sort by

209 publications mentioning mmu-mir-30b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-30b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 353
Considering the downregulated expression of miR-30b in gastric cancer, we focused on the list of genes showing increased expressions and selected the top 30 increased genes in gastric cancer, then determined if those genes were potential targets of miR-30b by using the prediction algorithm, TargetScan. [score:12]
Moreover, PAI-1 was identified as the potential targets of miR-30b, and miR-30b may induce apoptosis and suppress tumor growth by repressing the expression of PAI-1. Our findings suggest that miR-30b may function as a novel tumor suppressor gene in gastric cancer and can be a potential therapy target for gastric cancer. [score:11]
Our study showed that miR-30b expression was inversely correlated with PAI-1 expression in gastric cancer cell lines and tumor tissues, PAI-1 overexpression could counteract the effect of promoting apoptosis by miR-30b, and ectopic expression of miR-30b had similar promoting-apoptosis effect compared with silencing PAI-1 expression. [score:10]
Above results suggest that miR-30b expression is inversely correlated with PAI-1 expression in gastric cancer, and enhanced PAI-1 expression in gastric cancer could be a result of reduced miR-30b expression. [score:9]
Taken together, above data suggest that PAI-1 is a potential target of miR-30b, and miR-30b might down-regulate the target protein. [score:8]
In addition, silencing of PAI-1 was able to phenocopy the effect of miR-30b overexpression on apoptosis regulation of cancer cells, and overexpression of PAI-1 could suppressed the effect of promoting cell apoptosis by miR-30b, indicating on cancer cells. [score:8]
Moreover, plasminogen activator inhibitor-1 (PAI-1) was identified as the potential target of miR-30b, and miR-30b level was inversely correlated with PAI-1 expression in gastric cancer. [score:7]
These results suggest that the miR-30b expression is frequently down-regulated in gastric cancer and maybe involved in the development of gastric cancer. [score:7]
In current report, we found ectopic expression of miR-30b could induce the apoptosis of gastric cancer cells in vitro, and overexpression of miR-30b could significantly inhibit tumor growth in nude mouse xenograft mo del by inducing the apoptosis of gastric cancer cells in vivo. [score:7]
Interestingly, we found that PAI-1 gene which was upregulated in microarray (3.83 fold, P = 0.04) might be a probable target gene of miR-30b (Figure 4A). [score:6]
Considering that miR-30b is down-regulated in gastric cancer, and it has been reported that PAI-1 protein in gastric cancer tissues is dramatically higher than in the non-tumor tissues [28], we performed the correlation analysis between miR-30b and PAI-1 expression in gastric cancer cell lines and gastric cancer tissues. [score:6]
Furthermore, overexpression of miR-30b in AGS and HGC-27 cells resulted in the down-regulation of the protein levels of PAI-1 (Figure 4E). [score:6]
miR-30b was reported to be down-regulated in prostate cancer [31], invasive bladder tumor [32], anaplastic thyroid cancer [33], esophageal cancer [34], and lung cancer [35], whereas enhanced expression of miR-30b was identified in medulloblastoma [36] and malignant mesothelioma [37]. [score:6]
miR-30b may function as a novel tumor suppressor gene in gastric cancer by targeting PAI-1 and regulating the apoptosis of cancer cells. [score:6]
Since miR-30b was either up-regulated or reduced in different cancers, we could draw a conclusion that miR-30b may play different roles as an oncogene or a tumor suppressor gene in various cancers. [score:6]
As shown in Figure 6E-G, the overexpressing of PAI-1 resulted in obvious suppression on the effect of miR-30b -induced apoptosis. [score:5]
As shown in Figure 1A, the expression of miR-30b was significantly down-regulated in four cell lines compared with a pool of five non-tumor gastric tissues (P<0.01). [score:5]
We further characterized PAI-1 as a potential target of miR-30b, and the expression of miR-30b was inversely correlated with PAI-1 expression in gastric cancer. [score:5]
Finally, we performed the correlation analysis between miR-30b and its target expression in gastric cancer. [score:5]
miR-30b may function as a potential tumor suppressor gene in gastric cancer, and have the potential application as a biomarker or therapeutic target in gastric cancer therapy. [score:5]
Ectopic expression of miR-30b could promote the apoptosis of gastric cancer cell in vitro, and miR-30b could significantly inhibit tumorigenicity of gastric cancers in nude mouse xenograft mo del. [score:5]
Enforced expression of miR-30b promoted the apoptosis of gastric cancer cells in vitro, and miR-30b could significantly inhibit tumorigenicity of gastric cancer by increasing the apoptosis proportion of cancer cells in vivo. [score:5]
Consistent with our finding, miR-30b was found to be down-expressed by microRNA array from 184 gastric cancers and 169 non-tumor mucosae [39], and Qiao et al found that miR-30b was down-expressed in gastric cancer tissue and gastric cancer cell lines, AGS and BGC-823 cells [40]. [score:5]
In contrast, miR-30b was commonly down-regulated in 18 of 21 tumors. [score:4]
Notably, PAI-1 siRNA was able to phenocopy the effect of miR-30b overexpression on apoptosis regulation of cancer cell (Figure 6B, 6C). [score:4]
To directly address whether miR-30b binds to the 3′-UTR of the target mRNAs, we constructed the luciferase report vectors that contain the putative miR-30b binding sites within 3′-UTR. [score:4]
Above findings suggest miR-30b may act as a novel tumor suppressor by regulating the apoptosis of cancer cell in gastric cancer. [score:4]
Here, we showed miR-30b was down-regulated in gastric cancer cells and tumor tissues. [score:4]
Our previous report found miR-30b was able to regulate the autophagy process by targeting ATG12 and BECN1 during H. pylori persist infection [19]. [score:4]
In current study, we found that miR-30b was significantly down-regulated in gastric cancer cells and tumor tissues. [score:4]
miR-30b was significantly down-regulated in gastric cancer cells and human gastric cancer tissues. [score:4]
Our previous studies have revealed that H. pylori infection was able to induce the altered expression of miRNAs in gastric epithelial cells including miR-155, miR-146a and miR-30b, miRNAs may function as novel negative regulators to fine-tune H. pylori -induced inflammation [16], [17]. [score:4]
Furthermore, the scatter diagram showed that miR-30b was significantly down-regulated in gastric cancer samples versus normal gastric mucosa, with an average 6.28-fold decrease (P = 0.002) (Figure 1C). [score:4]
Identification of PAI-1 as a potential target of miR-30b. [score:3]
Overexpression of miR-30b increases the apoptosis of gastric cancer cells. [score:3]
The expression of miR-30b was further examined in 21 paired GC and adjacent non-tumor gastric tissues through TaqMan quantitative real-time PCR (qRT-PCR). [score:3]
The controversial expression of miR-30b suggests the complexity of the function of miR-30b. [score:3]
Inverse correlation between mir-30b and PAI-1 expression in gastric cancer tissues and cancer cell lines. [score:3]
These results strongly suggested that introduction of miR-30b could inhibit gastric cancer growth by promoting apoptosis of cancer cells. [score:3]
We analyzed the expression of miR-30b in gastric cancer cell lines and human gastric cancer tissues. [score:3]
Decreased miR-30b expression in human gastric cancer cell lines and GC tissue samples. [score:3]
The construction of various luciferase report vectors for miR-30b target was performed as previously described [16], [26], and the construct containing mutant seed region was generated as a control. [score:3]
0106049.g001 Figure 1(A) Comparison of expression level of miR-30b between normal gastric mucosa tissue samples and gastric cancer cell lines HGC-27, SGC-7901, BGC-823 and AGS. [score:3]
To further investigate whether PAI-1 is involved in miR-30b-promoted apoptosis, we first tested if the silencing of PAI-1 expression may have the similar apoptosis-promoting effect as miR-30b overexpression. [score:3]
Therefore, the loss of miR-30b expression may be associated with the pathogenesis and progression of gastric cancer. [score:3]
Our previous studies have revealed that H. pylori infection was able to induce the altered expression of miR-30b in gastric epithelial cells. [score:3]
Above results reveal that overexpression of miR-30b can promote the apoptosis of gastric cancer in vitro. [score:3]
Our data also indicated that overxepression of miR-30b could improve the apoptosis of gastric cancer cells in vitro and in vivo, and miR-30b was able to suppress tumor growth of gastric cancer in vivo. [score:3]
On the contrary, it has been shown that miR-30 can inhibit the self-renewal and induce apoptosis of breast tumor-initiating cells (BT-ICs) by silencing Ubc9 and ITGB3 [42]. [score:3]
Recently, several novel targets of miR-30b have been confirmed including p53 [43], Delta-like 4 [44], and Snail1 [45]. [score:3]
Above evidences indicate that miR-30 is a multifunction gene which can inhibit or induce the apoptosis. [score:3]
To explore the molecular mechanism underlying miR-30b function, it is important to identify its target gene. [score:3]
Subsequently, we examined PAI-1 and miR-30b expression in 21 sets of gastric cancer and adjacent non-tumor tissues. [score:3]
SGC-7901 or HGC-27 cells were transfected with miR-30b mimics or scrambled miR-control, and the validity of miR-30b ectopic expression was confirmed by qRT-PCR (Figure 2A). [score:3]
Recently, Li et al [41] found that miR-30b was significantly reduced in response to the oxidative stress stimulation, and miR-30b could inhibit mitochondrial fission and consequent apoptosis. [score:3]
Decreased miR-30b expression in human gastric cancer cell lines and tumor tissues. [score:3]
miR-30b could serve as a potential biomarker and therapeutic target against gastric cancer. [score:3]
Regarding to miR-30b, it may have multi-function in H. pylori infection and H. pylori -associated diseases. [score:3]
0106049.g005 Figure 5(A) The expression of mir-30b and PAI-1 in gastric cancer cell lines MKN45, MGC-823, SGC-7901, AGS and HGC-27. [score:3]
SGC-7901 or HGC-27 cells were seeded in 12-well plate at a suitable density and grown to 30% confluency after 24 h. Then cells were transfected with miR-30b mimics or miR-control, and the medium was replaced with serum-free DMEM for 48 h. For co-transfection experiment with miR-30b and PAI-1 expressing vector, SGC-7901 cells were transfected with miR-control or miR-30b mimics, and then with PAI-1 Human cDNA ORF Clone vector (indicated as PAI-1) or empty vector 24 h later. [score:3]
To validate the expression data acquired from qRT-PCR, 3 of all 21 pairs samples were randomly chose to determine the level of miR-30b using Northern bolt. [score:3]
In summary, we report the down-regulation of miR-30b in gastric cancer, and investigate the potential role of miR-30b in tumorigenesis by regulating apoptosis. [score:3]
In our study, PAI-1was identified as a target gene of miR-30b in gastric cancer. [score:3]
miR-30b suppresses tumorigenicity and promotes cell apoptosis in vivo. [score:3]
Inverse correlation between miR-30b and PAI-1 expression in gastric cancer cell lines and human tumor tissues. [score:3]
0106049.g004 Figure 4(A) Sequence alignment of miR-30b and its target sites in 3′-UTRs of PAI-1. (B) HEK293 cells were transiently cotransfected with luciferase report vectors, and either miR-30b mimics or miR-control. [score:3]
PAI-1 is a candidate target gene of miR-30b. [score:3]
The relationship between the miR-30b level and PAI-1expression was analyzed using Pearson's correlation. [score:3]
0106049.g002 Figure 2. (A) Relative expression of miR-30b in AGS, HGC-27, and SGC-7901 cells transfected with miR-30b mimics or miR-control for 48 h. Data represent means±S. [score:3]
In the current study, we found that miR-30b expression was significantly decreased in gastric cancer tissues and cell lines compared with normal gastric tissues. [score:2]
miR-30b is one of the miR-30 family which is associated with the development of many types of cancers. [score:2]
Notably, we also found miR-30b could regulate the autophagy process during H. pylori persist infection, thereby contributing to the persistence of H. pylori infections [19]. [score:2]
It suggests that the miR-30b-PAI-1 axis may be involved in the development of gastric cancer. [score:2]
PAI-1 is involved in miR-30b-regulated apoptosis. [score:2]
We also found the consistent decreased expression of miR-30b in gastric cancer compared with non-tumor gastric tissues (Figure 1D). [score:2]
Above findings suggest that miR-30b may play the potential role in gastric cancer development by promoting apoptosis of cancer. [score:2]
To further assess the function of miR-30b, it is important to determine which host mRNAs are being regulated by miR-30b. [score:2]
The target of miR-30b was identified by bioinformatics analysis, luciferase assay and. [score:2]
One of the hallmark of cancer is its ability to evade apoptosis [27], so we examined the effect of miR-30b on gastric cancer cells apoptosis. [score:1]
The difference of tumor size between miR-control group and miR-30b group was statistically significant, **P<0.01. [score:1]
In addition, miR-30b was identified as one of independent predictors for recurrence-free survivals of hepatocellular carcinoma [38]. [score:1]
To determine the role of miR-30b in the pathogenesis of gastric cancer, we analyzed the miR-30b levels in various gastric cancer cells, including HGC-27, AGS, BGC-823 and SGC-7901. [score:1]
However, little is known about the potential role of miR-30b in gastric cancer. [score:1]
Top, western blot analysis of PAI-1 protein levels; bottom, qRT-PCR analysis of miR-30b levels. [score:1]
SGC-7901 or HGC-27 cells were transfected with miR-30b mimics or miR-control, and then the medium was replaced with serum-free DMEM for 48 h, cells were analyzed for apoptotic rate after staining with Annexin V-FITC and PI. [score:1]
As shown in Figure 4B, we observed a marked reduction in luciferase activity (P<0.01) after contransfection of luciferase report vectors and miR-30b mimics. [score:1]
To further determine whether miR-30b is involved in tumorigenesis of gastric cancer, nude mouse xenograft mo del was used. [score:1]
Now little is known about the effect of miR-30b on apoptosis in cancer. [score:1]
RNAs were hybridized sequentially with miR-30b and U6 probe, and U6 was used as a control for RNA loading. [score:1]
As shown in Figure 3D, tumor sections from miR-30b mimics treated xenografts exhibited significantly increase in TUNEL -positive cells. [score:1]
Nude mouse xenograft mo del was used to determine whether miR-30b is involved in tumorigenesis of gastric cancer. [score:1]
miR-30b mimics, scrambled miR-control, chemically modified miR-30b duplex (agomir), chemically modified scrambled miR-control, PAI-1 siRNA, or siRNA negative control were purchased from GenePharma (Shanghai GenePharma Co. [score:1]
Using Pearson's correlation analysis, we observed a significant inverse correlation between miR-30b and PAI-1 mRNA (Figure 5B, R = −0.6475, P = 0.0123). [score:1]
However the role of miR-30b in gastric cancer is still largely unknown. [score:1]
When tumors were harvested, the average volume of tumors derived from the miR-30b mimics group was only 27.87% of that in the miR-control group (Figure 3C, right panel, P<0.01). [score:1]
SGC-7901 cells were transfected with miR-control or miR-30b mimics for 24 h, and followed by transfection with PAI-1 Human cDNA ORF Clone vector (indicated as PAI-1) or empty vector. [score:1]
The cells were transfected with each firefly luciferase reporter vector, Renilla luciferase control vector, pRL-TK (Promega), and miR-30b mimics or miR-control (GenePharma). [score:1]
However, the role of miR-30b in tumorigenesis is controversial. [score:1]
U6 and β-actin served as internal normalized references for miR-30b and PAI-1 mRNA, respectively. [score:1]
miR-control- and miR-30b -transfected SGC-7901 (1×10 [6]) were suspended in 100 µl PBS and then injected subcutaneously into either side of the posterior flank of the same female BALB/c athymic nude mouse. [score:1]
miR-control- and miR-30b-tranfected SGC-7901 cells were injected subcutaneously into either posterior flank of the same nude mice. [score:1]
PAI-1 is potentially involved in miR-30b -induced apoptosis. [score:1]
This study provides new insights into the role of miR-30b in gastric cancers. [score:1]
Because we found that miR-30b played a more significant role in promoting SGC-7901 cells apoptosis than HGC-27 cells in vitro, we explore the role of miR-30b in tumorigenesis of gastric cancer using SGC-7901 cells. [score:1]
For GFP repression experiments, HEK-293 cells were seeded in 12-well plate at 1×10 [5] per well the day before transfection and then were cotransfected with the miR-30b mimics or miR-control with various GFP reporter vectors. [score:1]
The DNA oligonucleotide antisense probes used to detect miR-30b and U6 snRNA were as follows: miR-30b (5′- AGCTGAGTGTAGGATGTTTACA-3′) and U6 (5′-ATATGGAACGCTTCACGAATT-3′). [score:1]
Next, we also examined whether PAI-1 could abrogate the effect of promoting apoptosis by miR-30b. [score:1]
As shown in Figure 4C and 4D, GFP fluorescence was significantly reduced in cells transfected with GFP report vectors containing binding sites and miR-30b mimics, whereas there was no change of GFP fluorescence in cells transfected with mutant vector and miR-30b mimics. [score:1]
Viable miR-30b mimics- and miR-control -transfected SGC-7901 cells (1×10 [6]) were suspended in 100 µl PBS and then injected subcutaneously into either side of the posterior flank of the same female BALB/c athymic nude mouse at 4 to 6 weeks of age as described previously [25]. [score:1]
Taken together, our results suggest that PAI-1 is potentially involved in miR-30b-promoted apoptosis. [score:1]
[1 to 20 of 110 sentences]
2
[+] score: 286
This observation also raises the intriguing possibility that miR-30 mediated regulation of the miRNA pathway is a mechanism not specific to muscle cells, but rather a mechanism in all cells expressing miR-30 to antagonize the expression of all miRNA-regulated targets. [score:9]
To identify direct miR-30 family targets, we first utilized TargetScan 6.2 [20] to identify predicted targets. [score:8]
To determine whether modulating miR-30 family miRNA levels affects miRNA repression, we tested the ability of muscle-specific miR-206 to repress a known target, cyclin D1 (Ccnd1)[31], during miR-30 family over -expression or inhibition. [score:7]
Putative direct miR-30 family targets include epigenetic, transcriptional, and post-transcriptional regulators of gene expression. [score:7]
If miR-30 directly regulates the expression of these candidates at the mRNA level, one could expect de-repression in mdx4cv muscles where miR-30 family expression is reduced. [score:7]
Transcriptional, post-transcriptional and epigenetic regulation of gene expression are the most highly enriched GO terms in the set of predicted miR-30 family targets. [score:6]
While no change was observed for Nfyb and Ppargc1a, we found that Runx1, Smarcd2, and Tnrc6a were increased in their expression in the gastrocnemius muscles and that Snai2 trended towards an increase (P = 0.07) (Fig. 6C), indicating that these may be direct miR-30 targets. [score:6]
As expected, over -expression of miR-30a/b/c de-repressed Ccnd1 luciferase reporter activity (Fig. 7A), and miR-30 family inhibition enhanced Ccnd1 repression by miR-206 (Fig. 7B), showing that miR-30 family miRNAs can negatively regulate the activity of other miRNAs. [score:6]
miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animalsIn order to identify miRNAs that are dysregulated during muscle pathogenesis, we hypothesized that, as dystrophic muscle is undergoing constant cycles of degeneration/regeneration, miRNAs differentially expressed between dystrophic and healthy muscle may represent novel biomarkers of muscle homeostasis. [score:6]
Given these dynamic expression changes during adult myogenesis in vitro, changes in miR-30 family expression could also be expected during developmental myogenesis. [score:6]
Note miR-206 and miR-21 (red, overexpressed in mdx4cv) and miR-30 family (green, down-regulated in mdx4cv). [score:6]
