sort by

63 publications mentioning mmu-mir-137

Open access articles that are associated with the species Mus musculus and mention the gene name mir-137. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 467
To determine whether endogenous miR-137 is able to regulate Shank2 expression, we carried out luciferase assays and Western blot experiments in mouse primary hippocampal neurons after inhibition of miR-137 with a targeted miRCURY LNA™ Power microRNA inhibitor or treatment with a microRNA inhibitor control. [score:11]
Conversely, miR-137 inhibition increased Shank2 protein expression, indicating that miR-137 regulates SHANK2 expression by repressing protein translation rather than inducing mRNA degradation. [score:10]
We analyzed the number of validated target genes that were differentially expressed in SCZ individuals and revealed a lower frequency compared with the respective miR-137 targets (Additional file  1: Table S6, differentially expressed targets: let-7a 14%, miR-21-5p 11%, miR-93-5p 14%, miR-451a 0%, and miR-675-5p 0%). [score:10]
Inhibiting effective protein translation is a known mechanism for local fine tuning of gene expression at postsynaptic sites and is in line with previously reported direct miR-137 targets, including Ephrin B2 (EFNB2) and the AMPA receptor subunit GluA1 (GRIA1) [35, 36]. [score:10]
All study-wide significant miR-137 target genes had modest fold changes with a mean of 1.09 and a range of 1.049–1.135 (inverting downregulated expression ratios). [score:8]
miR-124 precursor expression was not different between SCZ and control individuals and the differentially expressed miR-137 target genes may only slightly be co-regulated by miR-124 and miR-128. [score:8]
miR-137 regulates the expression of multiple glutamatergic synapse proteins; therefore, subtle regulation of SHANK2 expression by miR-137 is likely to be physiologically relevant. [score:7]
Most miR-137 targets have been investigated in cancer cell lines and only 13 miR-137 target genes (including SHANK2) have been confirmed in neuronal cells; therefore, some of the confirmed targets may not be miR-137 targets in the brain. [score:7]
miR-137 was also overexpressed or inhibited in hippocampal neurons, and Shank2 expression was analyzed by quantitative real-time PCR and Western blot. [score:7]
The analysis of miR-137 expression in 21 different human tissue samples revealed high expression in the central nervous system and marginal expression in other tested organs (Additional file  1: Figure S3). [score:7]
For the inhibitor experiments, the primary mouse hippocampal neurons were treated with 25 nM miR-137 or power inhibitor control (miRCURY LNA™ Power microRNA hsa-miR-137 4101446-111 or negative control B 199007-111 inhibitor 5′-Fluorescein-labeled, Exiqon, Vedbaek, Denmark) added drop-wise to the cells on DIV5. [score:7]
This indicated that miR-137 specifically binds the target site, as mutation of the seed region in the miR-137 binding site eliminated the robust downregulatory effect of miR-137. [score:7]
miR-137 acts cooperatively and synergistically with miR-124 and miR-128 [7, 33, 34]; therefore, changes in the expression of these two microRNAs may interfere with the expression of miR-137 target genes. [score:7]
Next, we focused on the miR-137 signaling network and analyzed the expression of 69 known miR-137 target genes (68 validated targets from previously published studies summarized in 1: Table S4 and SHANK2). [score:7]
In contrast, miR-137 overexpression or inhibition did not affect dendritic spine morphology, whereas miR-137 inhibition only led to a reduced spine density [36]. [score:7]
Furthermore, evidence was obtained that miR-137 target genes are differentially expressed between healthy controls and SCZ patients offering additional support for the involvement of miR-137 and its target genes in the pathogenesis of neuropsychiatric disorders. [score:7]
To analyze the expression levels of the validated miR-137 target genes and miR-137 precursor, we selected the average expression levels, the log [2]-fold change and the P values for the respective genes published on https://synapse. [score:7]
Next, we treated cells with a miR-137 inhibitor or control inhibitor on DIV5, shortly before miR-137 reaches its highest endogenous expression levels. [score:7]
In the DLPFC, SHANK2 and miR-137 are both expressed [27, 31] and we aimed to identify whether miR-137, SHANK2, and other known miR-137 targets are differentially expressed in the DLPFC of SCZ individuals compared to controls. [score:6]
We discovered that physiological levels of miR-137 regulate SHANK2 expression, most likely by repressing translation of SHANK2 protein rather than inducing mRNA degradation. [score:6]
