determined by qRT-PCR and normalized to control. [score:1]
Moreover, the transcribing of pri-miR-30 wasn’t affected by TGF-β, and thus strongly suggesting the underlying mechanism responsible for miR-30 decrease in response to TGF-β. [score:1]
The increase of lincRNA-p21 in hepatocyte was associated with the loss of miR-30 during liver fibrosis. [score:1]
Figure 2LincRNA-p21 interacts with miR-30. [score:1]
de/rnahybrid/) further revealed a healthy minimum free energy of hybridization between lincRNA-p21 and miR-30 family members (Supplementary Figure  S1A). [score:1]
However, at this stage, we can’t exclude the possibility that the decrease of miR-30 may be triggered by other mechanisms in liver fibrosis. [score:1]
Notably, increased infiltration of macrophages was limited in AdH-miR-30 group mice (Fig.   3E). [score:1]
The specific association between miR-30 and lincRNA-p21 was also validated by affinity pull-down of miR-30. [score:1]
To confirm the interaction between lincRNA-p21 and miR-30, we inserted the lincRNA-p21 cDNA downstream of the firefly luciferase reporter gene. [score:1]
Two days before the first injection of CCl [4], AdH-miR-30 or AdH-NC was injected into mice via tail vein. [score:1]
Left, AML12 were transfected with miR-30b mimics for 24 h. Right, primary hepatocytes were isolated from fibrotic liver injected with AdH-NC or AdH-miR-30. [score:1]
Thus, we hypothesized that hepatocyte lincRNA-p21 and miR-30 are inversely associated and involved in liver fibrosis. [score:1]
Transfection of miR-30 greatly decreased the luciferase activity of the wild type reporter with normal binding sites for miR-30, but not that with the mutant binding sites. [score:1]
Notably, we have previously reported that TGF-β1 reduced miR-30 in hepatocyte [35]. [score:1]
Moreover, the miR-30s in the isolated hepatocytes from AdH-shlincp21 group mice significantly increased, suggesting that AdH-shlincp21 might prevent liver fibrosis by increasing miR-30 in hepatocyte (Fig.   4F). [score:1]
Figure 7LincRNA-p21 enhances TGF-β/Smad signaling in hepatocyte by interacting with miR-30. [score:1]
Thus, TGFβ -induced lincRNA-p21 might be responsible for the decrease of miR-30. [score:1]
These phenomena depend on the interaction between lincRNA-p21 and miR-30. [score:1]
Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-shlincp21 and SCR (AdH-shlincp21 + SCR, n = 6) and CCl [4] in combination with injection of AdH-shlincp21 and anti-miR-30 (AdH-shlincp21 + anti-miR-30, n = 6). [score:1]
Administration of AdH-miR-30 led to miR-30b increase in the liver tissue (Fig.   3C). [score:1]
Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-NC (CCl4 + AdH-NC, n = 6) and CCl [4] in combination with injection of AdH-miR-30 (CCl4 + AdH-miR-30, n = 6). [score:1]
Thus, lincRNA-p21 may be able to function as a ceRNA for miR-30. [score:1]
LincRNA-p21 is physically associated with the miR-30. [score:1]
[1 to 20 of 57 sentences]
12
[+] score: 145
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B). [score:7]
miR-30 targets were predicted using TargetScan. [score:5]
These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage. [score:5]
0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells. [score:5]
In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC. [score:5]
mRNA expression patterns of miR-30 targets in mMSC line. [score:5]
Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB). [score:5]
As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal. [score:5]
Expression pattern of miR-30 targets. [score:5]
For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells). [score:4]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
EED, named after embryonic ectoderm development, is another novel target of miR-30. [score:4]
miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts. [score:4]
One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported. [score:3]
List of predicted miR-30 targets. [score:3]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
miR-30a/d/e targets pcgf5 and hnrnpa3 vB as well (Fig 11D). [score:3]
These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c. [score:3]
These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members. [score:3]
Analysis of miR-30 targeting. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
In addition, two putative miR-30 targeting sites on spp1/osteopontin were found. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesis. [score:3]
miR-30 targeting prediction. [score:3]
As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78. [score:3]
0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction. [score:3]
Known target of miR-30. [score:3]
miR-30 targeting in mMSC line. [score:3]
Matching around the 3′ part and intermediate part of miR-30 were tested to those targets. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58). [score:3]
miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis. [score:3]
Prediction of miR-30 targeting. [score:3]
Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction. [score:3]
miR-30a/d/e target hnrnpa3 vB and pcgf5 in osteoblastic and osteocytic stages (D). [score:3]
Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability. [score:2]
As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B). [score:2]
Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2). [score:1]
All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A). [score:1]
0058796.g007 Figure 7(A) List of mature miR-30 family members. [score:1]
These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family. [score:1]
Homologous nucleotides among miR-30a/d/e or between miR-30b/c were shown in bold. [score:1]
Mature miR-30 quantification during osteocytogenesis. [score:1]
In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3). [score:1]
Osteo-induction transiently induces hspa5, eed, ccn1/2/3 and hnrnpa3 vC, thereafter those transcripts are attenuated by miR-30b/c in early stage and by miR-30a/d/e in osteocytic stage (A). [score:1]
These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation. [score:1]
Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family. [score:1]
Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis. [score:1]
WD protein associated, miR-30-specificity. [score:1]
Osteo-inductive stimulation transiently induces hspa5, eed, ccn1/2/3 and hnrnpa3 vC, but thereafter those transcripts are attenuated by miR-30b/c at the early stage and by miR-30a/d/e during the osteocytic stage (Fig 11A). [score:1]
We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation. [score:1]
Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541. [score:1]
[1 to 20 of 51 sentences]
13
[+] score: 132
To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B). [score:8]
DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum. [score:6]
Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells. [score:6]
DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum. [score:6]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells. [score:5]
These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines. [score:5]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells. [score:5]
In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown). [score:5]
In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells. [score:5]
In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells. [score:4]
To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression. [score:4]
We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells. [score:4]
Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33]. [score:4]
IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β. [score:3]
NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells. [score:3]
DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice. [score:3]
Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C). [score:3]
Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation. [score:3]
Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells. [score:3]
Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells. [score:3]
Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression. [score:3]
DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation. [score:3]
We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4]. [score:3]
Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation. [score:3]
DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling. [score:3]
We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression. [score:3]
NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells. [score:3]
shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells. [score:3]
Modulation of miR-30 expression with IL-1β neutralizing antibody. [score:3]
Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment. [score:3]
It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells. [score:3]
DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells. [score:3]
Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI. [score:1]
In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells. [score:1]
This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum. [score:1]
In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells. [score:1]
We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown). [score:1]
Reverse transcription (RT) was performed using TaqMan miRNA RT Kits (Applied Biosystems, Foster City, CA) in triplicate according to the manufacturer’s instructions, and the resulting cDNAs of miR-30a,-30b, -30c, 30d and 30e were quantitatively amplified on an IQ5 (Bio-Rad) Real-Time PCR System. [score:1]
We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types. [score:1]
These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals. [score:1]