When sorted for P-value, the functionally annotated biological processes that are most enriched in the list of predicted miR-30 family targets include the regulation of transcription, gene expression, and macromolecule synthesis (Fig. 6A). [score:6]
To narrow the candidate target list as well as gain insight into the biological processes and pathways that may be regulated by the miR-30 family, we took the 1133 predicted targets and performed gene ontology (GO) analysis using the Database for Annotation, Visualization and Integrated Discovery (DAVID) [21]. [score:6]
If miR-30 family miRNAs control miRNA repression by targeting Tnrc6a, we could expect that high levels of miR-30 would repress Tnrc6a levels resulting in global de-repression of miRNA targets and increased protein synthesis. [score:5]
Given our observed decrease in miR-30 family expression in a pathological setting of constant degeneration/regeneration (mdx4cv), we wanted to examine miR-30 family expression in other mo dels of skeletal muscle pathology, including regeneration after acute injury and muscle disuse atrophy. [score:5]
Numerous functions have been described for the miR-30 family, including regulation of fibrosis, apoptosis, and hypertrophy in cardiomyocytes [32– 34], regulation of pronephros development in the kidneys [35], as well as the regulation of the epithelial-to-mesenchymal transition in hepatocytes [36]. [score:5]
Additionally, miR-30 family miRNAs provide negative feedback on the miRNA pathway by targeting TNRC6A, leading to derepressed miRNA targets and increased protein synthesis. [score:5]
While smoothened is not predicted to be a conserved miR-30 family target in mice, the possibility exits that miR-30 family miRNAs play a critical role in the regulation of embryonic muscle development and fiber type specification. [score:5]
While others have identified Tnrc6a as a miR-30 family target [46], we are the first to show that miR-30 expression modulates the activity of other miRNAs and levels of protein synthesis. [score:5]
’ Therefore, by repressing the set of miR-30 targets present in the given cellular milieu while at the same time reducing the extent of other miRNA -mediated repression, miR-30 family can repress a current gene expression pattern and pave the way for a change in cellular state (Fig. 8). [score:5]
Following withdrawal of serum from the medium, we observed increases in miR-30a-5p (∼1.5 fold), miR-30b (∼2 fold) and miR-30c (∼2 fold) expression as differentiation progressed (Fig. 4A), indicating that the miR-30 family is expressed in myoblasts. [score:5]
To test if the reduction in miR-30 family miRNA expression found in dystrophic, injured and atrophic muscle correlates with expression changes in myoblasts, we measured miR-30a/b/c expression during C [2]C [12] myoblast differentiation in vitro. [score:5]
0118229.g006 Fig 6 (A) GO analysis of predicted miR-30 targets (TargetScan 6.2) is shown sorted by P-value for enriched biological processes. [score:5]
Interestingly, we found that inhibition of Tnrc6a expression by miR-30 family miRNAs reduces the activity of muscle-enriched miR-206, indicating that the miR-30 family constitutes a negative feedback mechanism on the miRNA pathway. [score:5]
analysis of RNA isolated from whole (A) gastrocnemius, (B) tibialis anterior (TA), and soleus (C) muscles of 3-month old WT and mdx4cv animals validates down-regulation of miR-30a-5p, miR-30b and miR-30c (miR-30a/b/c) by. [score:4]
0118229.g008 Fig 8 To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis. [score:4]
Tnrc6a, Smarcd2, and Snai2 are regulated by miR-30a/b/cTo validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture. [score:4]
For miRNA knockdown/overexpression, 40–50% confluent cells were transfected with indicated concentrations of antimiRs (miRagen Therapeutics) or pre-miRs (Ambion pre-miR-control [AM17110] or an equimolar mix of pre-miR-30a-5p [PM11062], pre-miR-30b [PM10986] and pre-miR-30c [PM11060]) using Lipofectamine 2000 transfection reagent (Life Technologies) according to the manufacturer’s instructions. [score:4]
Indeed, after normalizing to protein content, we found a significant ∼2-fold increase (P ≤ 0.05) in [3]H-tyrosine incorporation in miR-30b/d over -expressing myotubes when compared to controls (Fig. 7C), indicating that miR-30 family miRNAs promote high levels of protein synthesis, likely through de-repression of miRNA targets. [score:4]
To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis. [score:4]
In addition, we identify the chromatin remo deling component Smarcd2, the transcriptional repressor Snai2 and the miRNA pathway component Tnrc6a as direct miR-30 targets. [score:4]
The miR-30 family miRNAs belong to the same seed family and thus share identical seed sequences (S1 Fig. ) and likely regulate an overlapping set of targets. [score:4]
Through in vitro experiments and bioinformatic analysis, we have proposed a novel mechanism whereby miR-30 promotes the differentiation of myoblasts by both restricting the expression of Smarcd2 and Snai2 (both negative regulators of the myogenic gene program), as well as by antagonizing the miRNA pathway through repression of Tnrc6a. [score:4]
In zebrafish, Ketley et al. recently showed that the miR-30 family promotes a fast muscle phenotype during embryonic muscle development and that inhibition of the miR-30 family in zebrafish embryos increased the percentage of slow fibers [37]. [score:4]
0118229.g002 Fig 2qRT-PCR analysis of RNA isolated from whole (A) gastrocnemius, (B) tibialis anterior (TA), and soleus (C) muscles of 3-month old WT and mdx4cv animals validates down-regulation of miR-30a-5p, miR-30b and miR-30c (miR-30a/b/c) by. [score:4]
After injury, miR-30 family expression is reduced and reaches a minimum on day 3 post-injury (∼4–5 fold reduction in miR-30a/b/c) (Fig. 3A) corresponding to a time point at which the muscle is largely degenerating (S3 Fig. ), indicating a correlation between low miR-30a/b/c levels and muscle degeneration. [score:3]
Human miR-30 family expression. [score:3]
miR-30 regulates miRNA -mediated post-transcriptional regulation and protein synthesis. [score:3]
Here we show that the expression of miR-30 family miRNAs is dynamic in skeletal muscle pathologies, with low miR-30 being correlated with degeneration and muscle mass loss, and high miR-30 associated with myogenesis and protein synthesis. [score:3]
Identifying the cell-type specific expression pattern of the miR-30 family in WT and mdx4cv animals will be necessary to ascertain the pathogenic role of the miR-30 family. [score:3]
Notably, little has been published about the expression and role of the miR-30 family in skeletal muscle. [score:3]
miR-30 family target identification and validation. [score:3]
By deep sequencing small RNAs from wild-type C57Bl/6 (WT) and dystrophic mdx4cv gastrocnemius muscles, we found the miR-30 family miRNAs to be coordinately down-regulated when compared to WT. [score:3]
miR-30 family miRNAs promote a myogenic program in vitro To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts. [score:3]
Our results indicate that expression of the miR-30 family miRNAs is perturbed during alterations in muscle homeostasis in vivo, and that the miR-30 family miRNAs promote myoblast terminal differentiation and restrict proliferation in vitro. [score:3]
To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts. [score:3]
While these findings are in agreement with our observations of miR-30 family effects on proliferation and differentiation in vitro, we were unable to assess the expression pattern and function of miR-30 family members in non-muscle cell types in vivo. [score:3]
Another outcome of this hypothesis would be a general increase in protein synthesis in the presence of high miR-30 family miRNA levels, mediated by the de-repression of miRNA targets. [score:3]
We thus wondered whether ectopic miR-30 family miRNA expression could decrease the proportion of proliferating cells. [score:3]
In comparison to a scrambled pre-miR control at equivalent concentrations, EdU incorporation was reduced dose -dependently by 10% and 15% (P ≤ 0.05) in 10nM and 50nM transfected cells, respectively (Fig. 5C), indicating that high miR-30 family expression reduces the proportion of proliferating myoblasts in vitro. [score:3]
miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animals. [score:3]
We also show that miR-30 family expression is reduced in acute pathological conditions including BaCl [2] -induced injury and disuse atrophy. [score:3]
To test if the inverse is true, we utilized chemically modified, antisense oligonucleotides to inhibit miR-30 family function. [score:3]
In agreement with this argument, the validated miR-30 targets include the epigenetic SWI/SNF component Smarcd2, the transcription factor Snai2, and the post-transcriptional miRNA pathway component Tnrc6a. [score:3]
To validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture. [score:3]
validation of reduced miR-30 family miRNA expression. [score:3]
Given that fast twitch fiber-types are preferentially affected in DMD [38], it is tempting to speculate that the decrease in miR-30 family expression in mdx4cv muscle is a compensatory mechanism to promote an increase in slow-twitch, fatigue resistant fiber types. [score:3]
To further sort these candidates, we measured the expression levels of their mRNAs in mdx4cv skeletal muscles by, including Galnt7 as a positive control miR-30 target [28]. [score:3]
Interestingly, we also found that the normalized read counts for the entire miR-30 family were strikingly reduced in mdx4cv animals (Fig. 1B), and that the miR-30 family is the 5th most highly expressed miRNA family in skeletal muscle (Fig. 1C). [score:3]
Given the high abundance in skeletal muscle and differential expression, we decided to further investigate the expression and function of miR-30 family miRNAs in mammalian skeletal muscle. [score:3]
miR-30 family expression displayed relative to 15.5 dpc miR-30a-5p levels. [score:3]
In conclusion, we present a miRNA-seq dataset identifying a reduction in miR-30 family miRNA expression in dystrophic mdx4cv skeletal muscles. [score:3]
In another recent publication, Soleimani et al. proposed that miR-30 -mediated regulation of the transcriptional repressor SNAI1 facilitates entry into the myogenic gene program and promotes differentiation of primary mouse myoblasts [26]. [score:2]
miR-30 regulates miRNA -mediated repression and protein synthesis. [score:2]
Many of the studies published on various miR-30 family functions indeed report the regulation of transcription factors [26, 33, 35, 39, 40], indicating that the generalized function of miR-30 may be to control the switch from one cellular state (i. e. proliferating, differentiating, quiescent, etc. ) [score:2]
While the miR-30 family includes 5 mature miRNAs (miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e [NCBI: NR_029533, NR_029534, NR_029716, NR_029718, NR_029602]), for this study we have focused on miR-30a-5p, miR-30b and miR-30c (“miR-30a/b/c”) due to sequence similarity of miR-30a-5p, miR-30d and miR-30e (differing by only one nucleotide each) (S1 Fig. ). [score:1]
Twenty-four hours after transfection, quantification of myogenin -positive (MYOG+) nuclei indicated a striking 65% increase (P = 5e-5)(Fig. 5A), indicating that the miR-30 family promotes terminal differentiation of myoblasts in vitro. [score:1]
As indicated by the percentage of MyHC+ area, 24 hours following transfection antimiR-30 restricted the differentiation of C [2]C [12] myoblasts (Fig. 5B), again indicating that miR-30 family miRNAs promote myoblast differentiation. [score:1]
miR-30 family miRNAs promote a myogenic program in vitro. [score:1]
miRNA-seq reveals reduced miR-30 family miRNAs in mdx4cv muscles. [score:1]
Accordingly, we first performed barium chloride injury in the gastrocnemius muscles of WT animals to test regeneration after injury in vivo and measured miR-30 family expression on 1, 3, 7 and 14 days post-injury (DPI) in comparison to uninjured contralateral controls. [score:1]
This reduction was least pronounced in the slow-twitch soleus muscle, where baseline miR-30 levels are lower than in the gastrocnemius and TA muscles (S2 Fig. ). [score:1]
48 hours following the induction of differentiation, myotubes were infected with empty adenovirus (control) or adenoviruses encoding the miR-30a hairpin and the miR-30b/d cluster (kind gift of Dr. [score:1]
Sequence and organization of miR-30 family miRNAs. [score:1]
Mo del for miR-30 family mechanism of action. [score:1]
After reaching a minimum on day 3 post-injury (DPI), miR-30 levels begin to return towards uninjured levels on days 7 and 14. [score:1]
S1 Fig (A) Alignment of miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e shows conserved positions in bold and positions differing from miR-30a-5p in red. [score:1]
To this end we transfected proliferating C [2]C [12] with a representative synthetic miR-30 family member, miR-30a-5p, then performed 5-ethynyl-2’-deoxyuridine (EdU) proliferation analysis. [score:1]
Thus, we transfected C [2]C [12] myoblasts with an equimolar mix of synthetic pre-miR-30a-5p, pre-miR-30b and pre-miR-30c at 10nM total concentration. [score:1]
[1 to 20 of 79 sentences]
3
[+] score: 275
miR-30s are abundant in podocytes and are downregulated by TGF-β in vitro and in vivo Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice. [score:15]
B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice. [score:14]
The important role of TGF-β in controlling epithelial plasticity by promoting epithelial-to-mesenchymal transition (EMT) is well-documented [34] and is dependent on the coordinated upregulation of miR-155 and the subsequent inhibition of its target, RhoA, and the downregulation of miR-30 in mouse mammary epithelial cells [35]. [score:11]
Together, these results suggest that among the various miRs regulated by TGF-β in kidney disease, the TGF-β -induced downregulation of miR-30 may regulate apoptosis -associated target genes and their associated apoptotic pathways. [score:10]
Overexpression of miR-30 induced, while miR-30 reduction inhibited, the apoptosis of BT-ICs cells through affecting target Itgb3 expression. [score:9]
In silico predictions of miR-30 targets and functionTo obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www. [score:9]
Among the 190 genes that are upregulated in the glomeruli of Dicer [fl/fl]:NPSH2-Cre mice, the predicted miR-30 targets were highly enriched, suggesting a role for miR-30 in the gene expression and homeostasis of podocytes [16]. [score:8]
These findings demonstrate that miR-30s are abundantly expressed in the podocytes and parietal epithelial cells of glomeruli, and TGF-β downregulates miR-30 expression in podocytes both in vivo and in vitro. [score:8]
Moreover, we examined the precursors of these miR-30s in these RNA samples by qPCR, and the result showed that they were also downregulated in the glomeruli of Alb-TGF-β mice (Figure S2), suggesting that TGF-β regulates miR-30 expression at the transcription level. [score:7]
To obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www. [score:7]
Interestingly, miR-30 has recently been shown to target p53 directly in human cardiomyocytes, resulting in inhibition of Drp1 -mediated mitochondrial fission and apoptosis in response to oxidative stress [20]. [score:6]
Ongoing and future work will be needed to elucidate at the molecular level the mechanisms that mediate the concerted downregulation of all five miR-30 family members downstream of Smad2 and to determine how miR-30s inhibit the phosphorylation/activation of pro-apoptotic p53. [score:6]
However, the reported inhibitory mechanism of a direct miR-30-p53 target pairing differs from that observed in our results. [score:6]
In the current study, we report that miR-30s are expressed selectively and abundantly in glomerular podocytes in mice and that TGF-β profoundly downregulates miR-30 members in podocytes both in vivo and in vitro. [score:6]
We propose that the miR-30 family represents an attractive novel therapeutic target for the protection of podocytes in glomerular diseases, as our study demonstrated that maintenance of miR-30 levels above critical thresholds prevented podocyte apoptosis in the presence of TGF-β. [score:5]
Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A typical miR is predicted to target hundreds of genes based on the presence of its recognition motif(s) in the 3’ untranslated regions (UTRs) of the genes. [score:5]
Sustained expression of miR-30 inhibits TGF-β induced apoptosis of podocytes. [score:5]
Thus, because the miR-30-p53 target pairing is not evolutionarily conserved and is only observed in primate genomes, our findings provide an important, previously unknown alternative mechanism for the inhibition of p53 -mediated apoptosis by miR-30, at least in glomerular podocytes. [score:5]
File S1 Table S1, 155 miR-30 targets that are commonly predicted by TargetScan, PicTar, and miRbase, and conserved among human, dog, mouse and rat. [score:5]
There were 873 genes predicted to be miR-30 targets by TargetScan, 634 by PicTar, and 1,566 by miRbase. [score:5]
To determine whether a putative functional role of miR-30 could be predicted by in silico analysis of miR-30 target genes, we took a stringent approach and searched for potential miR-30 target genes that not only carry evolutionarily conserved miR-30 recognition motifs in their 3’-UTRs (Figure 2A) but also are consistently predicted by the three independent miR databases. [score:5]
uk/enright-srv/microcosm/htdocs/targets/), and then selected the common genes as our predicted miR-30 targets. [score:5]
miR-30 downregulation is required for activation of pro-apoptotic p53 by TGF-β. [score:4]
miR-30 precursors were downregulated in the glomeruli of Alb-TGF-β transgenic mice. [score:4]
Similarly, our results demonstrated for the first time that the concerted downregulation of all miR-30 members was specifically required for the activation of a central mediator of apoptosis, p53, by TGF-β. [score:4]
Downregulation of miR-30 members was required for TGF-β -induced apoptosis in visceral glomerular epithelial cells (podocytes). [score:4]
The finding that the TGF-β -induced downregulation of miR-30 may selectively promote apoptotic outcomes by permitting the activation of p53 expands our understanding of the emerging role of miRNAs in conferring biological specificity in cell type -dependent pluripotent TGF-β signaling networks. [score:4]
Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A. miR-30d transcripts were abundantly detected by in situ hybridization in podocytes (yellow arrows) and parietal epithelial cells (white arrows) in adult wildtype (wt) control mice, but not in Alb-TGF-β transgenic (Tg) mice; B. miR-30a, -30b, -30c, -30d, and -30e were significantly downregulated in cultured human podocytes after 6 and 24 hr of TGF-β treatment (5 ng/ml). [score:4]
Mechanistic studies demonstrated a novel and selective functional role for Smad2 -dependent downregulation of miR-30 in the TGF-β -mediated activation of pro-apoptotic p53, and this pathway was required for TGF-β -induced podocyte apoptosis. [score:4]
miR-30 downregulation by TGF-β is mediated by Smad2 -dependent signaling and does not require Smad3. [score:4]
These results suggest that Smad2 -dependent downregulation of miR-30 by TGF-β is required to specifically activate p53 signaling during podocyte apoptosis. [score:4]
TGF-β significantly downregulated levels of miR-30 members in wild-type podocytes and S3 KO podocytes (Figure 6B). [score:4]
In contrast, Smad2 -dependent signaling selectively downregulates miR-30 family transcripts to permit the activation of pro-apoptotic p53, which is required for caspase-3 activation and apoptosis. [score:4]
In contrast, TGF-β had no significant effect on miR-30 levels in S2 KO and D KO podocytes (Figure 6B), demonstrating that Smad2 mediates the TGF-β -induced downregulation of miR-30 in podocytes. [score:4]
B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. The novel findings reported in our work connect for the first time the miR-30 family with the TGF-β/Smad signaling network. [score:3]
Thirty out of 116 (26%) of the annotated miR-30 target genes were associated with apoptosis (Figure 2C, Table S2 in File S1). [score:3]
To validate the in silico predictions experimentally, we generated luciferase reporter vectors containing 3’-UTRs with miR-30 recognition sequences from 7 of the predicted target genes. [score:3]
Our results suggest that a high estimated percentage (~ 86%) of the 155 genes could be experimentally validated as genuine targets of miR-30. [score:3]