[1 to 20 of 40 sentences]
14
[+] score: 80
miR-30a mimics could reduce the expression of TMED2 and IGF1R (Figure 4E; P<0.05), whereas miR-30a inhibitor could elevate the expression of these genes (Figure 4F; P<0.05). [score:7]
Interestingly, bioinformatics analyses showed that TMED2 and IGF1R are predictive targets of miR-30a (Targetscan). [score:5]
miR-30a regulated S KOV3 cellular proliferation, migration and invasion through directly targeting TMED2. [score:5]
miR-30a regulated PI3K/AKT pathway by directly target IGF1R in non-small cell lung cancer [25]. [score:5]
In contrast, no significant suppression of luciferase activity was detected in cells transfected with the control vector with mutant TMED2 and IGF1R 3' UTR when miR-30a expression was elevated (Figure 4D; P<0.05). [score:5]
We constructed a vector to determine whether miR-30a can directly target the 3' UTR of TMED2 and IGF1R. [score:4]
Furthermore, we found that TMED2's regulation of IGF1R was eliminated when miR-30a was inhibited (Figure 4G; P<0.05). [score:4]
We also determined that miR-30a regulated proliferate, migration and invasion through targeting TMED2. [score:4]
These data indicate that TMED2 and IGF1R are direct targets of miR-30a. [score:4]
TMED2 served as a competing endogenous RNA (ceRNA) to regulate the expression of IGF1R through competing for miR-30a. [score:4]
Our study also found that IGF1R is a directly target of miR-30a. [score:4]
Our results showed that miR-30a mimics significantly suppressed luciferase activity of the reporter vector. [score:3]
miR-30a mimics inhibited the malignant behavior in ovarian carcinoma S KOV3 cells. [score:3]
Thus, we attempted to experimentally verify whether miR-30a modulated TMED2 and IGF1R expressions in S KOV3 cells. [score:3]
So, we investigated whether miR-30a regulated the malignant behavior through targeting TMED2 in S KOV3 cells. [score:2]
Our results also demonstrate that TMED2 can regulate IGF1R in a miR-30a -dependent manner (Figure 9). [score:2]
miR-30a can regulate malignant behavior in ovarian cancer [24]. [score:2]
MiR-30a suppresses tumor metastasis and proliferate in many cancers [21– 23]. [score:2]
Our results indicate that TMED2 and IGF1R regulate each other through competition for miR-30a. [score:2]
TMED2 regulation of IGF1R is miR-30a dependent. [score:2]
These data indicate that TMED2's regulation of IGF1R is miR-30a dependent. [score:2]
Ovarian cancer S KOV3 cells were transfected with NC(negative control), miR-30a mimics or LV5-TMED2 + miR-30a mimics. [score:1]
Figure 7Ovarian cancer S KOV3 cells were transfected with NC(negative control), miR-30a mimics or LV5-TMED2 + miR-30a mimics. [score:1]
The fold changes of the relative luciferase activity in miR-30a mimics with the indicated plasmids transfected cells were normalized to NC with the corresponding indicated plasmid -transfected cells. [score:1]
S KOV3 cells were cotransfected with miR-30a mimics or control RNA (NC) with luciferase reporter plasmids containing either wild-type (pMIR-TMED2-3UTR and pMIR-IGF1R-3UTR) or mutant 3' UTR (pMIR-TMED2-3UTRm and pMIR-IGF1R-3UTRm) of TMED2 and IGF1R genes. [score:1]
miR-30a mimics were synthesized at Ruibo Biotech (Ruibo Biotechnology, Guangzhou, China). [score:1]
Bioinformatics predicted that there was a miR-30a binding site in the 3' UTR of TMED2 and IGF1R mRNAs (Figure 4D). [score:1]
[1 to 20 of 27 sentences]
15
[+] score: 74
Here we confirmed that Mtdh represents a target of mi-R30s in DN, and that the expression of all five miR-30 family members is downregulated in the glomeruli form streptozotocin -induced diabetic rats and HG -induced MPC5 cells. [score:8]
Mtdh protein expression was shown to be increased as well after the treatment with the miR-30 inhibitors (Figure 6e), whereas miR-30 mimics significantly reduced Mtdh expression in HG -induced MPC5 cells (Figure 6f). [score:7]
[28] Liu et al. [40] suggested that MTDH can induce EMT in human non-small cell lung cancer through the regulation of miR-30a activity, whereas He et al. [41] showed that miR-30a-5p suppresses the proliferation of hepatocellular carcinoma cells and enhances their apoptosis by targeting MTDH. [score:6]
To assess the effects of miR-30s on the expression of Mtdh, we transiently transfected MPC5 cells with miR-30 inhibitors, synthetic miRNA mimics, or their NCs. [score:5]
As shown in Figures 6a and b, transient transfection of MPC5 cells with miR-30a inhibitor resulted in significant reduction of miR-30a expression, and miR-30a mimic treatment considerably increased miR-30a levels. [score:5]
Furthermore, miR-30 inhibitors significantly increased the expression of Bax and cleaved caspase 3 (Figure 7c). [score:5]
The obtained results demonstrated that miR-30a, -30b, -30c, -30d, and -30e mimics can significantly inhibit the luciferase activity of the wild-type Mtdh 3′-UTR reporter, but not that of the NC, and that this inhibition was reduced when the mutant reporter, with mutated miR-30 -binding site, was used (Figures 5d–h). [score:5]
Transient transfections with siRNAs, Mdth overexpression vector, miR-30 inhibitors, and miR-30 mimics. [score:5]
These cells were transfected with Mtdh siRNA (50 nM; GenePharma, Shanghai, China) or the overexpression (500 ng per well, GenePharma) the mixture of the mimics or inhibitors (RiboBio, Guangzhou, China) of all five miR-30 family members at the final concentrations of 50 nM, using Lipofectamine 2000 (Invitrogen) for 6 h in OPTI-MEM (Gibco BRL), according to the manufacturers' instructions. [score:5]
Mtdh represents a direct target of the members of miR-30 family. [score:4]
Mtdh mRNA level was shown to be significantly increased following the treatment with miR-30 inhibitors (Figure 6c), whereas miR-30s mimics led to a considerable reduction of Mtdh expression induced by HG (Figure 6d), compared with the corresponding NC treatment groups. [score:4]
Therefore, we studied miR-30 expression in the DN glomeruli and HG -induced MPC5 cells. [score:3]
Afterward, OPTI-MEM was replaced with the complete medium containing 1% FBS, and treated with HG for 48 h after the transfection with siRNAs or mimics, whereas the cells treated with miR-30 inhibitors were not treated with HG. [score:3]
MPC5 were transfected with miR-30 inhibitors, mimics, or the respective NCs. [score:3]
analysis demonstrated that the transfection of cells with miR-30 inhibitors significantly increased the percentage of apoptotic cells compared with the NC group (Figure 7a). [score:2]
A study by Li et al. [27] showed that miR-30a-5p induced liver cancer cell apoptosis via the MTDH/PTEN/AKT pathway. [score:1]
[44] The 3′-UTR of Mtdh containing putative miR-30 -binding sites was amplified and cloned into PmiR-RB-REPORT dual-luciferase reporter vector (RiboBio). [score:1]
The treatment with miR-30 mimics considerably decreased HG -induced increase in the levels of these proteins (Figure 7d). [score:1]
Conversely, miR-30 mimics considerably reduced the rate of MPC5 apoptosis induced by HG (Figure 7b). [score:1]
[1 to 20 of 19 sentences]
16
[+] score: 63
Among the differentially expressed miRNAs, members of miRNA-30 family (miRNA 30a, b, c, d, and e) were chosen for further studies as they have been found to be: (a) upregulated significantly (fold change ranging from 1.15–1.52) in NSCs from embryos of diabetic pregnancy (Supplementary Table 4); (b) involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015). [score:7]
MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer. [score:7]
In the present study, miRNA-30 family was found to be up regulated in NSCs from diabetic pregnancy when compared to control, suggesting that maternal diabetes alters the expression of miRNA-30 family and its target genes, which may perturb brain development in offspring of diabetic mothers. [score:6]
In addition, miRNA-30d expression levels are found to be affected in brains of female schizophrenic patients (Mellios and Sur, 2012), thus emphasizing the importance of miRNA-30 family in brain development and disease. [score:6]
In addition, we found that hyperglycemia increased the expression of miRNA-30 family, in particular miRNA-30b that altered NSC differentiation via down regulation of its target, Sirt1 in NSCs. [score:6]
miRNA-30 family is found to have diverse functions in the brain during development and disease, with well-known roles in regulating epithelial-to-mesenchymal transition (EMT) (Kumarswamy et al., 2012). [score:5]
Members of the miRNA-30 family i. e., miRNA-30a and miRNA-30d, are enriched in layer III pyramidal neurons and have been shown to target BDNF during development (Mellios and Sur, 2012). [score:4]
Among the differentially expressed miRNAs in NSCs from diabetic pregnancy, the miRNA-30 family has been proposed to play critical role in maternal diabetes -induced neural tube anomalies as it has been shown to be involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015). [score:4]
One of the miRNA-30 family members, miRNA-30b is found to target Sirt1 which belongs to the Sirtuin family of proteins with seven members of the family being reported to exist in mammals. [score:3]
Figure 5 (A) qRT-PCR showing the expression pattern of miRNA-30 family. [score:3]
2017.00237/full#supplementary-material Supplementary Figure 1 Gene targets of miR-30 family are depicted. [score:3]
Gene targets of the miRNA-30 family were predicted using IPA (Supplementary Figure 1). [score:3]
Further, quantitative RT-PCR analysis was performed to validate the expression levels of miRNA-30 family (miRNA-30 b, c, d, and e) in NSCs from embryos of diabetic and control pregnancy. [score:3]
miRNA-30 family and brain development. [score:2]