Thus, we conclude that an essential miR-30 threshold exists in podocytes, above which miR-30s can suppress pro-apoptotic factors and promote cell survival. [score:3]
Among these genes, 155 were predicted to be miR-30 targets in all three databases and were conserved in human, dog, rat and mouse (Table S1 in File S1). [score:3]
B. Bar graph showing the mean ± S. D. of the activity of luciferase reporter constructs carrying 3’ UTR sequence fragments of seven genes randomly chosen from the 155 predicted miR-30 target genes. [score:3]
Lentiviral miR-30 expression sustains miR-30 levels in podocytes treated with TGF-β. [score:3]
Although the precise physiological roles of miR-30s remain poorly understood, miR-30 members may promote tumor invasion and metastasis by targeting Galphai2 in liver cancer cells [19]. [score:3]
In silico predictions of miR-30 targets and function. [score:3]
Table S2, List of cell death associated genes from the 155 predicted miR-30 targets according to analyses of Inguinity System. [score:3]
Apoptosis associated genes are highly enriched among the predicted miR-30 targets. [score:3]
Reporter constructs were cotransfected with either a scrambled miR expression construct (control) or a synthetic miR-30 precursor (pre-miR-30a). [score:3]
Functional annotations were available in the Ingenuity Pathway Analysis software for 116 of the 155 predicted miR-30 targets. [score:3]
Maintenance of sufficient miR-30 levels may provide a new therapeutic strategy to promote podocyte survival and prevent podocyte depletion in progressive glomerular diseases. [score:3]
However, Itgb3 is not expressed in podocytes (data not shown), precluding the involvement of miR-30-Itgb3 pair in podocyte apoptosis. [score:3]
Because we demonstrated that miR-30 was specifically controlled by Smad2, but not Smad3, therapeutic supplementation of miR-30 may provide an approach to target pro-apoptotic TGF-β activity without interfering with homeostatic Smad3- or Cd2ap -dependent activities. [score:3]
To investigate whether miR-30 downregulation by TGF-β had any role in podocyte apoptosis, one of the miR-30 family members, miR-30d, was studied as a representative member of the family. [score:2]
Finally, TGF-β treatment of human podocytes cultured under non-permissive or permissive conditions significantly reduced the levels of all five miR-30 family members beginning at 6 hrs, as determined by qRT-PCR (Figure 1B). [score:1]
A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line). [score:1]
The miR-30 family consists of 5 evolutionarily conserved members, miR-30a through -30e. [score:1]
For example, we demonstrated for the first time that to induce apoptosis in podocytes, TGF-β signaling must decrease protective miR-30 levels specifically through the Smad2 -dependent pathway, whereas Smad3 is not required. [score:1]
miR-30 quantification in the RNA samples was conducted by qRT-PCR using the Ncode miRNA Amplification System (Invitrogen, Carlsbad, CA). [score:1]
Indeed, therapeutic maintenance of miR-30 may protect epithelial cells, including podocytes, from multiple pro-apoptotic stressors, including TGF-β (this work) and oxidative stress and hypoxia [20]. [score:1]
In addition, miR-30 has been implicated in the epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) via TGF-β signaling in anaplastic thyroid carcinomas [22]. [score:1]
Thus, it will be interesting to examine whether restoration of homeostatic miR-30 levels by therapeutic miR-30 replacement therapy will protect the survival of podocytes exposed to a range of common mediators of glomerular injury, including metabolic, mechanic, and toxic stressors. [score:1]
Moreover, we showed that sustaining miR-30 levels above this proposed threshold prevented both increases in protein and in phosphorylation of p53 in podocytes. [score:1]
0075572.g002 Figure 2 A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line). [score:1]
Note that at the age of 2 weeks the Alb-TGF-β mice had a ~ 20% podocyte loss according to our previous studies [8], which contributed to the miR-30 reduction in the glomeruli of Alb-TGF-β mice. [score:1]
Thus, we propose a novel pro-apoptotic TGF-β-Smad2-miR-30-p53 pathway that is necessary for caspase-3 activation and apoptosis in podocytes (Figure 8). [score:1]
[1 to 20 of 64 sentences]
4
[+] score: 212
Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation. [score:12]
The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene. [score:10]
shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells. [score:9]
Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c). [score:9]
a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d). [score:8]
Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells. [score:7]
Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells. [score:6]
To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv. [score:5]
The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation. [score:5]
As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells. [score:5]
Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest. [score:5]
However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30. [score:5]
In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15]. [score:5]
Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15]. [score:5]
Radiation -induced Mcl-1 downregulation was miRNA-30 dependent. [score:4]
Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b. [score:4]
In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells. [score:4]
Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c). [score:3]
The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21]. [score:3]
b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection. [score:3]
Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15]. [score:3]
Levels of miR-30b and miR-30c expression were determined by Quantitative Real Time-RT PCR in mouse (a) Serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation. [score:3]
miR-30b and miR-30c expression were examined 24 h post-transfection by quantitative RT-PCR. [score:3]
de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene. [score:3]
Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation. [score:3]
irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15]. [score:3]
However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood. [score:3]
; miR-30b and miR-30c expression were examined by quantitative RT-PCR 24 h post-transfection and U6 was used as a control. [score:3]
Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14]. [score:3]
d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells. [score:3]
As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter. [score:3]
CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co. [score:3]
However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
In contrast, Bcl-2 expression was not affected by miR-30 in these cells. [score:3]
Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells. [score:2]
In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation. [score:2]
In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation. [score:2]
Reverse transcription (RT) was performed using TaqMan [®] MicroRNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions, and the resulting cDNAs were quantitatively amplified in triplicate for miR-30b and -30c expression using TaqMan [®] MicroRNA specific primers for miR30b (ID#000602), miR30c (ID#000419) and U6 (ID#001973) on an IQ5 Real-Time PCR System (Bio-Rad, Hercules, CA). [score:2]
A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated. [score:2]
Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14]. [score:2]
Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown. [score:1]
β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation. [score:1]
c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated. [score:1]
NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc. [score:1]
There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c. [score:1]
The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d. [score:1]
The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR. [score:1]
We found that both miR-30b and miR-30c were highly induced by 5–9 Gy within 4 h in serum, in a radiation dose -dependent manner (Fig.   5a). [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid. [score:1]
In the current study, we demonstrated increased levels of miR-30b and miR-30c in mouse serum after 5–9 Gy WBI, and this increase was radiation dose -dependent. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells. [score:1]
Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure. [score:1]
[1 to 20 of 59 sentences]
5
[+] score: 198
The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point. [score:9]
We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e). [score:9]
To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists). [score:9]
Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS. [score:6]
Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:6]
We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases. [score:6]
We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e). [score:6]
” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9. [score:6]
We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium. [score:5]
Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. [score:5]
miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium. [score:5]
Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2). [score:5]
FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium. [score:5]
This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d). [score:5]
To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels. [score:4]
Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein. [score:4]
Up-regulation of miR-30 family members in myoblasts promotes differentiation (53). [score:4]
Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway. [score:4]
Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection. [score:4]
d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels. [score:4]
FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression. [score:4]
We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35). [score:4]
In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust. [score:4]
Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression. [score:4]
Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease. [score:3]
However, the predicted miR-30 target site in UBE3A is human-specific. [score:3]
miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation. [score:3]
Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard. [score:3]
Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
miR-30b and miR-30e targeting are shown in detail with predicted base paring colored in red. [score:3]
To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
At 24 h post-transfection, predicted miR-30 target sites were not enriched. [score:3]
FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation. [score:3]
FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway. [score:3]
Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses. [score:3]
This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b). [score:2]
Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well. [score:2]
Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. [score:2]
f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium. [score:2]
Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54). [score:2]
To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”). [score:2]
Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study. [score:2]
Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway. [score:2]
In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation. [score:2]
Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52). [score:2]
Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation. [score:2]
Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium. [score:2]
More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells. [score:2]
Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation. [score:2]
To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells. [score:1]
To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor. [score:1]
Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members. [score:1]
LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family. [score:1]
[1 to 20 of 55 sentences]
6
[+] score: 185
We recently reported that radiation upregulates miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30c plays a key role in radiation -induced human hematopoietic and osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) in these cells after γ-irradiation [19]. [score:9]
To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B). [score:8]
DT3 protected mouse BM hematopoietic progenitor cells and human hematopoietic stem and progenitor CD34+ cells from radiation damage, repressed the expression of radiation -induced proinflammatory factors IL-1β and IL-6 in mouse spleen, and we report for the first time that DT3 downregulated radiation -induced miR-30b and miR-30c expression in mouse tissues and serum and in human CD34+ cells. [score:8]
We reported recently that radiation upregulates miR-30b and miR-30c in human hematopoietic CD34+ cells, and miRNA-30c plays a key role in radiation -induced human hematopoietic and osteoblast cell damage by negatively regulating survival factor REDD1 expression in these cells after γ-irradiation[19]. [score:7]
DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum. [score:6]
Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells. [score:6]
DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum. [score:6]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells. [score:5]
These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines. [score:5]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells. [score:5]
In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown). [score:5]
In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells. [score:5]
We previously demonstrated radiation -induced miR-30b and miR-30c expression in human hematopoietic CD34+ cells [19], and here we further examined the effects of gamma-radiation on miR-30b and miR-30c expression in mouse tissues. [score:5]
In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells. [score:4]
To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression. [score:4]
We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells. [score:4]
Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33]. [score:4]
IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β. [score:3]
NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells. [score:3]
DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice. [score:3]
IL-1β significantly induced both miR-30b and miR-30c expression in CD34+ cells at all-time points. [score:3]
Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C). [score:3]
Next, miR-30b and miR-30c expression were validated in sham- or 2 Gy radiation with or without anti-IL-1β antibody -treated and siNFκB or control-siRNA transfected cells by quantitative real-time RT-PCR. [score:3]
Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation. [score:3]
Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells. [score:3]
DT3 treatment suppressed miR-30b and miR-30c in irradiated mouse serum at all time points in comparison with vehicle -treated samples. [score:3]
Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells. [score:3]
Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression. [score:3]
DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation. [score:3]
We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4]. [score:3]
Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation. [score:3]
DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling. [score:3]
Fig 7C shows that in the control-siRNA transfected samples, γ-radiation enhanced miR-30b and miR-30c expressions by 3- and 2.2-fold, respectively, in comparison with sham-irradiated cells. [score:3]
We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression. [score:3]
NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells. [score:3]
shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells. [score:3]
Modulation of miR-30 expression with IL-1β neutralizing antibody. [score:3]
Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment. [score:3]
0122258.g005 Fig 5 (A) Vehicle, DT3, or neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy radiation, and miR-30b and miR-30c expression were examined 1 h after irradiation. [score:3]
As expected, both miR-30b and miR-30c were expressed significantly in CD34+ cells 15 min after IL-1β addition and continually increased to 3-fold at 1 h after IL-1β-treatment as shown in Fig 5B (IL-1β + IgG). [score:3]
It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells. [score:3]
DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells. [score:3]
DT3-treatment completely blocked the radiation -induced expression of miR-30b and miR-30c in mouse BM, jejunum and liver cells compared with vehicle -treated mice (Fig 4B and 4C, N = 6/ group). [score:2]
DT3-treatment completely blocked the radiation -induced miR-30b and miR-30c expressions in mouse (B) BM cells after 7 Gy irradiation and in (C) jejunum and liver cells after 10 Gy irradiation, compared with vehicle -treated mice. [score:2]
Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI. [score:1]
In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells. [score:1]
in Fig 4D demonstrated the levels of miR-30b and miR-30c in serum changed in a radiation dose -dependent manner. [score:1]
This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum. [score:1]
In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells. [score:1]
We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown). [score:1]
We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types. [score:1]
These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals. [score:1]
Fig 5A shows that 2 Gy radiation increased miR-30b and miR-30c by 3- and 2.5-fold in vehicle -treated CD34+ cell samples, respectively. [score:1]
We added IL-1β into CD34+ cell culture and observed a significant miR-30b and -30c increase in these cells (Fig 5B). [score:1]
[1 to 20 of 54 sentences]
7
[+] score: 171
To further validate that lincRNA-p21 regulates TGFβ/Smad signaling through interacting with miR-30, we co -transfected lincRNA-p21 siRNA with miR-30 antagomir, showing that lincRNA-p21 siRNA failed to reduce KLF11 expression and suppress TGFβ/Smad signaling when miR-30 was inhibited (Fig.   7G). [score:8]
In our previous study, we found that miR-30 blunted TGF-β/Smad signaling in HSCs by targeting KLF11, which suppressed the transcription of inhibitory Smad7 in TGF-β/Smad pathway [31]. [score:7]
The luciferase activity increased in response to pCI-lincRNA-p21 in a dose -dependent manner, suggesting that ectopically expressed lincRNA-p21 sequestered endogenous miR-30 and prevented it from suppressing luciferase expression (Fig.   2E). [score:7]
We reasoned that, if hepatocyte lincRNA-p21 regulates liver fibrosis by interacting with miR-30, inhibition of miR-30 would show inhibitory effects on the protective function of AdH-shlincp21 in liver fibrosis. [score:6]
Here, we further revealed that the inhibition of KLF11 by miR-30 resulted in the upregulation of Smad7 in hepatocytes (Fig.   7A). [score:6]
Figure 3Ectopic expression of miR-30b in hepatocyte suppresses CCl [4] -induced liver fibrosis. [score:5]
Consistent with the histology results, hepatic expression of inflammatory genes, including interleukin-6 (IL-6), chemokine ligand 2 (CCL2) and IL-1β, were suppressed in AdH-miR-30 group (Fig.   3F). [score:5]
Ectopic expression of miR-30 greatly inhibited CCl [4] -induced liver fibrosis as observed by histological examination (Fig.   3A), and significantly decreased collagen deposition and hepatic hydroxyproline level (Fig.   3B). [score:5]
Collectively, these results provide convincing evidence that miR-30 can suppress TGF-β/Smad signaling by targeting KLF11 in hepatocyte. [score:5]
To ascertain the underlying mechanism responsible for miR-30 decrease in response to TGFβ, we determined the expression of pri-miR-30s in TGFβ -treated AML12 cells, showing that TGFβ didn’t obviously suppress the transcription of pri-miR-30s (Supplementary Figure  S4C). [score:5]
Here, our results demonstrate that hepatocyte miR-30 greatly inhibits fibrotic TGF-β/Smad signaling by targeting KLF11 and consequently prevents liver fibrosis. [score:5]
Figure 5Inhibition of miR-30 impairs the effects of lincRNA-p21 knockdown on CCl [4] -induced liver fibrosis. [score:4]
Here, we provide the first evidence that TGF-β -induced lincRNA-p21 inhibited miR-30 by directly binding to them. [score:4]
We previously found that hepatic miR-30s decreased in the fibrotic liver and HSC-specific upregulation of miR-30 prevented liver fibrosis [31]. [score:4]
The presence of competitive miR-30 antagomir abolished the inhibitory effects of lincRNA-p21 knockdown on TGF-β signaling and liver fibrogenesis, indicating that lincRNA-p21 functions as a ceRNA. [score:4]
The expression of hepatic profibrogenic markers (α-SMA, Col1a1, TGF-β1, CTGF and TIMP-1) also significantly increased in anti-miR-30 group (Fig.   5C). [score:3]
In contrast, miR-30 antagomir inhibited endogenous miR-30 and increased the luciferase activity (Fig.   2D). [score:3]
However, the increase of luciferase activity was suppressed by miR-30b (Supplementary Figure  S5B). [score:3]
The suppression of luciferase activity by lincRNA-p21 siRNA was reversed by miR-30 antagomir (Supplementary Figure  S5C). [score:3]
To test this, we constructed adenovirus AdH-miR-30 and AdH-NC that can specifically express miR-30b or control in hepatocyte in vivo under the control of albumin promoter. [score:3]
AdH-miR-30 could significant increased miR-30b expression in AML12, but not in the cultured HSC cell line HSC-T6 (Supplementary Figure  S2B). [score:3]
Basing on these results, we propose that TGF-β -induced lincRNA-p21 in turn strengthens TGF-β signaling by interacting with miR-30, thus forming a positive feedback loop to ensure lincRNA-p21 expression and mediate the role of TGF-β in promoting liver fibrosis. [score:3]
In the isolated hepatocytes from fibrotic liver injected with AdH-miR-30, ectopic expression of miR-30b led to decrease of KLF11 and increase of Smad7 in hepatocyte in vivo (Fig.   7A). [score:3]
Moreover, miR-30b expression increased in the hepatocytes of AdH-miR-30 -injected mice, but not in the HSCs (Fig.   3D). [score:3]
Hepatocyte miR-30 inhibits liver fibrosis. [score:3]
Notably, TGF-β1, Col1a1 and tissue inhibitor of metalloproteinase-1 (TIMP-1) were also greatly reduced in the AdH-miR-30 -injected mice. [score:3]
AML12 cells were transfected with lincRNA-p21 siRNA for 24 h and then treated with TGF-β1 for 2 h. (G) Inhibition of miR-30 impairs the effects of lincRNA-p21 siRNA on TGF-β/Smad signaling. [score:3]
showed that miR-30b greatly inhibited the phosphorylation of Smad2 and Smad3 in TGF-β1 -treated AML12 cells (Fig.   7B). [score:3]
In addition, hepatic expression of IL-6, IL-1 and CCL2 significantly increased in anti-miR-30b group mice (Fig.   5D). [score:3]
Overexpression of lincRNA-p21 (Supplementary Figure  S1B) significantly reduced miR-30b, -30c, -30d and -30e levels (Fig.   2A). [score:3]
To examine the interactions between lincRNA-p21 and miR-30, the nontumorigenic mouse hepatocyte cell line AML12 were transiently transfected with the expression plasmid pCI-lincRNA-p21 that contains the murine lincRNA-p21 cDNA. [score:3]
However, in anti-miR-30 group, AdH-shlincp21 failed to exert the inhibitory effects (Fig.   5A and B). [score:3]
In the present study, we find that hepatocyte lincRNA-p21 can function as a ceRNA by binding miR-30, and therefore participating in the regulation of TGF-β signaling and liver fibrosis. [score:2]
Hepatocyte lincRNA-p21 regulates liver fibrosis through interacting with miR-30. [score:2]
To date, the mechanism of miR-30 deregulation in various states is mostly unknown. [score:2]
To test our hypothesis, anti-miR-30, a phosphorothioate -modified antisense oligonucleotides specific for miR-30, and scrambled control (SCR), were intravenously injected into CCl [4] -treated mice weekly during the liver fibrosis development. [score:2]
However, the injection of miR-30 antisense oligonucleotides decreased miR-30b in the hepatocyte (Fig.   5F). [score:1]
Meanwhile, pCI-lincRNA-p21Mut, in which the predicted miR-30 binding site was mutated, failed to increase the luciferase activity (Fig.   2E). [score:1]
AML12 cells were transfected with miR-30b mimics, changed to serum-free DMEM for 24 h and then treated with TGF-β1 for 2 h. p-Smad2, p-Smad3 and total Smad2, Smad3 were detected by western blot. [score:1]
Total inputs (Input-Biotin-NC and Input-Biotin-miR-30b) are indicated as total RNA isolated from Biotin-NC or Biotin-miR-30b -transfected AML12 cells. [score:1]
Collectively, our results suggest that hepatocyte lincRNA-p21 contributes to liver fibrosis by interacting with miR-30. [score:1]
miR-30 enrichment was determined by qRT-PCR and normalized to control. [score:1]
AML12 cells were transfected with biotinylated miR-30b (Biotin-miR-30b) or its biotinylated mimic control (Biotin-NC) for 24 h. Cells were then harvested for biotin -based pull-down. [score:1]
RT-PCR and qRT-PCR results confirmed that lincRNA-p21 was specially pulldown by biotinylated miR-30b (Fig.   2G). [score:1]
AML12 cells were co -transfected with lincRNA-p21 siRNA and miR-30b antagomir for 24 h and then treated with TGF-β1 for 2 h. Left, p-Smad2 and total Smad2 were detected by western blot; Right, miR-30b levels were determined by qRT-PCR. [score:1]
Moreover, the transcribing of pri-miR-30 wasn’t affected by TGF-β, and thus strongly suggesting the underlying mechanism responsible for miR-30 decrease in response to TGF-β. [score:1]
The increase of lincRNA-p21 in hepatocyte was associated with the loss of miR-30 during liver fibrosis. [score:1]
Figure 2LincRNA-p21 interacts with miR-30. [score:1]
de/rnahybrid/) further revealed a healthy minimum free energy of hybridization between lincRNA-p21 and miR-30 family members (Supplementary Figure  S1A). [score:1]
However, at this stage, we can’t exclude the possibility that the decrease of miR-30 may be triggered by other mechanisms in liver fibrosis. [score:1]
Notably, increased infiltration of macrophages was limited in AdH-miR-30 group mice (Fig.   3E). [score:1]
The specific association between miR-30 and lincRNA-p21 was also validated by affinity pull-down of miR-30. [score:1]
To confirm the interaction between lincRNA-p21 and miR-30, we inserted the lincRNA-p21 cDNA downstream of the firefly luciferase reporter gene. [score:1]
Left, AML12 were transfected with miR-30b mimics for 24 h. Right, primary hepatocytes were isolated from fibrotic liver injected with AdH-NC or AdH-miR-30. [score:1]
Two days before the first injection of CCl [4], AdH-miR-30 or AdH-NC was injected into mice via tail vein. [score:1]
Thus, we hypothesized that hepatocyte lincRNA-p21 and miR-30 are inversely associated and involved in liver fibrosis. [score:1]
Transfection of miR-30 greatly decreased the luciferase activity of the wild type reporter with normal binding sites for miR-30, but not that with the mutant binding sites. [score:1]
Notably, we have previously reported that TGF-β1 reduced miR-30 in hepatocyte [35]. [score:1]
Moreover, the miR-30s in the isolated hepatocytes from AdH-shlincp21 group mice significantly increased, suggesting that AdH-shlincp21 might prevent liver fibrosis by increasing miR-30 in hepatocyte (Fig.   4F). [score:1]
Figure 7LincRNA-p21 enhances TGF-β/Smad signaling in hepatocyte by interacting with miR-30. [score:1]
Thus, TGFβ -induced lincRNA-p21 might be responsible for the decrease of miR-30. [score:1]
These phenomena depend on the interaction between lincRNA-p21 and miR-30. [score:1]
Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-shlincp21 and SCR (AdH-shlincp21 + SCR, n = 6) and CCl [4] in combination with injection of AdH-shlincp21 and anti-miR-30 (AdH-shlincp21 + anti-miR-30, n = 6). [score:1]
Administration of AdH-miR-30 led to miR-30b increase in the liver tissue (Fig.   3C). [score:1]
AdH-shlincp21 prevented the increase of hepatocyte lincRNA-p21 and led to a significant increase of miR-30b in the isolated hepatocytes from fibrotic liver (Fig.   5E). [score:1]
Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-NC (CCl4 + AdH-NC, n = 6) and CCl [4] in combination with injection of AdH-miR-30 (CCl4 + AdH-miR-30, n = 6). [score:1]
Thus, lincRNA-p21 may be able to function as a ceRNA for miR-30. [score:1]
LincRNA-p21 is physically associated with the miR-30. [score:1]
[1 to 20 of 68 sentences]
8
[+] score: 159
Our results show the upregulation of miRNA-30b and downregulation of its target gene, Sirt1 in NSCs derived from non-malformed embryos from diabetic mice which suggest that cognitive deficiency or neuropsychological deficits that are said to be associated with maternal diabetes (in the absence of anatomical anomaly) may be mediated by Sirt1 downregulation. [score:12]
Among the differentially expressed miRNAs, members of miRNA-30 family (miRNA 30a, b, c, d, and e) were chosen for further studies as they have been found to be: (a) upregulated significantly (fold change ranging from 1.15–1.52) in NSCs from embryos of diabetic pregnancy (Supplementary Table 4); (b) involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015). [score:7]
analysis revealed that overexpression of miRNA-30b but not miRNA-30d could significantly decrease the expression of Sirt1 protein suggesting that Sirt1 may be a target of miRNA-30b (Figures 6C,D). [score:7]
In order to verify that miRNA-30b increased astrocytes via down regulating its specific target Sirt1, Sirt1 was silenced using siRNA in NSCs and the expression of MAP2, GFAP, and CNPase proteins were analyzed. [score:6]
Overexpression of miRNA-30b resulted in significant decrease in the expression of MAP2 (neuronal marker) and CNPase (early oligodendrocyte marker) proteins and increase in the expression of GFAP (astrocyte marker) protein when compared to that in negative control (Figures 7B,C). [score:6]
In the present study, miRNA-30 family was found to be up regulated in NSCs from diabetic pregnancy when compared to control, suggesting that maternal diabetes alters the expression of miRNA-30 family and its target genes, which may perturb brain development in offspring of diabetic mothers. [score:6]
In addition, immunostaining and confocal imaging following miR-30b overexpression revealed decreased expression of Sirt1 in miRNA-30b overexpressed cells when compared to negative control (Figure 6E). [score:6]
In addition, miRNA-30d expression levels are found to be affected in brains of female schizophrenic patients (Mellios and Sur, 2012), thus emphasizing the importance of miRNA-30 family in brain development and disease. [score:6]
In addition, we found that hyperglycemia increased the expression of miRNA-30 family, in particular miRNA-30b that altered NSC differentiation via down regulation of its target, Sirt1 in NSCs. [score:6]
However, knockdown of Sirt1 also increased the expression of CNPase (in contrast to miRNA-30b overexpression). [score:6]
The expression levels of neuronal and glial markers were determined following overexpression of miRNA-30b in NSCs in order to understand the role of miRNA-30b on NSC fate specification. [score:5]
miRNA-30 family is found to have diverse functions in the brain during development and disease, with well-known roles in regulating epithelial-to-mesenchymal transition (EMT) (Kumarswamy et al., 2012). [score:5]
Further in particular, overexpression of miRNA-30b and decreased expression of Sirt1 favored the differentiation of NSCs to astrocytes at the expense of neurons. [score:5]
Following transfection, the luminescence intensity was found to be significantly decreased in miRNA-30b mimic transfected cells (Figure 7A) suggesting that miRNA-30b binds to its complementary site in the 3′UTR of Sirt1 and directly regulates the expression of Sirt1. [score:5]
NC, negative control; miRNA-30b OE, miRNA-30b over expression; miRNA-30d OE, miRNA-30d over expression. [score:5]
siRNA -mediated knockdown of Sirt1 in NSCs led to an increase in GFAP with a concomitant decrease in MAP2 proteins similar to miRNA-30b overexpression (Figures 8D,E). [score:4]
MicroRNA-30b promotes axon outgrowth of retinal ganglion cells by inhibiting Semaphorin3A expression. [score:4]
Members of the miRNA-30 family i. e., miRNA-30a and miRNA-30d, are enriched in layer III pyramidal neurons and have been shown to target BDNF during development (Mellios and Sur, 2012). [score:4]
Sirtuin1 is a direct target of miR-30b. [score:4]
Among the differentially expressed miRNAs in NSCs from diabetic pregnancy, the miRNA-30 family has been proposed to play critical role in maternal diabetes -induced neural tube anomalies as it has been shown to be involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015). [score:4]
From the pathway analysis, Sirtuin1 (Sirt1), which is predicted to be one of the targets of miRNA-30b was selected for further analysis as it has been shown to be involved in NSC differentiation and fate determination during brain development (Hisahara et al., 2008; Prozorovski et al., 2008). [score:4]
The NSCs from normal pregnancy were transfected with miRNA-30b or miRNA-30d mimics, in order to overexpress these miRNAs. [score:3]
One of the miRNA-30 family members, miRNA-30b is found to target Sirt1 which belongs to the Sirtuin family of proteins with seven members of the family being reported to exist in mammals. [score:3]
Figure 5 (A) qRT-PCR showing the expression pattern of miRNA-30 family. [score:3]
2017.00237/full#supplementary-material Supplementary Figure 1 Gene targets of miR-30 family are depicted. [score:3]
Gene targets of the miRNA-30 family were predicted using IPA (Supplementary Figure 1). [score:3]
NC -negative control, miRNA-30b OE—miRNA-30b over -expression. [score:3]
In order to confirm that Sirt1 is a direct target of miR-30b, a 3′UTR plasmid assay was performed. [score:3]
Figure 6 (A) qRT-PCR result shows increase in miR-30b expression following transfection with miR-30b mimics. [score:3]
Further, quantitative RT-PCR analysis was performed to validate the expression levels of miRNA-30 family (miRNA-30 b, c, d, and e) in NSCs from embryos of diabetic and control pregnancy. [score:3]
miRNA-30b alters the fate specification of NSCs via down regulation of Sirt1. [score:2]
miRNA-30 family and brain development. [score:2]
Following transfection, the expression of miRNA-30b and miRNA-30d increased 60-fold (Figure 6A) and 40-fold (Figure 6B), respectively, when compared to negative control. [score:2]
The expression of miRNA-30b and miRNA-30d were quantified by RT-PCR with Exilent SYBRGreen master mix (Exiqon) and microRNA primers for miRNA-30b or miRNA-30d (Exiqon) in 96 well-FAST optical plates (7900 HT, Applied Biosystems). [score:2]
Sirt1 plasmid containing the 3′UTR of Sirt1 gene was co -transfected with miRNA-30b mimic or negative control mimic in BV2 cells. [score:1]
There was significant up regulation of miR-30b and miR-30d in NSCs from diabetic pregnancy (open bars) when compared to normal (black bars). [score:1]
of miR-30b mimics (Ambion, ThermoFisher Scientific) and negative control probes (Ambion, ThermoFisher Scientific) were performed using lipofectamine RNAiMAX (ThermoFisher Scientific) in OptiMEM media at a final concentration of 10 nM. [score:1]
Among the other miRNAs, our results highlight that miRNA-30b controls NSC fate determination via Sirt1, since Sirt1 has been shown to be involved in the final fate specification of NSCs (Cai et al., 2016). [score:1]
Supplementary Table 4Fold change and p-value of miRNA-30 family. [score:1]
BV2 cells were co -transfected with miR-30b mimics or negative control mimics (at 10 nM) and plasmid vector containing luciferase gene and 3′UTR of Sirt1 gene (308 ng) (MmiT054166-MT06) using Lipofectamine® RNAiMAX (Thermofisher Scientific). [score:1]
While miR-30b and miR-30d were significantly up regulated in NSCs from embryos of diabetic pregnancy when compared to the control, miRNA-30c and miRNA-30e showed an increasing trend (Figure 5A). [score:1]
[1 to 20 of 41 sentences]
9
[+] score: 159
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B). [score:7]
miR-30 targets were predicted using TargetScan. [score:5]
These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage. [score:5]
0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells. [score:5]
In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC. [score:5]
Our data also indicate that miR-30b/c represses runx2 mRNA; however, overexpression of miR-30d increased runx2 expression, through unknown mechanisms. [score:5]
mRNA expression patterns of miR-30 targets in mMSC line. [score:5]
Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB). [score:5]
As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal. [score:5]
Expression pattern of miR-30 targets. [score:5]
For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells). [score:4]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
EED, named after embryonic ectoderm development, is another novel target of miR-30. [score:4]
miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts. [score:4]
These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members. [score:3]
One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported. [score:3]
List of predicted miR-30 targets. [score:3]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
Analysis of miR-30 targeting. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
In addition, two putative miR-30 targeting sites on spp1/osteopontin were found. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesis. [score:3]
Stem, Dev, signals M miR-30b LRP6 −0.5 Frizzled co-receptor for Wnt signaling Dev, signal M miR-30b LIN28A −0.46 Inhibit pri-let-7 maturation in cytoplasm. [score:3]
miR-30 targeting prediction. [score:3]
These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c. [score:3]
As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78. [score:3]
0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction. [score:3]
Known target of miR-30. [score:3]
miR-30 targeting in mMSC line. [score:3]
Matching around the 3′ part and intermediate part of miR-30 were tested to those targets. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58). [score:3]
miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis. [score:3]
Prediction of miR-30 targeting. [score:3]
Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction. [score:3]
Dev, Txn N miR-30b hnRNPA3 −0.96 hnRNPA family directly bind to mRNA for nuclear export. [score:2]
RNA N/C miR-30b EED −0.9 Embryonic ectoderm development. [score:2]
Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability. [score:2]
As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B). [score:2]
miR-30b/c repress hspa5, eed, ccn1/2/3, hnrnpa3 vC (A), lin28a, opn/spp1 (B), lifr and runx2 (C) in MSC stage. [score:1]
Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2). [score:1]
0058796.g007 Figure 7(A) List of mature miR-30 family members. [score:1]
This repression is released during osteogenesis due to reduction of miR-30b/c, especially significantly in increase in opn/spp1, lin28a (B), lifr and runx2 (C). [score:1]
In this mo del, miR-30b/c represses hspa5, eed, ccn1/2/3, hnrnpa3 vC (Fig 11A), opn/spp1, lin28a (Fig 11B), lifr and runx2 (Fig 11C) at the MSC stage. [score:1]
Dev, Epige, Stem N, Chro miR-30b CCNE2 −0.84 G1/S transition Cell cycle N miR-30b YOD1 −0.7 DeUbiquitination enzyme Protein Modi miR-30b WDR82 −0.61 WD repeat domain protein. [score:1]
These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family. [score:1]
Osteo-induction transiently induces hspa5, eed, ccn1/2/3 and hnrnpa3 vC, thereafter those transcripts are attenuated by miR-30b/c in early stage and by miR-30a/d/e in osteocytic stage (A). [score:1]
Txn N miR-30b Sox9 −0.6 Master transcription factor for chondrogenesis Dev, Txn N miR-30b LIFR −0.6 Key factor for ES cell self-renewal. [score:1]
This repression is released during osteogenesis upon reduction of miR-30b/c, a change especially significantly in increase in opn/spp1, lin28a (Fig 11B), lifr and runx2 (Fig 11C). [score:1]
Mature miR-30 quantification during osteocytogenesis. [score:1]
Homologous nucleotides among miR-30a/d/e or between miR-30b/c were shown in bold. [score:1]
In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3). [score:1]
Osteo-inductive stimulation transiently induces hspa5, eed, ccn1/2/3 and hnrnpa3 vC, but thereafter those transcripts are attenuated by miR-30b/c at the early stage and by miR-30a/d/e during the osteocytic stage (Fig 11A). [score:1]
These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation. [score:1]
Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family. [score:1]
Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis. [score:1]
WD protein associated, miR-30-specificity. [score:1]
Phos Sig C miR-30b Runx2 −1 Master transcription factor for osteoblast differentiation. [score:1]
All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A). [score:1]