Supplementary Table 4Fold change and p-value of miRNA-30 family. [score:1]
[1 to 20 of 15 sentences]
17
[+] score: 56
Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10]. [score:6]
These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector. [score:6]
Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17]. [score:6]
The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21]. [score:5]
As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%. [score:5]
Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector. [score:5]
To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b). [score:5]
As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript. [score:3]
Expression of NP miRNA from the mouse miR30 -based lentiviral vector. [score:3]
Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16]. [score:3]
In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19]. [score:2]
In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells. [score:2]
A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18]. [score:2]
Flanking and hairpin sequences are miR30. [score:1]
0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector. [score:1]
Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells. [score:1]
[1 to 20 of 16 sentences]
18
[+] score: 50
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
We have further shown that HDI, such as VPA and butyrate, inhibit AID and Blimp1 expression by upregulating miR-155, miR-181b, and miR-361, which silenced AICDA/Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silenced PRDM1/Prdm1 mRNA (16). [score:8]
Figure 8The Prdm1 targeting miRNAs miR-23b, miR-125a, miR-351, miR-30a/c/d, miR-182, miR-96, miR-98, miR-200b/c, and miR-365 are upregulated by HDI. [score:6]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
We have shown by qRT-PCR that miR-23b, miR-30a, and miR-125b, which silence Blimp-1 by targeting Prdm1 3′ UTR, were significantly upregulated by HDI (16). [score:6]
Some miRNAs, including miR-155, miR-181b, and miR-361, can silence AID expression, whereas miR-30a and miR-125b can silence Blimp-1 expression (16). [score:5]
All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes. [score:1]
The miR-30 family members are similar to each other and have identical seed sequences. [score:1]
Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8). [score:1]
[1 to 20 of 11 sentences]
19
[+] score: 42
In summary, we have established a mouse strain that expresses a tet-regulatable, miR30 -based shRNA targeting the Cox2 transcript, and have demonstrated reversible and functional DOX -mediated suppression of Cox2 gene expression. [score:10]
The targeting vector, pCol-TGM, contains a GFP open reading frame immediately downstream of the TRE promoter, followed by the miR30 -based shRNA expression cassette. [score:5]
To identify appropriate shRNAs, each cloning template containing a COX-2 shRNA sequence was ligated into LMP, a retroviral miR30-shRNA expression vector in which miRNA -based shRNA (shRNAmir) expression is driven from the viral 5′LTR promoter (Fig. 1A). [score:5]
Using the microRNA30 (miR30) precursor RNA as a template, they substituted miR30 stem sequences with designed shRNAs, and showed effective target gene inhibition [15]. [score:5]
The Cox2.2058 shRNA in the LMP shRNA expression cassette was cloned into the miR30 backbone of this targeting vector at the single XhoI /EcoRI site. [score:5]
pCol-TGM contains a miR30 -based expression cassette regulated by an inducible tetracycline response element (TRE) promoter. [score:4]
The LMP retroviral vector, a murine stem cell virus (MSCV) -based vector contains unique XhoI and EcoRI sites within a miR30-shRNA expression cassette, driven by the viral 5′LTR promoter ([17], [20] and Fig. 1A). [score:3]
These shRNA sequences, and their corresponding sense strand predictions, were synthesized as 97 mers and cloned into the miR30 shRNA backbone as described previously [21]. [score:1]
Appropriate products carrying the XhoI /EcoRI restriction sites at their ends and comprising the common and Cox2-specific stem sequences and the 19 bp loop were used to create miR30-adapted shRNAs. [score:1]
This vector contains an XhoI /EcoR1 cloning site for shRNAs within a miR30 backbone (shRNAmir). [score:1]
These sequences comprise the common and gene-specific stem and 19 bp loop of the miR30-context to create miR30-adapted shRNAs specific for Cox2. [score:1]
Using improved prediction methods for the design of miR30 -based shRNAs [20], we identified four 22-mer guide strand sequences; Cox2.284 (1), Cox2.1082 (2), Cox2.2058 (3) and Cox2.3711 (4) (Fig. 1A), complementary to the Cox2 coding region (1 and 2) or the Cox2 3′-UTR sequence (3 and 4). [score:1]
[1 to 20 of 12 sentences]
20
[+] score: 40
The targets of miRNA-192 and miRNA-30a target were visualized using Cytoscape V2.7. [score:5]
Using target prediction algorithms, we identified the predicted target protein networks of human miRNA-192 and miRNA-30a (Fig.   6a, b). [score:5]
By performing microarray screening on exosomes, we found nine inflammatory miRNAs which were deregulated in sera of chronic alcohol-fed mice compared to controls including upregulated miRNAs: miRNA-192, miRNA-122, miRNA-30a, miRNA-744, miRNA-1246, miRNA 30b and miRNA-130a. [score:4]
The finding of elevated levels of miRNAs species in exosomes after alcohol administration from other tissues such as miRNA-30a, which is highly expressed in heart cells [45], may further demonstrate the effect of alcohol on multiple organs and cell types despite the majority of pathological damage being reported as confined to the liver. [score:3]
a Potential targets of miRNA-30a. [score:3]
Fig.  6Target prediction for miRNA-30a and miRNA-192. [score:3]
Predicted targets of miRNA-30a. [score:3]
However, more data regarding specificity of miRNA-192 and miRNA-30a for alcoholic hepatitis compared to the other types of liver disease, and side by side comparison of those miRNA markers with other markers of liver injury such as ALT should be gathered in future studies. [score:2]
Comparing the miRNA signature of exosomes from alcohol-fed mice with pair-fed mice showed deregulation of nine inflammatory miRNAs including miRNA-122, miRNA-192 and miRNA-30a. [score:2]
miRNA-192, miRNA-122 and miRNA-30a accurately discriminate the alcohol-fed and control mice. [score:1]
Consistent with the highly significant increase of miRNA-122, miRNA-30a, and miRNA-192 (Fig.   4a–c), those miRNAs showed promising diagnostic values. [score:1]
Importantly, of these miRNAs in the cohort of patients with alcoholic hepatitis, we found a significantly elevated level of miRNA-30a and miRNA-192 in the EV-fraction of plasma. [score:1]
miRNA-122 and miRNA-30a showed an AUC of 0.92 (p < 0.001) and 0.85 (p < 0.05), respectively (Table  3; Fig.   4d–f). [score:1]
The ROC analyses indicated excellent diagnostic value of miRNA-192, miRNA-122, and miRNA-30a to identify alcohol -induced liver injury. [score:1]
Curve of receiver operating characteristic (ROC) analysis constructed using differentially expressed d miRNA-122, e miRNA-192, and f miRNA-30a for discriminating alcohol-fed mice versus control mice. [score:1]
Particularly, miRNA-122, miRNA-30a, and miRNA-192 showed the most substantial increases and revealed an excellent diagnostic value for differentiating alcohol-fed mice versus pair-fed mice. [score:1]
Consistently, miRNA-30a and miRNA-192 were increased significantly in exosomes isolated from plasma of alcoholic hepatitis patients. [score:1]
Both miRNA-192 and miRNA-30a were significantly increased in the circulation of subjects with AH. [score:1]
e, f Curve of receiver operating characteristic (ROC) analysis constructed for differentially expressed miRNA-30a, miRNA-192, and for discriminating patients with alcoholic hepatitis versus controls (*p < 0.05). [score:1]
[1 to 20 of 19 sentences]
21
[+] score: 38
In total, 114 miRNAs are significantly changed and can be classified into four groups (Figure 2A); 52 miRNAs, including the miR-30 family, are down-regulated during the first 8 days after infection (Figure 2B), 8 miRNAs are down-regulated before day 2 and up-regulated after day 2 after infection (Figure 2C), 2 miRNAs are up-regulated before day 2 and down-regulated after day 2 after infection (Figure 2D), and the remaining 52 miRNAs, including the miR-17 family, are up-regulated (Figure 2E). [score:19]
The combined miRNA expression, miRNA target and signaling pathway assays revealed that the members of the miR-30 family may negatively regulate genes involved in MAPK signaling and adherens junctions [15], whereas the miR-29 family are involved in activating endogenous pluripotent genes such as Oct4 and Nanog by targeting DNMTs [24]– [27]. [score:7]
Among 41 unique miRNA expression signatures for activation of the iPS reprogramming process, we found 4/6 members of the miR-30 family, that are down-regulated. [score:6]
In the activation step of iPS generation, increased expression of the miR-29 family and decreased expression of the miR-30 family are essential. [score:5]
Two mean signal intensity plots are shown for this group and the miR-30 family. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 33
Conversely, we found that up-regulation of miR-30a-5p, miR-96 and miR-182 at E17.5, and miR-429 at E14.5 were reciprocally correlated with down-regulation of Cpeb3, Sox6, Hdac9, and Ddx3y respectively in Pkd1 [-/- ]mutants (Additional file 21). [score:7]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
For example, miR-30a-5p may be involved in histone deactylase inhibitor pathways, apoptosis, calcium and Wnt signaling (Figure 9); miR-10a may be involved in TGF-β and hedgehog signaling; miR-204 may be involved in calcium signaling while miR-488 may be involved in MAPK signaling by targeting Fgfr3 (Figure 9). [score:5]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