On the other hands, miR-30b/c 5′ seed as well as 3′ part was matched with 3′-UTR sequences of spp1/opn, pcgf5, hspa5/grp78 and ctgf/ccn2. [score:1]
We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation. [score:1]
Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541. [score:1]
[1 to 20 of 61 sentences]
10
[+] score: 137
Potential targets of miR-30b were searched amongst the 56 genes downregulated. [score:6]
However we found deregulated at least two genes (Bglap2 and Il1f9) regulated by Runx2, a direct target of miR-30 family [7], [9]. [score:6]
To determine if miR-30b upregulation has an impact on the cellular miRNA biosynthesis machinery, the expression of three miRNA (let-7c, miR-26a and miR-145) and Dicer, Drosha and Exportin5 were analyzed in the mammary gland of these two transgenic lines, by RT-qPCR (Figure S1). [score:6]
The expression of miR-30b was found to be regulated during mammary gland development. [score:5]
miR-30b expression was normalized to U6 expression. [score:5]
miR-30b expression changes during mouse mammary gland development. [score:4]
B/ Relative expression of miR-30b was determined by RT-qPCR at 3 different physiological stages (virgin week-6, lactation day-12 and involution day-6) in the two transgenic lines (Tg12 and Tg33). [score:3]
Relative expression of miR-30b was determined by RT-qPCR at different physiological stages. [score:3]
Number, size and aspect of lipid droplets are affected by overexpression of miR-30b during lactation. [score:3]
The transcriptomic data confirmed the histological analyses on the effect of the overexpression of miR-30b on a delay of the involution. [score:3]
Recent data highlighted a role of miR-30 in the inhibition of EMT in hepatocytes [13], process which is important for mammary gland involution. [score:3]
The transgene, consisting of the mouse precursor of miR-30b (pre-miR-30b) under transcriptional control of the MMTV-LTR (Figure 2A) that is designed to drive preferential expression of the transgene in the mammary tissue [38], was micro -injected in FVB/N eggs. [score:3]
com/) was used to assess the top network functions associated with the overexpression of miR-30b (Table 1). [score:3]
However the overexpression of miR-30b affects also the involution by a delay in the process. [score:3]
This profile is consistent with the results of others obtained by bead -based flow-cytometric profiling [37] and suggests a developmental regulation of miR-30b in the mammary gland. [score:3]
0045727.g001 Figure 1Relative expression of miR-30b was determined by RT-qPCR at different physiological stages. [score:3]
gr) to be potential targets of miR-30b. [score:3]
miR-30b overexpression affects the mammary gland structure during lactation and involution. [score:3]
Growth of the pups is affected by overexpression of miR-30b. [score:3]
No difference in phenotype was noticed, by histology analysis, in the mammary gland collected from virgin and gestating mice, suggesting that miR-30b overexpression at these early stages has no major observable impact. [score:3]
Here, we used transgenic mice overexpressing miR-30b to investigate its role in the development and differentiation of mammary epithelial cells in vivo and we show that miR-30b deregulation leads to an impairment of mammary gland structure and function during lactation and involution. [score:3]
Apoptosis and proliferation processes are modified by overexpression of miR-30b during lactation. [score:3]
The tissue-distribution of the miR-30b overexpression in these two lines was further analyzed by RT-qPCR in several tissues (liver, muscle, ovary, lung, spleen and kidney (Figure S2)). [score:3]
None of these genes corresponds to experimentally validated target of miR-30b (Table 3). [score:3]
To determine the potential mechanisms by which overexpression of miR-30b induced this phenotype, Affymetrix Mouse Gene 1.1 [ST] arrays were performed using lactating day-12 RNA samples, prepared from 4 mice of each genotype (wild-type, lines Tg12 and Tg33) and hybridized individually. [score:3]
During normal mammary gland development miR-30b expression was decreased in the early stages of involution compared to lactation (Figure 1), and thereafter increased from early to late involution. [score:3]
miR-30b overexpressing mice display a mammary gland phenotype during lactation. [score:3]
miR-30b expression was detected at all stages (Figure 1). [score:3]
miR-30b expression level is strongly higher during lactation than virgin stage or during involution in mammary gland of transgenic mice. [score:3]
Relative expression of miR-30b was determined by RT-qPCR at different tissues (liver, muscle, ovary, lung, spleen and kidney) from the two transgenic lines (Tg12 and Tg33) and control (WT) animals. [score:3]
miR-30 family targets validated in the literature. [score:3]
The genes whose expression was affected by the overexpression of miR-30b were characterized by microarray analysis. [score:3]
miR-30b overexpression provokes a delayed in mammary gland involution. [score:3]
In muscle, lung and spleen, miR-30b was significantly overexpressed in transgenic mice (Tg12 and Tg33 lines) compared to wild-type mice (less than 4 fold). [score:2]
The miR-30 family is also involved in the control of structural changes in the extracellular matrix of the myocardium [14], in cellular senescence [15] and in the regulation of the apoptosis [16]. [score:2]
The levels of endogenous miR-30b during mammary gland development and differentiation were assessed by RT-qPCR. [score:2]
The miR-30b upregulation was explored in mammary gland involution and tissue integrity was evaluated by whole-mount and histologic analyses. [score:2]
Our data suggests that miR-30b is important for the biology of the mammary gland and demonstrates that the deregulation of only one miRNA could affect lactation and involution. [score:2]
miR-30b, in particular, is considered to be a tumor-suppressor miRNA [19]. [score:2]
The miR-30b expression was significantly higher in transgenic mice (Tg12 and Tg33 lines) compared to wild-type mice (p<0.05). [score:2]
miR-30b is a member of the miR-30 family, composed of 6 miRNA that are highly conserved in vertebrates. [score:1]
These observations could corroborate to recent published data on the miR-30 family that highlighted its role in the differentiation of various cell types including adipocytes [7], B-cells [8] or osteoblasts [9]. [score:1]
This study was undertaken to determine the role of miR-30b on the establishment of a functional mouse mammary gland. [score:1]
The miR-30 family is highly conserved in Vertebrates, it is composed by 6 miRNA (miR-30a, -30b, -30c-1, -30c-2, -30d and -30e) and it is organized in 3 clusters of two miRNA localized on 3 different chromosomes. [score:1]
The role of miR-30b in the proliferation or in the involution was recently demonstrated, by Ichikawa and colleagues [19] and Li and colleagues [16], respectively. [score:1]
In conclusion, the overexpression of miR-30b causes a defect in lactation characterized by the presence of acini structures with abnormally small lumen. [score:1]
pMMTV = mouse mammary tumor virus promoter, Pre-miR-30b = precursor of miR-30b, SV40i = SV40 small T antigen intron. [score:1]
The mouse precursor of miR-30b (pre-miR-30b) was under the control of MMTV-LTR. [score:1]
Generation of miR-30b transgenic mice. [score:1]
Transgenic mice overexpressing miR-30b in mammary epithelial cells were used to investigate its role. [score:1]
[1 to 20 of 50 sentences]
11
[+] score: 103
Figure 7(A) Representative images of HUVECs with miR-30b overexpression (HUVEC [miR-30b]) and their negative control (HUVEC [scrambled]); (B) The expression of miR-30b; (C) Representative images of tube-like structures and quantitative analysis of the total tube length (4× magnification microscopic fields); (D) TargetScan shows that 3′ UTR of DLL4 contains conserved miR-30 family binding sites; (E and F) The expression of DLL4 in HUVECs (mRNA and protein, respectively) (* P < 0.05 vs HUVEC [scrambled]). [score:9]
Overexpression of miR-30b downregulates DLL4 expression in HUVECs. [score:8]
Infecting MSCs with miR-30b not only upregulated the expression of miR-30b in MSCs, but also increased its expression in exosomes derived from these cells. [score:8]
In addition, synthetic anti-miR-30b (Ambion) was transfected into MSCs using Lipofectamine™ RNAiMAX (Invitrogen) to downregulate the expression of miR-30b in MSCs. [score:6]
Figure 6(A) The expression of miR-30b in MSC [miR-30b] (* P < 0.05 vs MSC [scrambled]) and in exosomes derived from MSC [miR-30b] (Exo [miR-30b]) ([&], P < 0.05 vs Exo [scrambled]); (B) Representative images of capillary-like structures and quantitative analysis of the total tube length (4× magnification microscopic fields) ([&] P < 0.05 vs Exo [scrambled]); (C) The expression of miR-30b in MSC [anti-miR-30b] (* P < 0.05 vs MSC [NTC]) and in Exo [anti-miR-30b] ([&] P < 0.05 vs Exo [NTC]); (D) Representative images of tube-like structures in HUVECs and quantitative analysis of the total tube length (4× magnification microscopic fields) ([&] P < 0.05 vs Exo [NTC]). [score:5]
In contrary, inhibiting expression of miR-30b in exosomes resulted in reduced angiogenesis. [score:5]
In another set of experiment, miR-30b was downregulated using synthetic anti-miR-30b in MSCs (MSC [anti-miR-30b]). [score:4]
Overexpression and knockdown of miR-30b in MSCs and HUVECs. [score:4]
Exosomes were obtained from MSCs in which miR-30b was overexpressed or knockdown, respectively. [score:4]
Previous studies reported that DLL4, one of miR-30 family targets, modulates endothelial cell behavior during angiogenesis [31, 45]. [score:3]
The pre-miR-30b-copGFP expression plasmid and scramble-copGFP control were purchased from System Biosciences Company. [score:3]
The cumulative tube length was significantly decreased in HUVECs treated with Exo [anti-miR-30b] (25.68 ± 3.49 mm/field) compared to those treated with Exo [NTC] (35.42 ± 3.01 mm/field) (Figure 6D), indicating that downregulation of miR-30b reduced the pro-angiogenic capacity of exosomes. [score:3]
Our study showed that DLL4 expression in HUVECs [miR-30b] was significantly reduced. [score:3]
TargetScan shows that the 3′ UTR of DLL4 contains the conserved miR-30 family binding sites (Figure 7D). [score:3]
In this study, the expression of 26 pro-angiomiRs was quantified in CdM [MSC] and screened out that miR-30b, miR-30c, miR-424 and let-7f were implicated in MSC -mediated angiogenesis. [score:3]
The expression of miR-424, miR-30c, miR-30b, and let-7f in conditioned medium was significantly reduced after adding into HUVECs culture for 48 h, indicating that extracellular miRs, derived from MSCs, transferred into HUVECs. [score:3]
The expression of miR-30b, 30c, 424 and let-7f in CdM [HUVEC-HUVEC] was very low and in CdM [MSC-MSC] was very high. [score:3]
A lentiviral system was used to attain effective overexpression of miR-30b in MSCs and HUVECs. [score:3]
miR-30 family targeted DLL4 in endothelial cells to promote angiogenesis [31]. [score:3]
The expression of miR-30b in HUVECs was verified by real-time PCR (Figure 7B). [score:3]
The expression of miR-30b in MSC [miR-30b] and exosomes derived from MSC [miR-30b] (Exo [miR-30b]) was 5.24-fold and 5.22-fold increase compared with their counterpart MSC [scrambled] and Exo [scrambled], respectively (Figure 6A). [score:2]
The cumulative tube length was increased in HUVECs treated with Exo [miR-30b] (54.98 ± 9.89 mm/field) compared to HUVECs treated with Exo [scrambled] (32.81 ± 4.68 mm/field), indicating that overexpression of miR-30b enhanced the pro-angiogenic capacity of exosomes (Figure 6B). [score:2]
Finally, HUVECs were directly infected with miR-30b (HUVEC [miR-30b]) using lentivirus carrying pre-miR-30b fragment (Figure 7A). [score:2]
The expression of DLL4 in HUVEC [miR-30b] was significantly reduced, compared to that in HUVEC [scrambled] (Figure 7E and 7F). [score:2]
The expression of miR-30b in MSC [anti-miR-30b] and exosomes derived from these cells (Exo [anti-miR-30b]) was significantly reduced, compared with their counterpart MSC [NTC] and Exo [NTC], respectively (Figure 6C). [score:2]
The expression of miR-30b, 30c, 424, and let-7f in HUVECs treated with exosomes for 24 h was significantly increased compared to those treated with BSA (Figure 4E). [score:2]
MSCs were infected with lentivirus carrying the pre-miR-30b fragment (MSC [miR-30b]). [score:1]
These results indicate that miR-30b carried by exosomes plays an important role in MSCs mediated angiogenesis. [score:1]
To demonstrate the effect of transferred miRs on angiogenesis, miR-30b was selected as a representative miR. [score:1]
miR-30b plasmid or scrambled plasmid and packaging plasmids were co -transfected into 293Ta cells according to manufacturer's instruction for production of high titer lentiviral particles. [score:1]
To determine the role of transferred pro-angiomiRs in angiogenesis, we selected miR-30b amongst the cluster of miRs (miR-30b, 30c, 424 and let-7f) discovered in this study for gain-and-loss function in MSCs. [score:1]
[1 to 20 of 31 sentences]
12
[+] score: 74
Among the 14 miRNAs, miR-30b/c, -133a/b, -195, -200a, -320 and −365 emerged as chief candidates of pathogenesis based on the inverse relationship with the increased expression level of their target genes in EHBD, high miRNA expression in EHBDs relative to livers (with the exception of miR-30b/c), expression in cholangiocytes of the biliary epithelium, and a decreased expression of miR-365, -195, -30 and -200a in a cholangiocyte line infected with RRV. [score:11]
al. [9] Notably, our findings of suppressed expression of miR-30b/c, -195, -200a and −365 in EHBDs are similar to the suppression reported previously; [9] however, the finding of high level of hepatic miR-29a was not strictly reproduced in EHBDs, which in fact had an increased expression of the family member miR-29b to 2.51 fold above saline controls at the time of duct obstruction. [score:9]
Functional analysis of these target genes revealed a significant relevance of miR-30b/c, -133a/b, -195, -200a, -320 and −365 based on increases in expression of at least 3 target genes in the same tissue and 1 [st]-to-3 [rd] tier links with genes and gene-groups regulating organogenesis and immune response. [score:8]
Among these, our data point to miR-30b/c as an attractive miRNA for future mechanistic studies to define how its expression in cholangiocytes and subepithelial cells modulate pathogenic mechanisms of disease by regulation of their target genes. [score:8]
Perhaps more relevant to our experimental mo del of a biliary disease (biliary atresia), only miR-30b/c, -200b, -204 and −320 have been reported to change their expression levels in cholangiocarcinoma tissues or cell lines, [10, 25- 28] with miR-30 family members increasing in lipopolysaccharide -induced NFκB activation in cholangiocytes and after Cryptosporidium parvum infection, and being required for hepatobiliary development [10, 25, 26]. [score:6]
Consistent with an involvement in our mo del, miR-30b/c had the largest number of target genes with increased expression at the times of duct obstruction and atresia, and the largest number of 1 [st] tier links with genes regulating inflammation and immunity, which are thought to be chief biological processes involved in the pathogenesis of biliary atresia. [score:6]
From the genes selected based on the increased expression at the time of atresia (14 days), 8 genes were increased, of which 6 were targets of miR-30b/c (Ceacam1, Gda, Eya2, 1110032A04Rik, Gclc, and Slc6a9; Figure  2B, Table  3, Additional file 9). [score:5]
In summary, using integrative bioinformatics to screen the biliary miRNA and mRNA expression profiles in a complementary fashion, the expression of miRNAs in a tissue and cell-specific fashion, and the predicted interaction with genes and gene-groups, we identified miR-30b/c, -133a/b, -195, -200a, -320 and −365 as candidate miRNAs with potential roles in pathogenesis of experimental biliary atresia. [score:5]
Thus, using integrative bioinformatics we could predict a prominent position for miR-30b/c and secondary positions for miR-133a/b, -195, -200a, -320 and −365 in a network based on the number of target genes and 1 [st] tier links with biological processes and pathways that involved the regulation of immunity and organogenesis, two classes of processes previously linked to pathogenesis of biliary atresia [2, 5]. [score:4]
The linkage of coordinately overexpressed genes with a small group of miRNAs (namely miR-30b/c, -195 and 200a) formed the rationale for informatics -based analyses to explore the relationship of these genes and miRNAs in terms of biological pathways and function. [score:3]
Among these, miR-30b/c, -195 and −365 had 1 [st] tier links to biological processes of hematology and inflammation by influencing the expression of Pim1, Il10ra, Il7r (miR-195), Arrb2 (miR-365), Pik3cd, Cmpk2, Socs3, Cysltr1, Serpine1 and Ceacam1 (miR-30b/c). [score:3]
From two comprehensive datasets displaying the expression of miRNAs and mRNAs in EHBDs at early phases of epithelial injury, onset of duct obstruction, and duct atresia, we identified miR-30b/c, -133a/b, -195, -200a, -320 and −365 as candidate miRNAs with potential roles in pathogenesis of experimental biliary atresia. [score:3]
Most notably, miR-30b/c has been reported to influence transforming growth factor beta 1 -induced epithelial to mesenchymal transition and biliary development and infection, [10, 24- 26] while miR-200b, [27] -204, [28] and −320 [28] have been linked to cholangiocarcinoma. [score:2]
Integrative genomics reveals functional relevance of miR-30b/c, -133a/b, -195, -200a, -320 and −365. [score:1]
[1 to 20 of 14 sentences]
13
[+] score: 62
Here we confirmed that Mtdh represents a target of mi-R30s in DN, and that the expression of all five miR-30 family members is downregulated in the glomeruli form streptozotocin -induced diabetic rats and HG -induced MPC5 cells. [score:8]
Mtdh protein expression was shown to be increased as well after the treatment with the miR-30 inhibitors (Figure 6e), whereas miR-30 mimics significantly reduced Mtdh expression in HG -induced MPC5 cells (Figure 6f). [score:7]
To assess the effects of miR-30s on the expression of Mtdh, we transiently transfected MPC5 cells with miR-30 inhibitors, synthetic miRNA mimics, or their NCs. [score:5]
Furthermore, miR-30 inhibitors significantly increased the expression of Bax and cleaved caspase 3 (Figure 7c). [score:5]
The obtained results demonstrated that miR-30a, -30b, -30c, -30d, and -30e mimics can significantly inhibit the luciferase activity of the wild-type Mtdh 3′-UTR reporter, but not that of the NC, and that this inhibition was reduced when the mutant reporter, with mutated miR-30 -binding site, was used (Figures 5d–h). [score:5]
Transient transfections with siRNAs, Mdth overexpression vector, miR-30 inhibitors, and miR-30 mimics. [score:5]
These cells were transfected with Mtdh siRNA (50 nM; GenePharma, Shanghai, China) or the overexpression (500 ng per well, GenePharma) the mixture of the mimics or inhibitors (RiboBio, Guangzhou, China) of all five miR-30 family members at the final concentrations of 50 nM, using Lipofectamine 2000 (Invitrogen) for 6 h in OPTI-MEM (Gibco BRL), according to the manufacturers' instructions. [score:5]
Mtdh represents a direct target of the members of miR-30 family. [score:4]
Mtdh mRNA level was shown to be significantly increased following the treatment with miR-30 inhibitors (Figure 6c), whereas miR-30s mimics led to a considerable reduction of Mtdh expression induced by HG (Figure 6d), compared with the corresponding NC treatment groups. [score:4]
Therefore, we studied miR-30 expression in the DN glomeruli and HG -induced MPC5 cells. [score:3]
Afterward, OPTI-MEM was replaced with the complete medium containing 1% FBS, and treated with HG for 48 h after the transfection with siRNAs or mimics, whereas the cells treated with miR-30 inhibitors were not treated with HG. [score:3]
MPC5 were transfected with miR-30 inhibitors, mimics, or the respective NCs. [score:3]
analysis demonstrated that the transfection of cells with miR-30 inhibitors significantly increased the percentage of apoptotic cells compared with the NC group (Figure 7a). [score:2]
[44] The 3′-UTR of Mtdh containing putative miR-30 -binding sites was amplified and cloned into PmiR-RB-REPORT dual-luciferase reporter vector (RiboBio). [score:1]
The treatment with miR-30 mimics considerably decreased HG -induced increase in the levels of these proteins (Figure 7d). [score:1]
Conversely, miR-30 mimics considerably reduced the rate of MPC5 apoptosis induced by HG (Figure 7b). [score:1]
[1 to 20 of 16 sentences]
14
[+] score: 61
Overexpression of miR-24, miR-30b, and miR-142-3p suppress type I cytokines by DCs. [score:5]
Enforced expression of miR-24, miR-30b, and miR-142-3p in untreated MΦ significantly induced (~1.5–2 fold) CD86 expression (Fig. 5a,b). [score:5]
Marked induction (~2–4.5 fold) in PD-L1 expression was observed in miR-24, miR-30b, and miR-142-3p overexpressing cells compared to control mimic (Fig. 5a). [score:4]
PD-L1 surface expression is induced in miR-24, miR-30b, and miR-142-3p transfected MΦ and DC. [score:3]
MΦ and DCs overexpressing miR-24, miR-30b, and miR-142-3p are defective in antigen processing. [score:3]
Time kinetics of antigen uptake and processing in MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p. [score:3]
miR-24, miR-30b, and miR-142-3p induce PD-L1 expression in APCs. [score:3]
MiR-24, miR-30b, and miR-142-3p mimics or inhibitors were purchased from Qiagen (Gaithersburg, MD, USA). [score:3]
Time kinetics of antigen uptake and processing in miR-24, miR-30b, and miR-142-3p overexpressing APCs. [score:3]
MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p exhibit impaired antigen processing. [score:3]
However, CD86 expression was significantly elevated only in miR-142-3p transfected MΦ treated with Ova while Ova treated or untreated DC transfected with miR-30b showed significant changes (Fig. 5a,b). [score:3]
Impaired T-cell proliferation by MΦ and DC overexpressing miR-24, miR-30b and miR-142-3p. [score:3]
Flow cytometric analysis showed antigen processing was reduced to approximately 22%, 38% and 40% in DC overexpressing miR-24, miR-30b and miR-142-3p, respectively (Fig. 1g–j). [score:3]
In this study we demonstrate an inhibitory effect of miR-24, miR-30b, and miR-142-3p on the uptake as well as processing of Ova by APCs. [score:3]
Taken together, these results show that Th1 activation -associated cytokine profiles are suppressed in DC transfected with miR-24, miR-30b, and miR-142-3p. [score:3]
MΦ transfected with miR-24, miR-30b and miR-142-3p mimics show reduced green signal compared to control mimics (Fig. 1a) suggesting impaired antigen processing upon enforced expression of the miRNA mimics. [score:2]
Compared to control mimic, no significant differences were noted in the presence of miR-24, miR-30b or miR-142-3p inhibitor (Fig. 1e). [score:2]
Overall, our results highlight novel mechanistic insights through which miR-24, miR-30b and miR-142-3p can regulate activation of adaptive immune responses guided by APCs. [score:2]
miR-24, miR-30b, and miR-142-3p impair Ova specific T-cell proliferation. [score:1]
We therefore examined the impact of miR-24, miR-30b and miR-142-3p on antigen processing by MΦ and DC. [score:1]
How to cite this article: Naqvi, A. R. et al. miR-24, miR-30b and miR-142-3p interfere with antigen processing and presentation by primary macrophages and dendritic cells. [score:1]
We next examined the impact of PD-L1 blocking on T cell proliferation by miR-24, miR-30b, and miR-142-3p. [score:1]
Impaired T-cell activation and proliferation by miR-24, miR-30b, and miR-142-3p transfected APCs. [score:1]
[1 to 20 of 23 sentences]
15
[+] score: 56
Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10]. [score:6]
These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector. [score:6]
Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17]. [score:6]
The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21]. [score:5]
As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%. [score:5]
Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector. [score:5]
To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b). [score:5]
As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript. [score:3]
Expression of NP miRNA from the mouse miR30 -based lentiviral vector. [score:3]
Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16]. [score:3]
In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19]. [score:2]
In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells. [score:2]
A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18]. [score:2]
Flanking and hairpin sequences are miR30. [score:1]
0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector. [score:1]
Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells. [score:1]
[1 to 20 of 16 sentences]
16
[+] score: 50
There were four up-regulated miRNAs (mmu-miR-709, mmu-miR-467a-3p, mmu-miR-182-5p and mmu-miR-25-5p) and seven down-regulated miRNAs (mmu-miR-615-3p, mmu-miR-409-3p, mmu-miR-680, mmu-miR-129-5p, mmu-miR-151-5p, mmu-miR-142-5p and mmu-miR-30b-5p), as the values presented in Table 1. Then we performed unsupervised hierarchical clustering of the eleven miRNAs. [score:7]
In control Tregs, mmu-miR-487b-5p, mmu-miR-214-3p, mmu-miR-30b-5p and mmu-miR-129-5p showed significant down-regulation while mmu-miR-409-3p showed significant up-regulation (Figure 2C, left). [score:7]
Among the ten miRNAs validated by qRT-PCR, we found that mmu-miR-487b-5p, mmu-miR-709, mmu-miR-182-5p, mmu-miR-214-3p and mmu-miR-467a-3p were up-regulated in HCC-activated Tregs, mmu-miR-142-5p, mmu-miR-30b-5p, mmu-miR-409-3p and mmu-miR-129-5p were down-regulated (P < 0.01), while miR-344e-5p did not change significantly, as shown in Figure 1C. [score:7]
Compared with control Tregs, although mmu-miR-487b-5p and mmu-miR-129-5p showed similar down-regulation in HCC-activated Tregs, mmu-miR-409-3p was actually significantly down-regulated; mmu-miR-214-3p and mmu-miR-30b-5p did not exhibit significant changes (Figure 2C, right). [score:6]
Control) P -valuemmu-miR-25-5p2.210.04mmu-miR-7091.980.02mmu-miR-467a-3p1.820.04mmu-miR-182-5p1.540.05mmu-miR-129-5p0.290.02mmu-miR-6800.340.02mmu-miR-615-3p0.360.00mmu-miR-409-3p0.440.02mmu-miR-30b-5p0.510.05mmu-miR-151-5p0.610.03 mmu-miR-142-5p 0.63 0.04By TargetScan, we found that mmu-miR-25-5p, mmu-miR-615-3p, mmu-miR-151-5p and mmu-miR-680 had few target genes directly relating with Tregs in MeSH database, so we excluded the four miRNAs for further exploration. [score:6]
Compared with the healthy controls, the expression levels of hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p were significantly up-regulated in Tregs from HCC patients while the hsa-miR-409-3p and hsa-miR-142-5p did not show significant changes (Figure 3). [score:5]
Tregs from HCC patients and healthy controls finally confirmed the up-regulation of four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p). [score:4]
Interestingly, compared with data from the murine mo del, two of the four miRNAs (hsa-miR-182-5p and hsa-miR-214-3p) showed the similar up-regulation while the other two miRNAs (hsa-miR-129-5p and hsa-miR-30b-5p) showed reverse changes. [score:3]
indicated the four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p) targeted eight signaling pathways involved in Tregs. [score:3]
Two miRNAs (mmu-miR-214-3p and mmu-miR-30b-5p) were significantly changed only in control Tregs. [score:1]
The functions of these four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p) in human Tregs are not clear. [score:1]
[1 to 20 of 11 sentences]
17
[+] score: 49
Our findings indicate that (i) loss of Nrf2 in the heart results in a modest downregulation of transcripts involved in mitochondrial function, redox homeostasis, metabolism, cardiac pathology, and protein folding, (ii) 27 miRNAs (11 up and 16 downregulated) are significantly altered and differentially regulated in the Nrf2 depleted myocardium, (iii) Nrf2 may either directly or indirectly regulate a sub-set of cardiac miRNAs, and (iv) miR-582-5p, miR-208a-5p, miR-350-3p and miR-30b-5p are likely to contribute to basally downregulated genes in Nrf2 [−/−] hearts. [score:14]
A total of 39 downregulated DEGs contained potential miRNA recognition elements for the following upregulated miRNAs; miR-30b-5p, miR-350-3p, miR-582-5p, and miR-208a-5p. [score:7]
In silico target prediction for increased miRNAs suggested that many mRNAs altered in knockout mice may be concurrently regulated by miR-582-5p, miR-208a-5p, miR-350-3p, and miR-30b-5p. [score:5]
Importantly, miR-30b expression in cardiomyocytes contributes to survival and protection against oxidative stress induced mitochondrial fission [51], and miR-582-5p was recently shown to inhibit monocyte apoptosis [52]. [score:5]
In addition to these pro-hypertrophic miRNAs, miR-30b-5p and miR-582-5p expression was increased in the hearts of Nrf2 knockout mice (Fig. 5a). [score:4]
High throughput data were integrated using prediction algorithms, and these in silico analyses discovered potential recognition elements within 39 repressed mRNAs which matched the seed sequence for 4 upregulated miRNAs; miR-30b-5p, miR-208a-5p, miR-350-3p, and miR-582-5p. [score:4]
Using this approach, we discovered 39 transcripts potentially targeted by miR-30b-5p, miR-350-3p, miR-582-5p, and miR-208a-5p. [score:3]
Similarly, miR-30b expression has been shown to play an essential role in survival and protection of cardiomyocytes against mitochondrial fission induced through hydrogen peroxide [51]. [score:3]
Therefore, the 4-fold (p < 0.01) and 3-fold (p < 0.05) induction of miR-582-5p and miR-30b-5p (Fig. 5d) may also serve important homeostatic roles contributing to the maintenance of basal cardiac function in Nrf2 [−/−] mice. [score:1]
In addition to these pro-hypertrophic miRNAs, miR-582-5p and miR-30b-5p levels were increased in the hearts of Nrf2 [−/−] mice. [score:1]
Expression changes were validated for 12 miRNAs using specific primer assays in real-time and revealed a significant decrease in miR-10b-5p, miR-674-3p, miR-3535, and miR-378c while miR-30b-5p, miR-208a-5p, miR-350-3p, and miR-582-5p, and miR-1249-3p levels were increased. [score:1]
Therefore, the robust co-induction of miR-582-5p and miR-30b-5p in Nrf2 [−/−] mice could serve to maintain cardiomyocyte viability. [score:1]
[1 to 20 of 12 sentences]
18
[+] score: 42
In summary, we have established a mouse strain that expresses a tet-regulatable, miR30 -based shRNA targeting the Cox2 transcript, and have demonstrated reversible and functional DOX -mediated suppression of Cox2 gene expression. [score:10]
The targeting vector, pCol-TGM, contains a GFP open reading frame immediately downstream of the TRE promoter, followed by the miR30 -based shRNA expression cassette. [score:5]
To identify appropriate shRNAs, each cloning template containing a COX-2 shRNA sequence was ligated into LMP, a retroviral miR30-shRNA expression vector in which miRNA -based shRNA (shRNAmir) expression is driven from the viral 5′LTR promoter (Fig. 1A). [score:5]
Using the microRNA30 (miR30) precursor RNA as a template, they substituted miR30 stem sequences with designed shRNAs, and showed effective target gene inhibition [15]. [score:5]
The Cox2.2058 shRNA in the LMP shRNA expression cassette was cloned into the miR30 backbone of this targeting vector at the single XhoI /EcoRI site. [score:5]
pCol-TGM contains a miR30 -based expression cassette regulated by an inducible tetracycline response element (TRE) promoter. [score:4]
The LMP retroviral vector, a murine stem cell virus (MSCV) -based vector contains unique XhoI and EcoRI sites within a miR30-shRNA expression cassette, driven by the viral 5′LTR promoter ([17], [20] and Fig. 1A). [score:3]
These shRNA sequences, and their corresponding sense strand predictions, were synthesized as 97 mers and cloned into the miR30 shRNA backbone as described previously [21]. [score:1]
Appropriate products carrying the XhoI /EcoRI restriction sites at their ends and comprising the common and Cox2-specific stem sequences and the 19 bp loop were used to create miR30-adapted shRNAs. [score:1]
This vector contains an XhoI /EcoR1 cloning site for shRNAs within a miR30 backbone (shRNAmir). [score:1]
These sequences comprise the common and gene-specific stem and 19 bp loop of the miR30-context to create miR30-adapted shRNAs specific for Cox2. [score:1]
Using improved prediction methods for the design of miR30 -based shRNAs [20], we identified four 22-mer guide strand sequences; Cox2.284 (1), Cox2.1082 (2), Cox2.2058 (3) and Cox2.3711 (4) (Fig. 1A), complementary to the Cox2 coding region (1 and 2) or the Cox2 3′-UTR sequence (3 and 4). [score:1]
[1 to 20 of 12 sentences]
19
[+] score: 42
miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development. [score:5]
The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect. [score:3]
All of these results suggested that CLCNs are able to efficiently transfect the cells in vitro and increase the miR30b expression similar to that seen with DharmaFect. [score:3]
In vitro gene expression experiments were performed transfecting lung cancer cells, H1299, with CLCNs-miR30b complexes and the relative gene expression of miR30b was evaluated after 24 hour of transfection. [score:3]
in vitroGene-silencing and gene expression evaluation experiments were performed to determine whether CLCNs are able to deliver siRNA to cells to induce silencing of a reporter gene (Green fluorescent protein, GFP) or enhancing the expression of an endogenous microRNA (miR-30b) (Figure 5). [score:3]
Gene-silencing and gene expression evaluation experiments were performed to determine whether CLCNs are able to deliver siRNA to cells to induce silencing of a reporter gene (Green fluorescent protein, GFP) or enhancing the expression of an endogenous microRNA (miR-30b) (Figure 5). [score:3]
The expression of miR30b increased in the spleen, lung, liver, and in the tumor. [score:3]
The 4- to 6-week-old nu/nu female mice bearing H1299 subcutaneous tumors were treated with CLCNs-miR30b and CLCNs -negative siRNA control at 1.5 mg/kg via tail vein injection. [score:1]
Untreated control group and non-specific CLCN-siRNA were used as negative control to validate the gene silencing efficiency of CLCNs/miR30b complexes and Dhermafect-miR30b. [score:1]
Various concentrations of miR30b (25, 50, and 100 nM) were used and the same concentration were used for the NSC-siRNA (negative control) conjugated to CLCNs or to DharmaFect. [score:1]
Significantly different p-values were found at 25 nM concentration were the DharmaFect worked better than CLCNs above all the formulation CLCN1-miR30b vs DharmaFect-miR30b = 0.0003 (***) showed a lower transfection efficiency results. [score:1]
However, the function of miR30 especially in NSCLC remains unclear [32]. [score:1]
In vivo CLCNs-miR30b biodistribution. [score:1]
In vivo CLCNs-miR30b biodistribution The 4- to 6-week-old nu/nu female mice bearing H1299 subcutaneous tumors were treated with CLCNs-miR30b and CLCNs -negative siRNA control at 1.5 mg/kg via tail vein injection. [score:1]
CLCNs showed equivalent transfection efficiency to DharmaFect at the concentration of miR30b of 50 and 100 nM. [score:1]
was performed to compare the transfection efficiency of CLCNs-miR30b vs DharmaFect-miR30b. [score:1]
The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg). [score:1]
Basically, H1299 were treated for 24 hours with various concentrations of miR30b, 25, 50 and 100 nM, conjugated with CLCNs or DharmaFect. [score:1]
CLCNs-miR30b complexes and CLCNs/negative siRNA control complexes were injected at a dose of 1.5 mg/kg via tail vein. [score:1]
Biodistribution studies were performed to track fluorescent CLCNs (CLCNs D275) and to evaluate the expression of miR30b delivered by CLCNs, in the major organs and tissues after 24 hours of intravenous administration by tail vein. [score:1]
After 24 hours, the cells were treated with CLCNs conjugated with miR30b (Ambion) or DharmaFECT transfection reagents (Dharmacon) mixed with miR30b as well. [score:1]
In the microRNA biodistribution experiment no fluorescent CLCNs were conjugated with miR30b and the concentration of miR30b was quantified using RT-qPCR. [score:1]
25 nM, CLCN1-miR30b vs DharmaFect-miR30b p value 0.0003 (***) and CLCN2miR30b vs DharmaFect-miR30b p value 0.0053 (**). [score:1]
The fold expression of miR30b was evaluated by RT-qPCR after 24 hours of treatment with CLCNs-miR30b complexes at various concentrations (25, 50 and 100 nM). [score:1]
50 nM, CLCN1miR30b vs DharmaFect-miR30b p value 0.0004 (***) and CLCN2miR30b vs DharmaFect miR30b p value 0.0225 (*). [score:1]
The Quantitative real-time PCR showed a high concentration of miR30b in spleen and lung, liver and tumor (Figure 6E). [score:1]
[1 to 20 of 26 sentences]
20
[+] score: 41
Modulation of pulmonary miRNAs targeting p53 (miR-138 and miR-376c) and apoptosis (miR-98 and miR-350) is consistent with the notion that AMPK is involved in the p53 -mediated cell cycle arrest and apoptosis 2. Several miRNAs upregulated in the lung of metformin -treated mice, including miR-30b, miR-138, miR-239a, miR-342, and miR-574, are involved in stress response and inflammation and target NF κB or Tlr9 (Toll-like receptor). [score:8]
Accordingly, qPCR analysis demonstrated that metformin upregulated 3.0-fold let-7f, which is in line with microarray results indicating a 3.8-fold miR-30b upregulation in the same experimental groups (Table 2). [score:7]
In line with the known role of this drug to activate AMPK 4, considered an ideal drug target for cancer treatment 38, metformin upregulated both miR-148b, which targets this kinase, and miR-30b, belonging to a family of miRNAs that are known to modulate AMPK 39. [score:7]
In addition, metformin modulated the expression of a number of miRNAs (let-7f, miR-30b, miR-362, miR-376c, miR-466h, miR-490, and miR-574) involved in the regulation of the cell cycle, which is a crucial mechanism in the AMPK -mediated activity of this drug 42. [score:4]
Because of the biological relevance of two metformin-modulated miRNAs, let-7f and miR-30b, their expression was validated by qPCR analysis. [score:3]
Furthermore, this drug modulated miRNAs that target angiogenesis (let-7f and miR-98), stem cell recruitment, and multidrug resistance (miR-30b). [score:3]
In addition, the expression of two miRNAs (let-7f and miR-30b) was validated by real-time quantitative polymerase chain reaction (qPCR), as previously described 26. [score:3]
Validation of let-7f and miR-30b microarray results by real-time qPCRBecause of the biological relevance of two metformin-modulated miRNAs, let-7f and miR-30b, their expression was validated by qPCR analysis. [score:3]
Validation of let-7f and miR-30b microarray results by real-time qPCR. [score:1]
For miR-30b, the normalized fluorescent intensity was 20.5 FU in the lung of sham-exposed mice, in the absence of metformin, and 61.3 FU in the lung of mice treated with metformin. [score:1]
The specificity of the qPCR amplified products was confirmed by analyzing melting temperature peaks, which were 70.5°C for let-7f and 72.0°C for miR-30b. [score:1]
[1 to 20 of 11 sentences]
21
[+] score: 38
In total, 114 miRNAs are significantly changed and can be classified into four groups (Figure 2A); 52 miRNAs, including the miR-30 family, are down-regulated during the first 8 days after infection (Figure 2B), 8 miRNAs are down-regulated before day 2 and up-regulated after day 2 after infection (Figure 2C), 2 miRNAs are up-regulated before day 2 and down-regulated after day 2 after infection (Figure 2D), and the remaining 52 miRNAs, including the miR-17 family, are up-regulated (Figure 2E). [score:19]
The combined miRNA expression, miRNA target and signaling pathway assays revealed that the members of the miR-30 family may negatively regulate genes involved in MAPK signaling and adherens junctions [15], whereas the miR-29 family are involved in activating endogenous pluripotent genes such as Oct4 and Nanog by targeting DNMTs [24]– [27]. [score:7]
Among 41 unique miRNA expression signatures for activation of the iPS reprogramming process, we found 4/6 members of the miR-30 family, that are down-regulated. [score:6]
In the activation step of iPS generation, increased expression of the miR-29 family and decreased expression of the miR-30 family are essential. [score:5]
Two mean signal intensity plots are shown for this group and the miR-30 family. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 33
MiR-30 family members are strongly upregulated during adipogenesis in human cells, and inhibition of miR-30 inhibits adipogenesis [12]. [score:8]
In this study, miR-30a, miR-30b, and miR-30c were significantly downregulated in obese mice, and miR-30b was significantly upregulated after LFD feeding. [score:7]
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
miR-30 family members have also been demonstrated to act as positive regulators of adipocyte differentiation in a human adipose tissue-derived stem cell mo del [35]. [score:2]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