In contrast, at E17.5 miR-96, miR-182 and miR-30a were up-regulated in Pkd1 [-/- ]kidneys compared to WT. [score:3]
[1 to 20 of 7 sentences]
23
[+] score: 33
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
Constructs expressing miR-30a from the miR-30c locus and miR-125b from the miR-125a locus were also made, in an effort to control for processing efficiency. [score:3]
However, miR-30a was only expressed from its endogenous locus (Supplementary Fig. 10). [score:3]
We examined miR-30a, miR-30c and miR-125a targets sites predicted to form more stable pairing with a specific paralogue and which were ligated to only that paralogue in at least two experiments. [score:3]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d). [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
An exception was an 8mer mismatch miR-30c site with G–U wobble pairing at miRNA position 3, which showed similar repression by both miR-30a and miR-30c despite extensive predicted 3′-pairing with miR-30c (Fig. 8i). [score:1]
Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa. [score:1]
An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d). [score:1]
Genomic fragments for miR-125b, miR-30a and miR-30c spanning ∼200 nucleotides upstream and downstream of primary hairpins were synthesized as gBlocks (IDT) and inserted into the SBI vector between EcoRI and BamHI. [score:1]
[1 to 20 of 15 sentences]
24
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
25
[+] score: 29
Samples from left to right: C = control, G12D = G12D knockdown vector (three independent knockdown vectors with different efficiencies; G12D specific knockdown vector with mutated nucleotide at position 2, position 3 and position 6 of the guide strand, respectively), G12V = G12V knockdown vector with mutated nucleotide at position 4 of the guide strand, G12C = G12C knockdown vector with mutated nucleotide at position 3 of the guide strand, G12R = G12R knockdown vector with mutated nucleotide at position 4 of the guide strand, DVR = triple knockdown vectors for G12D, G12V and G12R in miR30a backbone (code named 129), CDV = triple knockdown vectors for G12C, G12D and G12V in miR30a backbone (code named 130), DVR = triple knockdown vectors for G12D, G12V and G12R in miR17-92 backbone (code named 131), CDV = triple knockdown vectors for G12C, G12D and G12V in miR17-92 backbone (code named 132). [score:11]
Samples PANC1 = non-transformed parent PANC-1 cells, Empty vector = non-transformed parent PANC-1 cells transfected with empty vector (pUMVC3 with no insert), Triple DVR (129) = PANC-1 cells transformed with DVR triple knockdown vector in miR-30a backbone (code named 129), Triple CDV (130) = PANC-1 cells transformed with CDV triple knockdown vector in miR-30a backbone (code named 130), Triple DVR (131) = PANC-1 cells transformed with DVR triple knockdown vector in miR-17-92 backbone (code named 131), Triple CDV (132) = PANC-1 cells transformed with CDV triple knockdown vector in miR-17-92 backbone (code named 132), G12V = PANC-1 cells transformed with G12V knockdown vector. [score:6]
S3 Fig A. Expression unit sequence for triple knockdown constructs in miR30a backbone with miR17-92 gap sequence. [score:4]
0193644.g003 Fig 3 A. Schematics shown expression unit sequence arrangement of triple knockdown constructs in either miR30a backbones or miR-17-92 cluster backbones. [score:4]
A. Schematics shown expression unit sequence arrangement of triple knockdown constructs in either miR30a backbones or miR-17-92 cluster backbones. [score:4]
[1 to 20 of 5 sentences]
26
[+] score: 27
MiRNA-30c belongs to the miRNA-30 family, which consists of five members that are ubiquitously expressed, all of which are among the most highly expressed miRNAs in the heart. [score:5]
Since the seed region is identical between members of the miRNA-30 family, it can be expected that there is a substantial overlap in the targets that they regulate. [score:4]
Since we observed no changes in overall mitochondrial morphology in our in vivo mo del, our results contradict the in vitro studies reported by Li et al. who found impaired mitochondrial fission in cultured neonatal cardiomyocytes when overexpressing miRNA-30 [17]. [score:3]
Members of the miRNA-30 family also affect mitochondrial fission and apoptosis in cultured neonatal cardiomyocytes, an effect attributed to miRNA-30c targeting of p53 [17]. [score:3]
In addition, in zebrafish, miRNA-30 overexpression with mimic sequences leads to excessive blood vessel sprouting, showing the ability of this miRNA to induce angiogenesis in vivo. [score:3]
As the miRNA-30 family has five members, of which several have genomic duplications, a genetic knock-out approach is highly impractical. [score:2]
Having generated a stable and specific miRNA-30 overexpression mo del we phenotypically compared wildtype and transgenic hearts. [score:2]
112.267732 12 Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, et al. (2009) miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
However, little is known on the role of the miRNA-30 family in the heart in vivo. [score:1]
As a consequence, functional redundancy is expected between the miRNA-30 family members. [score:1]
Uncovering the exact role of miR30 in vivo is highly relevant as miRNA-30c was identified as the top candidate for inducing cardiomyocyte hypertrophy in an unbiased miRNA mimic screen in neonatal rat cardiomyocytes [13]. [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 26
MiR-30 family members are strongly upregulated during adipogenesis in human cells, and inhibition of miR-30 inhibits adipogenesis [12]. [score:8]
Overexpression of miR-30a and miR-30d stimulates adipogenesis, and it has been demonstrated that miR-30a and miR-30d target RUNX2, a major regulator of osteogenesis and a potent inhibitor of PPARγ, the master gene in adipogenesis [36]. [score:8]
In this study, miR-30a, miR-30b, and miR-30c were significantly downregulated in obese mice, and miR-30b was significantly upregulated after LFD feeding. [score:7]
miR-30 family members have also been demonstrated to act as positive regulators of adipocyte differentiation in a human adipose tissue-derived stem cell mo del [35]. [score:2]
The miR-30 family has been found to be important for adipogenesis [12]. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 25
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
The down-regulation of mmu-miR-30a*, mmu-miR-30e*, mmu-miR-193 and mmu-miR-378 during HFD -induced obesity is consistent with previous studies [19], [37], [50]. [score:4]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
[1 to 20 of 5 sentences]
29
[+] score: 25
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B). [score:1]
Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A). [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR. [score:1]
Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site. [score:1]
The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
[1 to 20 of 17 sentences]
30
[+] score: 22
Interestingly, at all selected sites examined by ChIP-qPCR, histone deacetylation in the HBV-Met cells could be partly restituted via a nucleoside analog reverse transcriptase inhibitor or by anti-HBV miRNA-like molecules mimicking hsa-miRNA-30a, whereas ectopic expression of antiviral shRNA seemed to provoke intolerable off-target effects on the gene expression level. [score:9]
We therefore decided to camouflage the antiviral target sequences as the cell’s own microRNA (miRNA) in similar ways, as miRNA-30-like precursors have been used for the study of gene function before [11] to circumvent a hypothetical cellular response mechanism. [score:3]
Also HBsAg suppression was slightly more efficient, when a miRNA-26-like construct was used, whereby miRNA-122-like and miRNA-30-like constructs exhibited similar efficiency. [score:3]
Eventually we selected a pEPI-U6-miRNA-30-like clone targeting transcripts of HBV ORF X/ORF P for further experiments. [score:3]
To circumvent putative hepatocellular ‘friend or foe’ recognition, we mimicked hsa-miRNA-30-like molecules, which were compared to other miRNA-like constructs for their suppressive potency in prior experiments. [score:2]
The best apparent quality was particularly achieved when the anti-HBV miRNA-like molecules mimicking hsa-miR30a were used. [score:1]
D. in HBV-Met treated with miRNA-30 L-X1 versus untreated HBV-Met. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 21
Other miRNAs from this paper: hsa-mir-30a
Figure 5In Vivo Expression of SOD2 shRNA with Authentic miR30a Structure Did Not Up-Regulate the Expression of OSA1 and STAT1 Levels of the mRNAs were determined by real-time PCR. [score:8]
In Vivo Expression of SOD2 shRNA with Authentic miR30a Structure Did Not Up-Regulate the Expression of OSA1 and STAT1. [score:8]
The shRNA-coding hairpin mimics human microRNA miR-30a structure and target mouse Sod2 mRNA. [score:3]
The shRNA was designed to mimic human miR-30a structure (for details, see [13]). [score:1]
To test this idea, we used a construct that is composed of a human ubiquitin C promoter and an shRNA with the human miRNA miR-30a structure [13] to generate transgenic mice. [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 20
Thus, members of the miR-30 family were significantly down-regulated so that expression of its main target p53 could be suitably elevated to counteract the higher proliferation in recovering lung tissues, which are more prone to DNA damage and mutation in the presence of increased DNA synthesis [41]. [score:9]
TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi. [score:5]
Hence, miR-30 appears to act as a tumor suppressor, with its subdued expression facilitating proliferation, but concurrently activating the negative feedback loop of p53, thus showcasing the intricate roles that miRNAs play in pulmonary damage and repair [42]. [score:5]
At 15 dpi, 17 miRNAs (let-7b,c, miR-10a, miR-21, miR-25, miR-26a, miR-29c, miR-30a,b,c,d, miR-99a, miR-103, miR-151, miR-195, and miR-200b,c) were identified to be important in the late repair phase. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 20
Both miR30-shRNA and pX330-gFoxp1 inhibited the expression of FOXP1 in the E17.5 neurons as demonstrated by the loss of colocalization of GFP and FOXP1 immunofluorescence in the CP (Fig 2Ca–b and 2Ea–b). [score:5]
Both the targeting and the scramble sequences were also cloned into pCAG-miR30 system (Addgene), which is a pri-miRNA based shRNA -expression vector contributed by Connie Cepko [30]. [score:5]
The miR30 -based shRNA expression system was introduced into the brain by IUE at E14.5. [score:3]
Correspondingly, more neurons were stalled in the IZ when Foxp1 was inhibited (miR30-ScrRNA: 29.2%; miR30-shRNA-b: 53.5%) (Fig 2D), indicating a migratory delay. [score:3]
Therefore, the targeting and scramble sequences were embedded into the murine miR-30 using pCAG-miR30 vector system. [score:3]
At E17.5, a reproducible migration defect was observed in Foxp1 miR30-shRNA-b group by comparison with the control (miR30-ScrRNA) (Fig 2C). [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 19
Inhibiting endogenous background CSE gene expression, and direct administration of H [2]S at 100 microM induced apoptosis in HASMCs[146] Transfected with miR-30 mimics HEK293 cells and primary neonatal rat myocardial cellsOverexpression of miR-30 family members decreases the expression of CSE protein and H [2]S production. [score:10]
Knockdown of miR-30 family members leads to the upregulation of CSE and H [2]S production rates[164]  Diabetes CSE adenovirus gene transfer Transfection of insulin secreting beta cell line INS-1E cellsCSE overexpression stimulates INS-1E cell apoptosis via increased endogenous production of H [2]S. Ad-CSE transfection inhibited ERK1/2 but activated p38 MAPK. [score:9]
[1 to 20 of 2 sentences]
35
[+] score: 19
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63]. [score:6]
In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
[1 to 20 of 4 sentences]
36
[+] score: 19
It is notable that miR-17, miR-30a, and miR-124 in the Uup group played critical roles in controlling the attraction and repulsion of axons via their respective predicted targets. [score:3]
miR-153 in the Udown group targeted Nfatc3, along with miR-221, miR-384-5p, and miR-30a in the Uup group. [score:3]
Among the microRNAs, miR-182 in the Udown group together with 8 microRNAs in the Uup group (miR-96, miR-30a, miR-20a, miR-93, miR-384-5p, miR-106b, miR-17, and miR-181a) targeted Ppp3r1. [score:3]
Also, miR-153 in the Udown group together with miR-221, miR-384-5p, and miR-30a in the Uup group targeted Nfat. [score:3]
Since the network analysis showed that miR-182 in the Udown group and miR-17, miR-30a, and miR-124 in the Uup group play dominant roles in the axon guidance pathway, they and their corresponding target genes were selected for further validation. [score:3]
miR-182 in the Udown group together with miR-96, miR-30a, miR-20a, miR-93, miR-106b, miR-17, miR-384-5p, and miR-181a in the Uup group targeted Caln (Fig 6). [score:3]
The results showed that miR-30a, miR-320, and miR-124 in the Uup group were dominant in node interactions, as reflected by their relatively large size. [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 19
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
The miR-99a and miR-30a target sites are found in the Latimeria sequence and can therefore be inferred to have been present in the last common ancestor of tetrapods and lobe-finned fishes. [score:3]
[1 to 20 of 3 sentences]
38
[+] score: 18
Figure 7(A) Representative images of HUVECs with miR-30b overexpression (HUVEC [miR-30b]) and their negative control (HUVEC [scrambled]); (B) The expression of miR-30b; (C) Representative images of tube-like structures and quantitative analysis of the total tube length (4× magnification microscopic fields); (D) TargetScan shows that 3′ UTR of DLL4 contains conserved miR-30 family binding sites; (E and F) The expression of DLL4 in HUVECs (mRNA and protein, respectively) (* P < 0.05 vs HUVEC [scrambled]). [score:9]
Previous studies reported that DLL4, one of miR-30 family targets, modulates endothelial cell behavior during angiogenesis [31, 45]. [score:3]
TargetScan shows that the 3′ UTR of DLL4 contains the conserved miR-30 family binding sites (Figure 7D). [score:3]
miR-30 family targeted DLL4 in endothelial cells to promote angiogenesis [31]. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 18
Interestingly, we also found these two confirmed BDNF -targeting miRNAs (miR-30a and miR-195) were significantly up-regulated in mouse brain and liver after RDX exposure (Tables 1 and 2, Figure 4). [score:6]
Of the 113 miRNAs with significantly aberrant expressions after RDX exposure, the expression levels of 10 miRNAs were significantly increased in both mouse liver and brain (p < 0.01): miR-99a, miR-30a, miR-30d, miR-30e, miR-22, miR-194, miR-195, miR-15a, miR-139-5p, and miR-101b. [score:5]
In addition, two other members of the miR-30 family (miR-30d and miR-30e) that target BDNF (Mellios et al. 2008) were also overexpressed (Tables 1 and 2, Figure 4). [score:5]
In that study, luciferase assays confirmed that BDNF was targeted by two miRNAs, miR-30a-5p and miR-195 (Mellios et al. 2008). [score:2]
[1 to 20 of 4 sentences]
40
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
WT) Musmusculus mmu-miR-205_st 0.00222063 –12.7246 Musmusculus mmu-miR-200c_st 0.00648219 –5.19281 Musmusculus mmu-miR-152_st 0.00458781 –3.38479 Musmusculus mmu-miR-217_st 0.000331015 –3.0084 Musmusculus mmu-miR-30a-star_st 0.0228718 –2.96337 Musmusculus mmu-miR-491_st 0.000552044 –2.7046 Musmusculus mmu-miR-329_st 0.0117443 –2.6441 Musmusculus mmu-miR-138-1-star_st 0.00500405 –2.41789 Musmusculus mmu-miR-29a_st 0.03658 –2.40317 Musmusculus mmu-miR-128_st 0.00381972 –2.31917 Musmusculus mmu-miR-5100_st 7.60E-05 –2.28855 Musmusculus mmu-miR-412-5p_st 0.0241069 –2.23696 Musmusculus mmu-miR-421_st 0.00638554 –2.0941 Musmusculus mmu-miR-1839-5p_st 0.00541099 –2.05082 Musmusculus mmu-miR-27b_st 0.00384257 –2.02513 Musmusculus mmu-miR-674-star_st 0.0249087 –1. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 18
Given that microRNAs (miRNAs) modulate pathophysiology of cardiovascular diseases through regulation of gene expression [7], [8], [9], [47], we determined whether BMPCs administration after MI regulates miRNAs (like miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a) that have been shown to play a role in fibrosis in various tissues/organs [8], [11], [12]. [score:7]
To determine whether BMPCs regulate fibrosis-related miRNAs in infarcted heart, we injected mouse BMPCs in infarcted hearts of C57BLKS/J mice and determined (at 3 days post-MI) the expression of miRNAs (miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a, which have been shown to play a role in fibrosis [9], [10], [11], [24], [25]). [score:4]
Figure 1 depicts that saline -treated MI mice showed a significant increase in expression of miR-21 and miR-155 (P<0.01; Figures 1A and 1B) and decrease in miR-29 and miR-133a (P<0.01; Figures 1C and 1D) levels with non-significant reducing trend of miR-27 and miR-30a (Figures S4. [score:3]
Several miRNAs in the myocardium are modulated after MI including those that have been implicated in the regulation of fibrosis like miR-21, miR-29, miR-30, miR-133 and miR-155 [8], [9], [10], [11], [12]. [score:2]
Although the role miR-27 and miR-30a in fibrosis has been established in other organs systems [12], [48], their levels remained unchanged in the present study. [score:1]
BMPC therapy did not affect miR-27 (A) and miR-30a (B) in comparison with saline -treated group. [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 18
Thus, the downregulation of miR-133 and miR-30 may contribute to the development of cardiac fibrosis in DBL mice, as both regulate the profibrotic signalling factor, CTGF [30], which was correspondingly upregulated. [score:9]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
Downregulated miRNAs included miR-1 and miR-133a, which are part of the same transcriptional unit, and three miR-30 family members, namely miR-30b, miR-30c and miR-30e. [score:4]
[1 to 20 of 3 sentences]
43
[+] score: 17
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
There was no significant change in miR-133, miR-30, or miR-101 family members after LPS. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 17
However we found deregulated at least two genes (Bglap2 and Il1f9) regulated by Runx2, a direct target of miR-30 family [7], [9]. [score:6]
Recent data highlighted a role of miR-30 in the inhibition of EMT in hepatocytes [13], process which is important for mammary gland involution. [score:3]
miR-30 family targets validated in the literature. [score:3]
The miR-30 family is also involved in the control of structural changes in the extracellular matrix of the myocardium [14], in cellular senescence [15] and in the regulation of the apoptosis [16]. [score:2]
These observations could corroborate to recent published data on the miR-30 family that highlighted its role in the differentiation of various cell types including adipocytes [7], B-cells [8] or osteoblasts [9]. [score:1]