The miR-30 family has been found to be important for adipogenesis [12]. [score:1]
[1 to 20 of 7 sentences]
23
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
24
[+] score: 31
Expression profiling of the 6 shortlisted miRNAs revealed that most of the miRNAs were downregulated in oral tumors and miR-22-3p and miR-30b-5p were significantly downregulated in undifferentiated tumors. [score:9]
We further analyzed the expression of miRNAs with reference to cellular differentiation status and observed low-level expression of miRNAs in undifferentiated tumors, and only miR-22-5p and miR-30b-5p expression were statistically significant (P = 0.0485 and 0.0440, respectively). [score:7]
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
Except for miR-22-3p and miR-30b-5p, other miRNAs are significantly downregulated in oral tumors. [score:4]
Further, in undifferentiated tumors, OIP5-AS1 alone or together with other lncRNAs might sponge miR-22-3p and miR-30b-5p to a greater extent resulting in the derepression of the downstream target genes. [score:3]
miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p shared maximum common downstream targets. [score:3]
[1 to 20 of 6 sentences]
25
[+] score: 27
MiRNA-30c belongs to the miRNA-30 family, which consists of five members that are ubiquitously expressed, all of which are among the most highly expressed miRNAs in the heart. [score:5]
Since the seed region is identical between members of the miRNA-30 family, it can be expected that there is a substantial overlap in the targets that they regulate. [score:4]
Since we observed no changes in overall mitochondrial morphology in our in vivo mo del, our results contradict the in vitro studies reported by Li et al. who found impaired mitochondrial fission in cultured neonatal cardiomyocytes when overexpressing miRNA-30 [17]. [score:3]
Members of the miRNA-30 family also affect mitochondrial fission and apoptosis in cultured neonatal cardiomyocytes, an effect attributed to miRNA-30c targeting of p53 [17]. [score:3]
In addition, in zebrafish, miRNA-30 overexpression with mimic sequences leads to excessive blood vessel sprouting, showing the ability of this miRNA to induce angiogenesis in vivo. [score:3]
As the miRNA-30 family has five members, of which several have genomic duplications, a genetic knock-out approach is highly impractical. [score:2]
Having generated a stable and specific miRNA-30 overexpression mo del we phenotypically compared wildtype and transgenic hearts. [score:2]
112.267732 12 Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, et al. (2009) miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
However, little is known on the role of the miRNA-30 family in the heart in vivo. [score:1]
As a consequence, functional redundancy is expected between the miRNA-30 family members. [score:1]
Uncovering the exact role of miR30 in vivo is highly relevant as miRNA-30c was identified as the top candidate for inducing cardiomyocyte hypertrophy in an unbiased miRNA mimic screen in neonatal rat cardiomyocytes [13]. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 27
The targeting of Slug mRNA by miR-30 results in downregulation of fascin and upregulation of the tight junction proteins CLDN-1, CLDN-2, and CLDN-3, which downregulates EMT and, ultimately, reduces the rate of breast cancer progression. [score:12]
miR-30 family members, including miR-30a, are downregulated in estrogen receptor–negative and progesterone receptor–negative breast tumors, suggesting that these hormones are involved in de novo synthesis of miR-30 family members [26, 27]. [score:4]
We are currently mapping the specific region that harbors the hormone-response element(s) in the miR-30 promoter and will identify the hormonal mechanism that regulates miR-30 expression, which could help determine the clinical benefit of endocrine therapy in individuals with hormone receptor–positive breast cancer. [score:4]
This supported a suppressive function for miR-30 in breast cancer invasiveness and metastasis in vivo. [score:3]
According to data sorting of the mRNA sequences bound to miRNAs, miR-30 family members (miR-30a, -30b, -30c, -30d, and -30e) share the same seed sequence (Supplementary Figure S1), suggesting that other miR-30 family members may also suppress Snail or Slug. [score:3]
Additional studies are needed to determine whether defects in miR-30 family members act independently or jointly to drive the progression of breast cancer. [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 25
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B). [score:1]
Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A). [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR. [score:1]
Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site. [score:1]
The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
[1 to 20 of 17 sentences]
28
[+] score: 23
Thus, the downregulation of miR-133 and miR-30 may contribute to the development of cardiac fibrosis in DBL mice, as both regulate the profibrotic signalling factor, CTGF [30], which was correspondingly upregulated. [score:9]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
Nine miRNAs with the highest expression levels (average Ct value range 19.6–22.5) were common amongst the four groups of mice despite the differences in age and disease state, and they were miR-133a, miR-126-3p, miR-24, miR-30c, miR-30b, miR-1, miR-16, miR-19b and miR-145 (Table S1). [score:5]
Downregulated miRNAs included miR-1 and miR-133a, which are part of the same transcriptional unit, and three miR-30 family members, namely miR-30b, miR-30c and miR-30e. [score:4]
[1 to 20 of 4 sentences]
29
[+] score: 22
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d). [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa. [score:1]
An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d). [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
[1 to 20 of 10 sentences]
30
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-30c was upregulated by HDI in all the three experiments, miR-30d was upregulated in two of the three experiments, while miR-30b and miR-30e were upregulated in one of the three experiments but were downregulated in the other two experiments. [score:13]
All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes. [score:1]
The miR-30 family members are similar to each other and have identical seed sequences. [score:1]
Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8). [score:1]
[1 to 20 of 6 sentences]
31
[+] score: 20
Furthermore, it has been recently demonstrated that increased levels of miRNA-30b inhibit phagocytosis in myeloid inflammatory cells [18]. [score:3]
Thus, transgenic miRNA-30b overexpressing mice with lactation defects and disturbances of mammary epithelial cell differentiation are not suitable for studying milk exosome traffic under physiological conditions. [score:3]
The defect in mammary epithelial cell biology caused by overexpression of miRNA-30b may impair cellular traffic and correct assembly of milk exosomes. [score:3]
Transgenic mice overexpressing miRNA-30b. [score:3]
An aberrant composition of miRNA-30b-containing milk exosomes may explain the observed failure of miRNA-30b intestinal uptake [13]. [score:1]
Laubier et al [13] used this mo del to examine milk exosomal miRNA traffic in the offspring and found no effect of the elevated miRNA-30b level in the mouse milk on its level in pup tissues. [score:1]
miRNA-30b is a critical miRNA involved in the control of lactation [12]. [score:1]
MC: Milk cell; MEC: mammary epithelial cell; MFG: Milk fat globule miRNA-30b is a critical miRNA involved in the control of lactation [12]. [score:1]
The authors reported that the concentration of miRNA-30b in the milk of transgenic mice was 134 times the concentration in the wild-type control. [score:1]
However, they did not assess whether the extra miRNA-30b in the milk of this mo del was encapsulated in extracellular vesicles such as exosomes. [score:1]
The fact that miRNA-30b concentration in the stomach of transgenic pups was only 31 times the concentration in the wild-type pups, i. e. substantially lower than the ratio in milk, is consistent with an extravesicular localization resulting in impaired stability and bioavailability of miRNA-30b from these transgenic mice. [score:1]
The nutritional hypothesis is based on three problematic mouse mo dels: 1) miRNA-375 KO mice, 2) miRNA-200c/141 KO mice, and 3) transgenic mice presenting high levels of miRNA-30b in milk. [score:1]
[1 to 20 of 12 sentences]
32
[+] score: 20
Both miR30-shRNA and pX330-gFoxp1 inhibited the expression of FOXP1 in the E17.5 neurons as demonstrated by the loss of colocalization of GFP and FOXP1 immunofluorescence in the CP (Fig 2Ca–b and 2Ea–b). [score:5]
Both the targeting and the scramble sequences were also cloned into pCAG-miR30 system (Addgene), which is a pri-miRNA based shRNA -expression vector contributed by Connie Cepko [30]. [score:5]
The miR30 -based shRNA expression system was introduced into the brain by IUE at E14.5. [score:3]
Correspondingly, more neurons were stalled in the IZ when Foxp1 was inhibited (miR30-ScrRNA: 29.2%; miR30-shRNA-b: 53.5%) (Fig 2D), indicating a migratory delay. [score:3]
Therefore, the targeting and scramble sequences were embedded into the murine miR-30 using pCAG-miR30 vector system. [score:3]
At E17.5, a reproducible migration defect was observed in Foxp1 miR30-shRNA-b group by comparison with the control (miR30-ScrRNA) (Fig 2C). [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 19
Inhibiting endogenous background CSE gene expression, and direct administration of H [2]S at 100 microM induced apoptosis in HASMCs[146] Transfected with miR-30 mimics HEK293 cells and primary neonatal rat myocardial cellsOverexpression of miR-30 family members decreases the expression of CSE protein and H [2]S production. [score:10]
Knockdown of miR-30 family members leads to the upregulation of CSE and H [2]S production rates[164]  Diabetes CSE adenovirus gene transfer Transfection of insulin secreting beta cell line INS-1E cellsCSE overexpression stimulates INS-1E cell apoptosis via increased endogenous production of H [2]S. Ad-CSE transfection inhibited ERK1/2 but activated p38 MAPK. [score:9]
[1 to 20 of 2 sentences]
34
[+] score: 19
Thus, members of the miR-30 family were significantly down-regulated so that expression of its main target p53 could be suitably elevated to counteract the higher proliferation in recovering lung tissues, which are more prone to DNA damage and mutation in the presence of increased DNA synthesis [41]. [score:9]
TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi. [score:5]
Hence, miR-30 appears to act as a tumor suppressor, with its subdued expression facilitating proliferation, but concurrently activating the negative feedback loop of p53, thus showcasing the intricate roles that miRNAs play in pulmonary damage and repair [42]. [score:5]
[1 to 20 of 3 sentences]
35
[+] score: 19
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63]. [score:6]
In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
[1 to 20 of 4 sentences]
36
[+] score: 19
Furthermore, the use of an overexpression murine mo del to study milk miRNA uptake (23) in which WT pups received either WT or miR-30b -overexpressing milk does not account for possible variations in endogenous miR-30b levels and its potential to confound the interpretation of changes in miR-30b expression in the pups. [score:7]
Our data are in concordance with the results of Laubier et al. (23), who found that feeding WT pups with milk overexpressing miR-30b did not increase miR-30b expression in pup blood or tissues. [score:5]
Our study accentuates this lack of uptake even further because the miR-375 copy number difference between WT milk and 375 KO milk is more than 1000-fold (a difference of 10 Ct cycles), as opposed to a 31-fold copy number difference between WT milk and miR-30b -overexpressing gastric milk. [score:3]
Finally, a more recent study has revealed no evidence of miRNA uptake in murine offspring consuming milk overexpressing miR-30b (23). [score:3]
Laubier J., Castille J., Le Guillou S., Le Provost F. (2015) No effect of an elevated miR-30b level in mouse milk on its level in pup tissues. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 18
In the peripheral CD3 [+] T lymphocytes of DBA-2/J strain, we found 11 miRNAs (miR-302c, miR-691, miR-712, miR-125a-3p, miR-29b*, miR-30b*, miR-10b, miR-149, miR-141, miR-1897-5p and miR-690) that were up-regulated. [score:4]
In contrast, in DBA-2/J mice, Rorc mRNA expression was regulated by miR-29b*, miR-30b* and miR-690. [score:4]
Finally, we highlight the validation in this study of the miRNA-mRNA interactions that were not previously predicted in data bases such as TargetScan: miR-30b*-Rorc and miR-196b-CD8a. [score:3]
Rorc mRNA was regulated by miR-30b*, miR-690 and miR-29b* (Table 1). [score:2]
We confirmed that miR-30b* interacts with Rorc mRNA and miR-196b interacts with CD8a mRNA by hybridization with their respective 3′UTR sequences containing the predicted binding sites for these miRNAs. [score:1]
pMIR-Rorc and pMIR-Rorc(m) 3′UTR luciferase plasmid were co -transfected with control or miR-30b* mimic (A), and pMIR-CD8a and pMIR-CD8a(m) with control or miR-196b (B) into HEK293 cells. [score:1]
We revealed the participation of miR-500, miR-202-3p and miR-30b*, which established interactions with at least one of the following mRNAs: Rorc, Fas, Fasl, Il-10 and Foxo3. [score:1]
0054803.g011 Figure 11pMIR-Rorc and pMIR-Rorc(m) 3′UTR luciferase plasmid were co -transfected with control or miR-30b* mimic (A), and pMIR-CD8a and pMIR-CD8a(m) with control or miR-196b (B) into HEK293 cells. [score:1]
We highlighted miR-30b* interacting with RORγt mRNA because the encoded protein (RORγt) plays a role as a transcription factor involved in Th17 cell differentiation [35]. [score:1]
[1 to 20 of 9 sentences]
38
[+] score: 17
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
In contrast, only 5 miRNAs (miR-21, miR-26a, miR-24, miR-30b and miR-29a) were found to be downregulated both in vitro and in vivo by EF24 treatment. [score:4]
miR-30b appears to play an important oncogenic role in the development of medulloblastoma [36]. [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 17
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
There was no significant change in miR-133, miR-30, or miR-101 family members after LPS. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 15
Cre-conditional expression of rAAV2/9- CAG::FLEX-rev-hrGFP:mir30(Scn9a) in Agrp [Cre] mice (AGRP [sh(Scn9a)] mice, Figures 4H and 4I) reduced EPSP duration resulting in synaptic potentials that decayed with the membrane time constant (AGRP [sh(Scn9a)]: 116% ± 8% of τ [m], n = 14; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p < 0.001), whereas expression of a scrambled Scn9a shRNA sequence maintained prolonged EPSPs (AGRP [sh(Scn9a-scram)]: 271% ± 3% of τ [m], n = 7; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p = 0.15, Figure 5A). [score:5]
This method couples reporter gene expression (humanized Renilla green fluorescent protein [hrGFP]) to RNA interference with a microRNA (miR30) cassette that was modified (Stegmeier et al., 2005, Stern et al., 2008) to encode a shRNA sequence for Scn9a in the 3′-untranslated region, allowing identification of neurons transduced with the short hairpin RNA (shRNA) (Figures 4A and 4B). [score:5]
Constructs for Scn9a Knockdown miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www. [score:2]
php) and then chose a sequence with <76% homology to RefSeq transcripts in the mouse genome and that also obeyed gui delines for miR30 -based shRNA (Dow et al., 2012, Matveeva et al., 2012) (see the Supplemental). [score:1]
To produce a negative control for this miR30 -based Scn9a shRNA construct, we used a website to produce a scrambled sequence (http://www. [score:1]
miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 15
Importantly, we describe an shRNA prediction tool that can effectively predict high potency shRNA target sequences when imbedded in the miR30 context, and we show that more than half of the sequences tested had the ability to knockdown gene expression from single copy, Dox-inducible cassette in embryonic stem cells. [score:6]
While we have not yet examined the effect of these modifications with our shRNA selection algorithm, we anticipate that this may further improve the efficiency of miR30 shRNA mediated gene knockdown. [score:2]
pENTR1a-dsRed-m30c was constructed by first cloning dsRed-Express (Clonetech) into pENTR1a (Invitrogen) with SalI/NotI, then the miR30 based context was cloned into NotI/XbaI sites of pENTR1a-dsRed using the following primers: miR30 5’Arm 5’cgtaaGCGGCCGCGTCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGG 3, miR30 mid Arm 5’CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGCAACCAGATATCGAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACT 3’, miR30 3’Arm 5’GGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTCTAGAcgtaa 3’. [score:2]
Recently, site-specific insertion of inducible microRNA-30 context (miR30c) based shRNA cassettes in embryonic stem cells have enabled rapid generation of mice with inducible gene knockdown [1, 2]. [score:2]
Fluorescent miR30-shRNA or Flag tagged NPAS4, SIM2s and SIM2l cDNAs were recombined into pFLP-Inducer or pLVTPT vectors by LR recombination. [score:1]
Recently, a number of high throughput experiments have been performed to identify potent shRNA sequences which, when embedded with the miR30 -based context, successfully produce functional siRNAs [19, 20]. [score:1]
Generation of a miR30 shRNA selection algorithm. [score:1]
[1 to 20 of 7 sentences]
44
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
45
[+] score: 14
For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone. [score:6]
Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO. [score:5]
I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53). [score:3]
[1 to 20 of 3 sentences]
46
[+] score: 13
Studies have described miRNA binding sites for miR-30 within the extended region of Lhx1 3'UTR, where miR-30 inhibits Lhx1 expression and therefore embryonic kidney differentiation [28] (Figure 2C). [score:5]
MiR-30 was abundantly detected in our miRNA-Seq dataset, where it has been previously shown to be a critical regulator of kidney development [28]. [score:3]
Literature evidence of microRNA association is represented for Lhx1 (miR-30) and Hoxa11 (miR-181) along with other known transcriptional regulatory relationship (dotted arrows). [score:2]
Only Lhx1 has been characterized as target of miR-30 within the context of kidney development [28]. [score:2]
C: Riboprobes used for in situ hybridization (ISH): i) overlapping the canonical region as represented by Affymetrix probeset 1421951_at and ii) overlapping extended 3' signal captured by RNA-Seq and probeset 1450428_at, which also contains a microRNA binding site for miR-30 [28]. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 13
BIM shRNA knockdown and retroviral expression of miR-17-92The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems). [score:7]
The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems). [score:4]
A miR-30 -based shRNA was used to knockdown BIM expression by 80% as measured by Western blot analysis [21] (Supplementary Figure 1). [score:2]
[1 to 20 of 3 sentences]
48
[+] score: 13
Previous studies reported the downregulation of miR-30 family members during osteoblast differentiation from mouse preosteoblast cell lines 18, 19. miR-30a/b/c/d were demonstrated to be able to negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 [19]. [score:7]
In contrast, miR-30 family members were upregulated during adipogenic differentiation of adipose tissue-derived stem cells, and miR-30a and miR-30d contributed to adipocyte formation [20]. [score:4]
The miR-30 family is associated with cell differentiation, cellular senescence, apoptosis, and involved in the pathogenesis of tumors and other disorders of the nervous, genital, circulatory, alimentary and respiratory systems 15– 17. [score:1]
The miR-30 family members include miR-30a, miR-30b, miR-30c, miR-30d and miR-30e. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 12
Murchison et al. first investigated the expression of miRNAs in mouse oocytes, and they demonstrated that the miR-30, miR-16 and let-7 family was overexpressed in mouse germinal vesicle (GV) oocytes, speculating, as a result, that miRNAs might play important regulatory roles in the expression of mRNAs during the process of follicular maturity [23]. [score:6]
Furthermore, Tang et al reported that the miR-30, miR-16, let-7 and miR-17-92 family, which was detected in mature mouse oocytes, dynamically regulated oogenesis and early embryonic development. [score:3]
The expression of miR-103, miR-16, miR-30b, miR-30c and let-7d played an important role in maintaining the stability of the spindle structure [10]. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 12
Furthermore, inhibition of PI3K expression at the time of reperfusion abrogated p-Akt expression and the anti-autophagy effect of miR-30a induced by Sal B. Taken together, these data demonstrate that Sal B can alleviate I–R-injured myocardial cells through miR-30/PI3K/Akt pathway -mediated suppression of autophagy. [score:9]
Circulating miR-30 has been shown to be positively associated with left ventricular wall thickness, and regarded to be an important marker for the diagnosis of left ventricular hypertrophy due to miR-30a -induced alterations in expression of the beclin-1 gene and autophagy in cardiomyocytes [8]. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 12
Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette. [score:6]
Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector. [score:6]
[1 to 20 of 2 sentences]
52
[+] score: 12
Our analysis of miRNA expression revealed that miR-9, miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, and miR-146a are all expressed in the developing forebrain, adult dorsal striatum and in the developing kidney (S4 Table). [score:5]
Our data also suggest that miR-125a-5p, miR-125b-5p, miR-30a, and miR-30b are possible regulators of GDNF expression. [score:4]
We examined the miRNAs miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, miR-96, miR-9, and miR-146a, which were selected based on their co -expression with Gdnf in several brain areas [17, 19, 32, 33]; see also www. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 12
We therefore decided to camouflage the antiviral target sequences as the cell’s own microRNA (miRNA) in similar ways, as miRNA-30-like precursors have been used for the study of gene function before [11] to circumvent a hypothetical cellular response mechanism. [score:3]
Also HBsAg suppression was slightly more efficient, when a miRNA-26-like construct was used, whereby miRNA-122-like and miRNA-30-like constructs exhibited similar efficiency. [score:3]
Eventually we selected a pEPI-U6-miRNA-30-like clone targeting transcripts of HBV ORF X/ORF P for further experiments. [score:3]
To circumvent putative hepatocellular ‘friend or foe’ recognition, we mimicked hsa-miRNA-30-like molecules, which were compared to other miRNA-like constructs for their suppressive potency in prior experiments. [score:2]
D. in HBV-Met treated with miRNA-30 L-X1 versus untreated HBV-Met. [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 11
Some of them, such as miR-30b, miR-92a, and miR-125b, have been reported to undergo intergender differences in expression during lung development [34]. [score:4]
Two of the above mentioned miRNAs (miR-30 and miR-133) were targeted by both aspirin and naproxen. [score:3]
In fact, a couple of miRNAs (miR-27a and miR-133a), targeting inflammation and cell proliferation, had been found to be modulated by the same NSAID in A/J mice aged 10 weeks, whereas other miRNAs (miR-30, miR-101 and miR-344b) affecting later stages of pulmonary carcinogenesis were able to distinguish the mice according to the yield of both microadenomas and adenomas. [score:3]
Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas. [score:1]
[1 to 20 of 4 sentences]
55
[+] score: 11
This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions. [score:4]
Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56). [score:3]
For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction. [score:3]
Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 11
Therefore, expression of select miRNAs, including the miR-199 and miR-30 families, decreases during reprogramming and may allow for the upregulation of SIRT1 protein expression. [score:8]
Additionally, all five members of the miR-30 family that potentially target SIRT1 were higher in MEFs than iPS and mESCs. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 10
The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1). [score:3]
0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10]. [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 10
A similar result was observed when we used the targets of hsa-let-7b, hsa-mir-18a, hsa-mir-21, hsa-mir-30b and hsa-mir-101 that have the most common targets from both the AD and BARHL1-ESR1 networks (Table S13) for ToppFun analysis. [score:5]
hsa-miR-30 and hsa-miR-181 are downregulated [58], and apoptosis is a key mechanism in AD [59]. [score:4]
According to the p-values, we observed that hsa-miR-181a is the best cluster (p-value: 0.0276); hsa-miR-30 is the best miRNA family (p-value: 2.91 × 10 [−3]); and apoptosis having 10 miRNAs is one of the best functions (p-value: 7.97 × 10 [−3]). [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 10
In diabetic patients, miR-21a is down-regulated in peripheral blood mononuclear cells [25], serum miR-30a and urine miR-30b expression is up-regulated [26, 27]. [score:9]
In them, 9 miRNAs (miR-21a, miR-29c, miR-30a, miR-30b, miR-34a, miR-106b, miR-203, miR-378 and miR-802) had been shown to be related with diabetes or glucose metabolism. [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 10
An shRNA is expressed under regulation of a U6 promoter and is flanked by pri-miR-30 5′ and 3′ sequences, which are 151 and 128 bp long, respectively. [score:4]
The shRNA sequences (Figure 1B, Table S1) targeting human huntingtin (shHTT) and EGFP (control reagent, shCTRL) were designed using the RNAi Codex database (Olson et al., 2006) with a mir-30 loop between the passenger and guide strands. [score:3]
We have assembled a silencing construct and stably integrated it into the iPSC genome; this construct is based on the piggyBac transposase system (Yusa et al., 2011) and contains anti-HTT or control shRNA in the mir-30 backbone (Paddison et al., 2004), and the gene encoding mOrange2 fluorescent protein (Shaner et al., 2008) as a reporter (Figure 1A). [score:1]
We used a piggyBac transposase system (Yusa et al., 2011) and anti-HTT shRNA in the mir-30 backbone (Paddison et al., 2004) which provides additional possibility for future excision of the reagent if desired. [score:1]
Constructs (Figure 1A) composed of a U6 promoter, a miR-30 5′ flank (151 bp), an shRNA sequence, a miR-30 3′ flank (128 bp), a U6 terminator (TTTTTT), an EF1alpha promoter, an mOrange2 reporter gene, and an SV40 pA site were were synthesized by Genscript (Piscataway, NJ) and cloned into a pPB-HKS-neoL vector obtained, by removing the EGFP reporter gene, from a pPB-UbC. [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
These miRNAs (miR-15a, miR-30, miR-182, and miR-804) are involved in cell proliferation, apoptosis, inflammation, epithelial-mesenchymal transition, invasion, oncogene inhibition, and intercellular adhesion. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 10
Figure 1 Expression of concatenated miR30 -based shRNAs in a single transcript can promote efficient knockdown of at least three target genes. [score:6]
Prom; any of the pol II promoters listed in Fig. 2a, attL1 + attL2; Gateway recombination sites, 5'miR + 3'miR; flanking sequence derived from human miR30. [score:1]
Although we clone shRNAs into our entry vectors using BfuAI compatible linkers, we include Xho I and Eco RI cloning sites in the flanking miR30 sequence to allow subcloning of miR-shRNAs from popular whole genome libraries [2, 7] into our plasmids (Fig. 2b). [score:1]
For shRNAs cloned as BfuAI site-compatible linkers (see methods), shRNA sequence is introduced at the junctions of the 5' and 3' miR30 sequence (light blue). [score:1]
For shRNAs subcloned from commercially available whole genome libraries [2, 7], fragments can be subcloned to the XhoI/EcoRI sites (dark blue) within the 5' and 3' miR30 sequence. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 9
shRNA against GOI was expressed by CAG-LSL-mir30, which is a Cre -dependent shRNA expression vector 14. [score:5]
The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14 (Addgene plasmid #13786). [score:1]
The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14. [score:1]
Small hairpin RNA (shRNA) can be transfected into cortical neurons by the IUE -mediated transfection of CAG promotor/microRNA30 -based RNAi vector (CAG-LSL-mir30) 14. [score:1]
pK225 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi)] and pK226 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi Scramble control)]: For single cell LacZ knockdown, the shRNA against the coding region of LacZ (651–671) and its scramble control were generated by PCR with the template oligonucleotide for LacZ shRNA WL090 and the template oligonucleotide for LacZ shRNA scramble control WL091, respectively, using the primers HM082/HM083. [score:1]
[1 to 20 of 5 sentences]
64
[+] score: 9
Knockdown of NF-κB-p65 by small interfering RNA (siRNA) significantly suppresses radiation -induced miR-30 expression in CD34+ cells [45]. [score:6]
Nevertheless, suppression of miR-30 and IL-1β protects CD2F1 male mice and human CD34+ cells from radiation injury [45]. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 8
To temporarily and reversibly control p53 expression in vivo, we utilized TRE-p53.1224 transgenic mice in which expression of a miR-30 -based p53.1224 shRNA is regulated by a tetracycline-responsive element (TRE) 17. [score:6]
Expression of miR-30 -based p53.1224 shRNA was detected using a Custom TaqMan MicroRNA Assay (Applied Biosystems). [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 8
As shown in Figure 6A, mRNA targets of several miRNA families were found to be significantly upregulated in hypertrophy (false discovery rate (FDR) <0.05), including those targeted by miR-29, miR-1, miR-9, miR-30, and miR-133. [score:8]
[1 to 20 of 1 sentences]
67
[+] score: 8
Genes implicated in Toll-like receptors signaling such as GSK3B (a glycogen synthase kinase), SOCS3 (a suppressor of cytokine signalling-3) and ATF2 (an activating transcription factor) were defined as targets of modulated miRNAs during all time-course of the mouse mo del of asthma, respectively mmu-miR-23a, -23b, -26b, -29b, -29c, -155 and -214 for Gsk3b; mmu-miR30b, -30c, -30d, -152, -203, -207, -218 and -455 for Atf2; mmu-miR30b, -30c, -30d, -152, -203, -207, -218 and -455 for Socs3. [score:5]
Finally, at LT, TIMP-2 and TIMP-3 mRNAs are the predicted targets of several modulated miRNAs (mmu-miR-30b, -30c, -30d, -21, -214 and -206). [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 8
The miRNA control contains a luciferase shRNA cloned onto the stem of miR-30 [59], while the control shRNA targets firefly luciferase cloned as an shRNA. [score:3]
Tumors and metastases derived from implanted 4T1 cells or 4TO7 cells that were unmodified or infected with retroviruses expressing a control miR-30 stem insert or the miR-141-200c miRNA cluster within the miR-30 stem were stained with PCNA. [score:3]
The miR-30 stem containing an shRNA against firefly luciferase was used as a negative control. [score:1]
To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 8
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p). [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 8
The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study. [score:7]
For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 8
Wu et al. found that expression of the miR-30 family was downregulated in mouse preosteoblast differentiation and further found that miR-30 targeted the important transcription factors SMAD1 and RUNX2 [9]. [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 7
[14] and miR-21a, miR-26b, miR-30b, miR-103, miR-194, miR-449a found to be upregulated in both the present study and in that of Gapp et al. [60] In addition, let7f, let7g and let7i were found to be upregulated in both this study and Gapp et al. [60] It is important to emphasize that we are not discounting the importance of other small RNAs not common between the studies to-date because they are potentially acting as secondary molecular mediators of the offspring phenotypes under specific study conditions. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
As a group of tumour suppressors, the miR-30 family has been reported to be downregulated in many human cancers, including colorectal cancer [21], lung cancer 22, 23, thyroid cancer [24], renal cell carcinoma [25] and gastric cancer [26]. [score:6]
MiR-30a is a member of miR-30 family, which also includes miR-30b, miR-30c, miR-30d, and miR-30e. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 7
Most notable, among the up-regulated miRNAs were miR-205, miR-342 and miR-21, while miR-29c, miR-192, miR-30b and miR-200a were significantly down-regulated. [score:7]
[1 to 20 of 1 sentences]
75
[+] score: 7
This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis. [score:5]
There are 4 miRNAs (miR-30b, let-7b, 18a, and 19a) that are involved in the Wnt signaling pathway through the genes Fzd2, Racgap1, Myc and Prkce. [score:1]
For example, there are 5 miRNA members in the miR-30 family that are involved in TGF Beta signaling pathway through the gene “Tgfbr1” and 5 miRNAs (miR-17a, 18a, 20a, 20b, 92a) in miR-17-92 cluster that are involved the same pathway through the gene Smad6. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 7
In this study, we constructed multi-hairpin amiRNAs based on miR-30 to target endogenous genes of GAPDH, eIF4E and DNA pol α to knockdown their expression more effectively. [score:6]
amiRNAs based on modified human microRNA 30 (miR-30) could achieve more effective gene silencing than previous short-hairpin RNA (shRNA) [11, 13, 31]. [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 7
In particular, the up-regulation of microRNA-709, microRNA-320 and microRNA-128a, and down-regulation of microRNA-181a-1-3p, microRNA-30b and microRNA-374 were confirmed by RT-PCR (Fig. 3E). [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Among these miRNAs, 3 were downregulated (miR-193, miR-30b and miR-29c) and 2 were upregulated (miR-199a-3p and miR-199a-5p) (Figure 9B). [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
In these mice, all A1 paralogues expressed are constitutively targeted by a single shRNA embedded in the miR30 backbone, placed in the 3′UTR of the fluorescence marker Venus and expressed under control of the hematopoiesis specific Vav-gene promoter (VV-A1 mice). [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
In the present study, we investigated the alteration of miR-30e in SNpc by qRT-PCR and the results showed that the expression of miR-30e was downregulated gradually after MPTP injection, suggesting miR-30 might also have a role in the pathogenesis of PD. [score:4]
For overexpression of miR-30e in BV-2 cells, the cells were transfected with miR-30 mimics or negative control miRNA using Lipofectamine 2000 according to the manufacturer’s protocol. [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 7
Notably, several large miRNA families (such as the miRNA-15, miRNA-30, and let-7 families) were upregulated in P10 cardiac ventricles, and miRNA-195 (a member of the miRNA-15 family) was shown to be the most highly upregulated miRNA. [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
mRNA targets that showed inversely correlated expression with miRNAs (Additional file 3) include previously validated miRNA/target pairs such as Mef2c with miR-223 [14], Bcl2 with miR-15 or miR-16 [38], Mybl2 with miR-29 or miR-30 family members [39], and Ezh2 with miR-26a [40]. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
The other miRNAs involved in regulation of CSE are miR-30 that directly inhibits CSE [47], and miR-22 that inhibits SP1 [49]. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
We first utilised these ecotropic MuLE lentiviruses expressing combinations of shRNA or shRNA-miR30 against Cdkn2a, Trp53, Tsc2 and Pten with or without expression of oncogenic Hras [G12V], oncogenic PIK3CA [H1047R] or Myc vectors to attempt to generate panels of genetically-engineered angiosarcoma cell lines by infecting a disease-relevant cell type, namely primary murine endothelial cells from the spleen (pMSECs). [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 6
For instance, miR-125b, miR-504 and miR-30 can target p53 and down-regulate p53 protein levels and function [24– 26]. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
This resulted in an increased expression of miR-503, miR-30-c2*, miR-183* and miR-198, with miR-503 being the most upregulated (Fig. 1c). [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
miR-29 and miR-30 regulate B-Myb expression during cellular senescence. [score:4]
In agreement with other studies (Grillari et al., 2010; Kato et al., 2011; Martinez et al., 2011) we found a decrease in abundance of members of the family of let-7, miR-30, miR-17-92 cluster and its paralogs miR-106a-363 and miR-106b-25 in WT and 3x-Tg-AD aged mice. [score:1]
These overlapping miRNAs include family members of let-7, miR-30, miR-17-92 cluster and its paralogs. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 6
CCR-14-2829 25977341 4. Qi F The miR-30 family inhibits pulmonary vascular hyperpermeability in the premetastatic phase by direct targeting of Skp2Clin. [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
This class of miRNAs, poorly expressed in mdx, was upregulated in exon-skipping -treated animals and included muscle specific (miR-1 and miR-133) and more ubiquitous (miR-29 and miR-30) miRNAs. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
Interestingly, the miR-103-2 (16,537 CPM), miR-107 (2,068 CPM), miR-181 (6,627 CPM) and miR-30 (5,740 CPM) families have not previously been associated with the development of the brain, but were found to be highly expressed in our dataset. [score:4]
MiR-181 plays a crucial role in modulating haematopoietic lineage differentiation [53] whereas miR-30 has been strongly implicated with kidney development and nephropathies [54]. [score:2]
[1 to 20 of 2 sentences]
91
[+] score: 6
Conversely, 5 miRNAs showed decreased expression across multiple studies (miR-106b, miR-20b, miR-224, miR-30b, miR-383), of which 3 miRNAs showed some down-regulation in the TLDA dataset. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
Fluorouracil induces autophagy-related gastric carcinoma cell death through Beclin-1 upregulation by miR-30 suppression. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 6
A number of studies have shown that miRNAs, such as miR-34, miR-125, miR-200, miR-205, miR-328, and miR-30, were down-regulated and acted as tumor suppressors in breast cancer [16– 22]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
Cui et al[20] reportedthat miR-204 inhibited VSMC calcification by targeting RUNX2, and Balderman et al[45] confirmed that miR-30b-c also influenced vascular calcification by regulating RUNX2. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Unlike the shared program described between developing cerebellum and MB, only three terms such as activator, DNA binding, and DNA metabolism, were shared between small cell lung cancer upregulated genes and coherent targets in developing lung, involving miR-30, miR-200a, and miR-9, respectively. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 5
MEL cells were transfected with miR30 -based short-hairpin vectors targeting murine Fbxo7 or empty vector as described [15], or infected using MSCV -based vectors to express human Fbxo7 as described [9]. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
miR-142-3p was overexpressed in cells by transient transfection of pADC38, a pGIPZ (GE Dharmacon-Thermofisher, Erembodegem, Belgium) derivative that drives the expression of artificial miRNAs based on the backbone of miR30, from a RNA polymerase II promoter. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
Interestingly, both miR-301a and several members of the miR-30 family, which are also commonly longer than 24 nt in our dataset (Table S10), target the mRNA for plasminogen activator inhibitor-1, a protein involved in the pathogenesis of cardiovascular disorders [43]. [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
B. Correctly targeted CAGs-LSL-rtTA3 ESCs (Y1), were retargeted by recombinase mediated cassette exchange (RMCE) to introduce a TRE-GFP-miR30 (TGM) construct to the col1a1 recipient locus. [score:5]
[1 to 20 of 1 sentences]