The miR-30 family is highly conserved in Vertebrates, it is composed by 6 miRNA (miR-30a, -30b, -30c-1, -30c-2, -30d and -30e) and it is organized in 3 clusters of two miRNA localized on 3 different chromosomes. [score:1]
miR-30b is a member of the miR-30 family, composed of 6 miRNA that are highly conserved in vertebrates. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The top negatively correlated (conserved) mouse miRNAs include miR-30a/d (targets Runx2) [57], miR-148a (targets Met/Snail) [58], miR-503 (targets Bcl-2 and Igf1r, implicated in involution) [59], miR-203 (targets the transcription factor p63) [60] and miR-34a (targets Dll1 and CD44, important for stem cell activity) [61, 62]. [score:11]
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
Zaragosi LE Wdziekonski B Brigand KL Villageois P Mari B Waldmann R Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesisGenome Biol. [score:2]
[1 to 20 of 3 sentences]
47
[+] score: 15
Cre-conditional expression of rAAV2/9- CAG::FLEX-rev-hrGFP:mir30(Scn9a) in Agrp [Cre] mice (AGRP [sh(Scn9a)] mice, Figures 4H and 4I) reduced EPSP duration resulting in synaptic potentials that decayed with the membrane time constant (AGRP [sh(Scn9a)]: 116% ± 8% of τ [m], n = 14; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p < 0.001), whereas expression of a scrambled Scn9a shRNA sequence maintained prolonged EPSPs (AGRP [sh(Scn9a-scram)]: 271% ± 3% of τ [m], n = 7; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p = 0.15, Figure 5A). [score:5]
This method couples reporter gene expression (humanized Renilla green fluorescent protein [hrGFP]) to RNA interference with a microRNA (miR30) cassette that was modified (Stegmeier et al., 2005, Stern et al., 2008) to encode a shRNA sequence for Scn9a in the 3′-untranslated region, allowing identification of neurons transduced with the short hairpin RNA (shRNA) (Figures 4A and 4B). [score:5]
Constructs for Scn9a Knockdown miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www. [score:2]
php) and then chose a sequence with <76% homology to RefSeq transcripts in the mouse genome and that also obeyed gui delines for miR30 -based shRNA (Dow et al., 2012, Matveeva et al., 2012) (see the Supplemental). [score:1]
To produce a negative control for this miR30 -based Scn9a shRNA construct, we used a website to produce a scrambled sequence (http://www. [score:1]
miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www. [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 15
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
Out of the 8 selected miRNAs, miR-137, miR-140–5p, miR-148a-3p, miR-30a-5p and miR-338-3p were significantly downregulated in the tumors compared with normal tissue (P < 0.001, <0.001, 0.001, 0.001 and 0.0003, respectively) (Fig.   3a). [score:3]
Six miRNAs miR-137, miR-148a-3p, miR-338-3p, miR-30a/b-5p and miR-22-3p known to be associated with several cancers were chosen to study the expression levels in oral tumors 20, 25, 26. [score:3]
miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p shared maximum common downstream targets. [score:3]
Further, we screened the 3′-UTR of OIP5 for any shared microRNA response element (MREs) for the miRNAs those having interaction with OIP5-AS1 and found only miR-424-5p and miR-30a-5p specific MREs in OIP5. [score:1]
[1 to 20 of 5 sentences]
49
[+] score: 15
Importantly, we describe an shRNA prediction tool that can effectively predict high potency shRNA target sequences when imbedded in the miR30 context, and we show that more than half of the sequences tested had the ability to knockdown gene expression from single copy, Dox-inducible cassette in embryonic stem cells. [score:6]
While we have not yet examined the effect of these modifications with our shRNA selection algorithm, we anticipate that this may further improve the efficiency of miR30 shRNA mediated gene knockdown. [score:2]
pENTR1a-dsRed-m30c was constructed by first cloning dsRed-Express (Clonetech) into pENTR1a (Invitrogen) with SalI/NotI, then the miR30 based context was cloned into NotI/XbaI sites of pENTR1a-dsRed using the following primers: miR30 5’Arm 5’cgtaaGCGGCCGCGTCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGG 3, miR30 mid Arm 5’CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGCAACCAGATATCGAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACT 3’, miR30 3’Arm 5’GGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTCTAGAcgtaa 3’. [score:2]
Recently, site-specific insertion of inducible microRNA-30 context (miR30c) based shRNA cassettes in embryonic stem cells have enabled rapid generation of mice with inducible gene knockdown [1, 2]. [score:2]
Fluorescent miR30-shRNA or Flag tagged NPAS4, SIM2s and SIM2l cDNAs were recombined into pFLP-Inducer or pLVTPT vectors by LR recombination. [score:1]
Recently, a number of high throughput experiments have been performed to identify potent shRNA sequences which, when embedded with the miR30 -based context, successfully produce functional siRNAs [19, 20]. [score:1]
Generation of a miR30 shRNA selection algorithm. [score:1]
[1 to 20 of 7 sentences]
50
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
51
[+] score: 14
For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone. [score:6]
Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO. [score:5]
I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53). [score:3]
[1 to 20 of 3 sentences]
52
[+] score: 13
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
Among the p53-miRs that target the components of the miRNA processing complexes, miR-15/16/195, miR-103, miR-107, let-7, miR-124, miR-181, miR-148a/b, miR-30a/c, miR-27, miR-17, and miR-20 appear to target more than five components of the miRNA-processing pathway [Table 4, Table S3], suggesting the conserved nature of p53-miRs. [score:5]
[1 to 20 of 2 sentences]
53
[+] score: 13
Studies have described miRNA binding sites for miR-30 within the extended region of Lhx1 3'UTR, where miR-30 inhibits Lhx1 expression and therefore embryonic kidney differentiation [28] (Figure 2C). [score:5]
MiR-30 was abundantly detected in our miRNA-Seq dataset, where it has been previously shown to be a critical regulator of kidney development [28]. [score:3]
Literature evidence of microRNA association is represented for Lhx1 (miR-30) and Hoxa11 (miR-181) along with other known transcriptional regulatory relationship (dotted arrows). [score:2]
Only Lhx1 has been characterized as target of miR-30 within the context of kidney development [28]. [score:2]
C: Riboprobes used for in situ hybridization (ISH): i) overlapping the canonical region as represented by Affymetrix probeset 1421951_at and ii) overlapping extended 3' signal captured by RNA-Seq and probeset 1450428_at, which also contains a microRNA binding site for miR-30 [28]. [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 13
Furthermore, BDNF translation is also regulated by microRNA, e. g. miR-30a-5p targets specific sequences surrounding the proximal polyadenylation site within BDNF 3′-untranslated region and overexpression of this miR results in down-regulation of BDNF protein [32]. [score:13]
[1 to 20 of 1 sentences]
55
[+] score: 13
BIM shRNA knockdown and retroviral expression of miR-17-92The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems). [score:7]
The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems). [score:4]
A miR-30 -based shRNA was used to knockdown BIM expression by 80% as measured by Western blot analysis [21] (Supplementary Figure 1). [score:2]
[1 to 20 of 3 sentences]
56
[+] score: 13
Previous studies reported the downregulation of miR-30 family members during osteoblast differentiation from mouse preosteoblast cell lines 18, 19. miR-30a/b/c/d were demonstrated to be able to negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 [19]. [score:7]
In contrast, miR-30 family members were upregulated during adipogenic differentiation of adipose tissue-derived stem cells, and miR-30a and miR-30d contributed to adipocyte formation [20]. [score:4]
The miR-30 family is associated with cell differentiation, cellular senescence, apoptosis, and involved in the pathogenesis of tumors and other disorders of the nervous, genital, circulatory, alimentary and respiratory systems 15– 17. [score:1]
The miR-30 family members include miR-30a, miR-30b, miR-30c, miR-30d and miR-30e. [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 12
In addition to miR-320a, we found a group miRNAs which are differentially expressed in CAD patients, among which miRNAs, miR-21, miR-30a, miR-126, and miR-133a were reported to be up-regulated and miR-208a and miR-320a to be downregulated in infarcted myocardium 35, 36. [score:9]
Seven miRNAs (miR-21, miR-30a, miR-126, miR-133a, miR-195, miR-208a and miR-320a) were confirmed to be differentially expressed between CAD and control samples (Fig. 1B). [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 12
Furthermore, a high number of miRNAs that were downregulated in p53 compromised iPS cells convey tumour suppressive functions, that is, miR-30a-5p, [55] miR-31, 56, 57 miR-335, [58] miR-382 [59] and miR-503. [score:6]
Additionally, several miRNAs that are known to exhibit tumour suppressive functions, like miR-30a-5p, miR-31, miR-335, miR-382 and miR-503, were downregulated in the p53R172H cells upon reprograming to iPS cells. [score:6]
[1 to 20 of 2 sentences]
59
[+] score: 12
Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette. [score:6]
Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector. [score:6]
[1 to 20 of 2 sentences]
60
[+] score: 12
Our analysis of miRNA expression revealed that miR-9, miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, and miR-146a are all expressed in the developing forebrain, adult dorsal striatum and in the developing kidney (S4 Table). [score:5]
Our data also suggest that miR-125a-5p, miR-125b-5p, miR-30a, and miR-30b are possible regulators of GDNF expression. [score:4]
We examined the miRNAs miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, miR-96, miR-9, and miR-146a, which were selected based on their co -expression with Gdnf in several brain areas [17, 19, 32, 33]; see also www. [score:3]
[1 to 20 of 3 sentences]
61
[+] score: 11
This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions. [score:4]
Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56). [score:3]
For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction. [score:3]
Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30. [score:1]
[1 to 20 of 4 sentences]
62
[+] score: 11
Therefore, expression of select miRNAs, including the miR-199 and miR-30 families, decreases during reprogramming and may allow for the upregulation of SIRT1 protein expression. [score:8]
Additionally, all five members of the miR-30 family that potentially target SIRT1 were higher in MEFs than iPS and mESCs. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 10
The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1). [score:3]
0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10]. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 10
Following chronic CS exposure, 12 miRNAs (miR-146a, miR-148a, miR-152, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-342-3p, miR-376b* and miR-449) were differentially expressed in both lung tissue and BAL supernatant of which 10 showed concordant up- or down-regulation. [score:6]
By focusing on the overlap between subacute and chronic CS exposure within the same compartment, or the overlap between miRNAs with altered expression levels in BAL and lung, we narrowed the pool of interesting miRNAs down to 18: let-7b, let-7c, miR-135b, miR-138, miR-146a, miR-148a, miR-152, miR-155, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-322*, miR-342-3p, miR-376b* and miR-449. [score:3]
p-value = 0.0067, Fig.   5b) and miR-152, miR-30a-5p, miR-30c, miR-218 and miR-26a correlated with several immune cell types in lung tissue. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 10
miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development. [score:5]
The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect. [score:3]
However, the function of miR30 especially in NSCLC remains unclear [32]. [score:1]
The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg). [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 10
In diabetic patients, miR-21a is down-regulated in peripheral blood mononuclear cells [25], serum miR-30a and urine miR-30b expression is up-regulated [26, 27]. [score:9]
In them, 9 miRNAs (miR-21a, miR-29c, miR-30a, miR-30b, miR-34a, miR-106b, miR-203, miR-378 and miR-802) had been shown to be related with diabetes or glucose metabolism. [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 10
An shRNA is expressed under regulation of a U6 promoter and is flanked by pri-miR-30 5′ and 3′ sequences, which are 151 and 128 bp long, respectively. [score:4]
The shRNA sequences (Figure 1B, Table S1) targeting human huntingtin (shHTT) and EGFP (control reagent, shCTRL) were designed using the RNAi Codex database (Olson et al., 2006) with a mir-30 loop between the passenger and guide strands. [score:3]
We have assembled a silencing construct and stably integrated it into the iPSC genome; this construct is based on the piggyBac transposase system (Yusa et al., 2011) and contains anti-HTT or control shRNA in the mir-30 backbone (Paddison et al., 2004), and the gene encoding mOrange2 fluorescent protein (Shaner et al., 2008) as a reporter (Figure 1A). [score:1]
We used a piggyBac transposase system (Yusa et al., 2011) and anti-HTT shRNA in the mir-30 backbone (Paddison et al., 2004) which provides additional possibility for future excision of the reagent if desired. [score:1]
Constructs (Figure 1A) composed of a U6 promoter, a miR-30 5′ flank (151 bp), an shRNA sequence, a miR-30 3′ flank (128 bp), a U6 terminator (TTTTTT), an EF1alpha promoter, an mOrange2 reporter gene, and an SV40 pA site were were synthesized by Genscript (Piscataway, NJ) and cloned into a pPB-HKS-neoL vector obtained, by removing the EGFP reporter gene, from a pPB-UbC. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 10
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
Notes on individual miRs; [a]mmu-miR-19b-3p is ranked 30 [th] in RMA; [b]mmu-miR-107-3p is ranked 41 [st] in RMA; [c]mmu-miR-5100 was ranked 31 [st] in LVS; [d]mmu-miR-30a-5p is 42 [nd] in LVS. [score:1]
7* mmu-miR-29a-3p −1.0 mmu-miR-16-5p 2.0* mmu-miR-23b-3p −2.8* mmu-miR-15a-5p 2.3* mmu-let-7i-5p −1.6* mmu-miR-24-3p −1.5*mmu-miR-19b-3p [a] 1.1 mmu-miR-26b-5p 1.1 mmu-miR-26b-5p −1.1 mmu-let-7i-5p −1.1 mmu-miR-16-5p 1.5*mmu-miR-30a-5p [d] −4.1* mmu-miR-29c-3p −1.1 mmu-let-7d-5p −2.1* mmu-let-7d-5p −3.0* mmu-miR-29c-3p 1.1mmu-miR-107-3p [b] −1.3 mmu-miR-29b-3p −1.2Data were normalized using LVS or RMA. [score:1]
These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p). [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
These miRNAs (miR-15a, miR-30, miR-182, and miR-804) are involved in cell proliferation, apoptosis, inflammation, epithelial-mesenchymal transition, invasion, oncogene inhibition, and intercellular adhesion. [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 10
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
The miR-30a, miR-142-5p and miR-450a have roles in metastatic breast and colon cancer [61] and the miR-151-3p can enhance hepatocellular carcinoma cell mobility [66]. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 10
Figure 1 Expression of concatenated miR30 -based shRNAs in a single transcript can promote efficient knockdown of at least three target genes. [score:6]
Prom; any of the pol II promoters listed in Fig. 2a, attL1 + attL2; Gateway recombination sites, 5'miR + 3'miR; flanking sequence derived from human miR30. [score:1]
Although we clone shRNAs into our entry vectors using BfuAI compatible linkers, we include Xho I and Eco RI cloning sites in the flanking miR30 sequence to allow subcloning of miR-shRNAs from popular whole genome libraries [2, 7] into our plasmids (Fig. 2b). [score:1]
For shRNAs cloned as BfuAI site-compatible linkers (see methods), shRNA sequence is introduced at the junctions of the 5' and 3' miR30 sequence (light blue). [score:1]
For shRNAs subcloned from commercially available whole genome libraries [2, 7], fragments can be subcloned to the XhoI/EcoRI sites (dark blue) within the 5' and 3' miR30 sequence. [score:1]
[1 to 20 of 5 sentences]
72
[+] score: 9
shRNA against GOI was expressed by CAG-LSL-mir30, which is a Cre -dependent shRNA expression vector 14. [score:5]
The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14 (Addgene plasmid #13786). [score:1]
The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14. [score:1]
Small hairpin RNA (shRNA) can be transfected into cortical neurons by the IUE -mediated transfection of CAG promotor/microRNA30 -based RNAi vector (CAG-LSL-mir30) 14. [score:1]
pK225 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi)] and pK226 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi Scramble control)]: For single cell LacZ knockdown, the shRNA against the coding region of LacZ (651–671) and its scramble control were generated by PCR with the template oligonucleotide for LacZ shRNA WL090 and the template oligonucleotide for LacZ shRNA scramble control WL091, respectively, using the primers HM082/HM083. [score:1]
[1 to 20 of 5 sentences]
73
[+] score: 9
Murchison et al. first investigated the expression of miRNAs in mouse oocytes, and they demonstrated that the miR-30, miR-16 and let-7 family was overexpressed in mouse germinal vesicle (GV) oocytes, speculating, as a result, that miRNAs might play important regulatory roles in the expression of mRNAs during the process of follicular maturity [23]. [score:6]
Furthermore, Tang et al reported that the miR-30, miR-16, let-7 and miR-17-92 family, which was detected in mature mouse oocytes, dynamically regulated oogenesis and early embryonic development. [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 9
Knockdown of NF-κB-p65 by small interfering RNA (siRNA) significantly suppresses radiation -induced miR-30 expression in CD34+ cells [45]. [score:6]
Nevertheless, suppression of miR-30 and IL-1β protects CD2F1 male mice and human CD34+ cells from radiation injury [45]. [score:3]
[1 to 20 of 2 sentences]
75
[+] score: 9
Furthermore, miRNAs were confirmed to be upregulated upon myelination: p≤0.0001 (miR-34a, miR-146b), p = 0.04 (miR-338-3p), p = 0.003 (miR-204), p = 0.0007 (miR-27b), p = 0.005 (miR-140), p = 0.0002 (miR-138), p = 0.01 (miR-195), p = 0.0004 (miR-30a). [score:4]
All miRNAs analyzed were significantly downregulated in Dicer [fl/fl] Dhh-Cre [+] nerves at p4: p≤0.0001 (miR-34a, miR-146b, miR-338-3p, miR-204, miR-27b, miR-140, miR-138, miR-30a), p = 0.0002 (miR-195). [score:4]
However, some miRNAs identified have not been previously reported to be involved in myelination, including miR-195, miR-140, miR-34a, miR-30a, miR-30b, miR-30c, and miR-140*. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 9
Similar courses of miRNA expression levels are here found for miR-30a known to be involved in manifestation and resolution of liver fibrosis (Roy et al., 2015), for miR-27a described to be involved in fibrosis (Cui et al., 2016), and for mir-29b known to suppress transcription of genes encoding for extracellular matrix proteins (cf. [score:5]
However, the up-regulated levels of mir-122-5p, miR-30a, mir-27a, and miR-29, observed in vaccination-protected mice during crisis, may contribute to the accelerated liver regeneration suggested to occur in these mice. [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 9
Hierarchichal clustering of the miRNA data revealed significant upregulation of tumor promoter miRNAs (miR-17, miR-21, miR-31, miR-98 and miR-182) and significant downregulation of tumor suppressor miRNAs (Let7a, miR-143, miR-144, miR145, miR-30a and miR-200a) in the IECs of Apc [Min/+] mice (Figure 4A). [score:9]
[1 to 20 of 1 sentences]
78
[+] score: 8
On the contrary, it has been shown that miR-30 can inhibit the self-renewal and induce apoptosis of breast tumor-initiating cells (BT-ICs) by silencing Ubc9 and ITGB3 [42]. [score:3]
Above evidences indicate that miR-30 is a multifunction gene which can inhibit or induce the apoptosis. [score:3]
miR-30b is one of the miR-30 family which is associated with the development of many types of cancers. [score:2]
[1 to 20 of 3 sentences]
79
[+] score: 8
To temporarily and reversibly control p53 expression in vivo, we utilized TRE-p53.1224 transgenic mice in which expression of a miR-30 -based p53.1224 shRNA is regulated by a tetracycline-responsive element (TRE) 17. [score:6]
Expression of miR-30 -based p53.1224 shRNA was detected using a Custom TaqMan MicroRNA Assay (Applied Biosystems). [score:2]
[1 to 20 of 2 sentences]
80
[+] score: 8
As shown in Figure 6A, mRNA targets of several miRNA families were found to be significantly upregulated in hypertrophy (false discovery rate (FDR) <0.05), including those targeted by miR-29, miR-1, miR-9, miR-30, and miR-133. [score:8]
[1 to 20 of 1 sentences]
81
[+] score: 8
The miRNA control contains a luciferase shRNA cloned onto the stem of miR-30 [59], while the control shRNA targets firefly luciferase cloned as an shRNA. [score:3]
Tumors and metastases derived from implanted 4T1 cells or 4TO7 cells that were unmodified or infected with retroviruses expressing a control miR-30 stem insert or the miR-141-200c miRNA cluster within the miR-30 stem were stained with PCNA. [score:3]
The miR-30 stem containing an shRNA against firefly luciferase was used as a negative control. [score:1]
To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem. [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 8
The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study. [score:7]
For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 8
Such relatively high stromal/epithelial expression ratios were not observed for miR-30a-5p (average and range of 1.5- and 0.1–4.8-fold, respectively; t test P = 0.95) and let-7e (average and range of 1.7- and 1.0–2.2-fold, respectively; t test P = 0.18), two other microRNAs known to be expressed in NSCLC [3]. [score:5]
B. Relative expression of let-7e, miR-30a-5p, and miR-146b-5p and -3p microRNAs in stromal and cancerous epithelial components of stage I non-small cell lung cancer as assessed using reverse transcription followed by PCR. [score:3]
[1 to 20 of 2 sentences]
84
[+] score: 8
Wu et al. found that expression of the miR-30 family was downregulated in mouse preosteoblast differentiation and further found that miR-30 targeted the important transcription factors SMAD1 and RUNX2 [9]. [score:8]
[1 to 20 of 1 sentences]
85
[+] score: 7
Besides the regulation of miR-103/107 and miR-143, we could also confirm the up-regulation of miR-422b, miR-148a, miR-30c, and miR30a-5p found in differentiating 3T3-L1 cells by Xie and colleagues [24]. [score:5]
D–E: Melting curve analysis (D) in combination with agarose gel electrophoresis (E), Lane 1: miR-21*, lane 2: miR-125a-3p, lane 3: miR-30a PCR-products, “L”: GelPilot 50 bp Ladder revealed the specificity of miRNA PCR products. [score:1]
As shown in Fig. 2D and 2E, specific PCR products with melting temperatures of about 75°C did also posses the expected size of 85 bp demonstrated by agarose gel electrophoresis (a representative result for mir-30a is given). [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 7
We found that treatment of iMEF cells with miR-450a-3p mimic (50 nM) positively caused a marked reduction of Bub1 expression, whereas treatment with miR-30a or 30e mimic or an negative control (non -targeting) mimic did not cause any reduction of Bub1 protein (Fig. 2A ). [score:5]
The percent of Hoechst positive cells treated with miR-450a-3p is 6.8%, while the percent of Hoechst positive cells treated with miR-30a, miR-30e and the control is 2.4%, 1.5%, and 2.1% respectively (Fig. 3C ). [score:1]
Eight potential microRNAs were identified, including miRNA-30a,30e,494,467a,467e,450a-3p,466a-3p and 297b. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 7
In this study, we constructed multi-hairpin amiRNAs based on miR-30 to target endogenous genes of GAPDH, eIF4E and DNA pol α to knockdown their expression more effectively. [score:6]
amiRNAs based on modified human microRNA 30 (miR-30) could achieve more effective gene silencing than previous short-hairpin RNA (shRNA) [11, 13, 31]. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 7
Two of the above mentioned miRNAs (miR-30 and miR-133) were targeted by both aspirin and naproxen. [score:3]
In fact, a couple of miRNAs (miR-27a and miR-133a), targeting inflammation and cell proliferation, had been found to be modulated by the same NSAID in A/J mice aged 10 weeks, whereas other miRNAs (miR-30, miR-101 and miR-344b) affecting later stages of pulmonary carcinogenesis were able to distinguish the mice according to the yield of both microadenomas and adenomas. [score:3]
Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas. [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 7
In these mice, all A1 paralogues expressed are constitutively targeted by a single shRNA embedded in the miR30 backbone, placed in the 3′UTR of the fluorescence marker Venus and expressed under control of the hematopoiesis specific Vav-gene promoter (VV-A1 mice). [score:7]
[1 to 20 of 1 sentences]
90
[+] score: 7
In the present study, we investigated the alteration of miR-30e in SNpc by qRT-PCR and the results showed that the expression of miR-30e was downregulated gradually after MPTP injection, suggesting miR-30 might also have a role in the pathogenesis of PD. [score:4]
For overexpression of miR-30e in BV-2 cells, the cells were transfected with miR-30 mimics or negative control miRNA using Lipofectamine 2000 according to the manufacturer’s protocol. [score:3]
[1 to 20 of 2 sentences]
91
[+] score: 7
Notably, several large miRNA families (such as the miRNA-15, miRNA-30, and let-7 families) were upregulated in P10 cardiac ventricles, and miRNA-195 (a member of the miRNA-15 family) was shown to be the most highly upregulated miRNA. [score:7]
[1 to 20 of 1 sentences]
92
[+] score: 7
Other miRNAs from this paper: mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
We also observed that miRNA-30a was up-regulated in adrenals treated with ACTH, but down-regulated by 17α-E2 exposure. [score:7]
[1 to 20 of 1 sentences]
93
[+] score: 7
mRNA targets that showed inversely correlated expression with miRNAs (Additional file 3) include previously validated miRNA/target pairs such as Mef2c with miR-223 [14], Bcl2 with miR-15 or miR-16 [38], Mybl2 with miR-29 or miR-30 family members [39], and Ezh2 with miR-26a [40]. [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
The other miRNAs involved in regulation of CSE are miR-30 that directly inhibits CSE [47], and miR-22 that inhibits SP1 [49]. [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
We first utilised these ecotropic MuLE lentiviruses expressing combinations of shRNA or shRNA-miR30 against Cdkn2a, Trp53, Tsc2 and Pten with or without expression of oncogenic Hras [G12V], oncogenic PIK3CA [H1047R] or Myc vectors to attempt to generate panels of genetically-engineered angiosarcoma cell lines by infecting a disease-relevant cell type, namely primary murine endothelial cells from the spleen (pMSECs). [score:7]
[1 to 20 of 1 sentences]
96
[+] score: 7
Our resultsidentified 20differentially expressed miRNAs in aortas from WT mice and 12-week-old OPG [−/−] mice, with miR-32, miR-125b, miR-30a, miR-29a, miR-210, miR-33, miR-133a exhibitingsignificantly altered expression in aortas fromOPG [−/−] mice relative to their expression in aortas from WT mice. [score:7]
[1 to 20 of 1 sentences]
97
[+] score: 7
Other miRNAs from this paper: mmu-mir-182, mmu-mir-206
Additionally Snai2 transcripts were recently described as targets of miR-206 [5] and Snai1 transcripts as targets of miR-30a [36] the result of which can destabilize the gene transcripts and block translation. [score:7]
[1 to 20 of 1 sentences]
98
[+] score: 6
For instance, miR-125b, miR-504 and miR-30 can target p53 and down-regulate p53 protein levels and function [24– 26]. [score:6]
[1 to 20 of 1 sentences]
99
[+] score: 6
This resulted in an increased expression of miR-503, miR-30-c2*, miR-183* and miR-198, with miR-503 being the most upregulated (Fig. 1c). [score:6]
[1 to 20 of 1 sentences]
100
[+] score: 6
miR-29 and miR-30 regulate B-Myb expression during cellular senescence. [score:4]
In agreement with other studies (Grillari et al., 2010; Kato et al., 2011; Martinez et al., 2011) we found a decrease in abundance of members of the family of let-7, miR-30, miR-17-92 cluster and its paralogs miR-106a-363 and miR-106b-25 in WT and 3x-Tg-AD aged mice. [score:1]
These overlapping miRNAs include family members of let-7, miR-30, miR-17-92 cluster and its paralogs. [score:1]
[1 to 20 of 3 sentences]