miR-137 directly targets the SHANK2 3′UTRIn silico analysis (TargetScanHuman Release 7.1 [26]) of all three SHANK genes identified a single, highly conserved binding site for miR-137 (MIMAT0000429) in the 3′UTR of SHANK2 (ENST00000449833.2, Additional file  1: Figure S2A), suggesting that this microRNA has the potential to bind SHANK2 mRNA. [score:6]
This difference might be due to a more subtle regulatory effect of miR-137 on Shank2 protein expression compared to an RNAi -mediated knockdown as microRNAs are “fine-tuners” of protein expression. [score:6]
SHANK2 microRNA miR-137 Schizophrenia Autism Intellectual disability microRNAs are small non-coding, single-stranded RNA molecules that regulate gene expression by binding to the 3′UTRs of their target mRNAs through base pairing of their 6–8-nucleotide long seed region. [score:6]
Inhibition of miR-137 significantly increased endogenous Shank2 protein expression by 24% compared with control inhibitor (* P = 0.016, two-way ANOVA) (Fig.   2c). [score:6]
It is important to note that expression of miR-137 target genes is not regulated by miR-137 alone, but by multiple factors, e. g., other microRNAs, epigenetic mechanisms, subcellular localization, synaptic activity, medication, or other environmental factors. [score:6]
A two-sided Χ [2] test with Yates correction was used to compare the expression of validated target genes of miR-137 and five control microRNAs. [score:5]
Only 23% of the analyzed miR-137 target genes were differentially expressed on the mRNA level between SCZ and control individuals. [score:5]
The SHANK genes and the schizophrenia -associated microRNA-137 show convergence on several levels, as they are both expressed at the synapse, influence neuronal development, and have a strong link to neurodevelopmental and neuropsychiatric disorders like intellectual disability, autism, and schizophrenia. [score:5]
The majority of differentially expressed miR-137 target genes (12/16) were only modestly elevated in SCZ individuals, suggesting that small effects of single genes accumulate in the DLPFC, presumably leading to a general impairment of miR-137 signaling. [score:5]
The numbers of differentially expressed target genes were significantly different between miR-137 and the five pooled controls (P = 0.031, Χ [2] test, two-sided, Yates correction, Additional file  1: Table S6). [score:5]
Additionally, expression levels of experimentally validated miR-137 target genes were analyzed in the dorsolateral prefrontal cortex (DLPFC) of schizophrenia and control individuals using the RNA-Seq data from the CommonMind Consortium. [score:5]
Eight target genes that were not differentially expressed in SCZ and control individuals overlapped between miR137 and the five controls and were excluded from analysis. [score:5]
The miR-137 power inhibitor sequesters both the human hsa-miR-137 and mouse mmu-miR-137, thereby preventing it from binding to its targets. [score:5]
miR-137 was highly expressed in the fetal brain, and expression remained strong in the adult hippocampus, thalamus, and striatum. [score:5]
We analyzed miR-124 and miR-128, which act cooperatively with miR-137, and obtained no evidence that these two microRNAs influence the differential expression of miR-137 targets. [score:5]
To further investigate the link between miR-137 and SCZ, we analyzed the expression of miR-137 precursor and known miR-137 target genes in postmortem DLPFC samples of SCZ individuals using the CommonMind gene expression data resource [25]. [score:5]
We overexpressed miR-137 and negative control miRNA mimics in mouse hippocampal neurons to determine the effect on endogenous Shank2 expression. [score:5]
miR-137 also has subtle effects on the protein expression of its other targets [36]. [score:5]
Expression of miR-137 precursor and validated miR-137 target genes in the DLPFC of SCZ and control individuals. [score:5]
Expression of SHANK2 mRNA was not different in the DLPFC of SCZ and control individuals, which may mean that SHANK2 is not a relevant miR-137 target in the context of SCZ. [score:5]
Our study was limited to miR-137 precursor expression analysis as no data of mature miR-137 expression was available. [score:5]
Bar plots show mean ± SEM; *** P < 0.001, * P < 0.05 two-way ANOVA; b, c, and e (n = 5 experiments)Alterations in the microRNA machinery have been described in various cancers [29]; therefore, we further analyzed the regulatory effect of miR-137 on Shank2 expression in mouse primary hippocampal neurons. [score:4]
To investigate possible co-regulation with miR-137, we looked for additional binding sites in the 3′UTR of differentially expressed miR-137 target genes (Table  1). [score:4]
Therefore, we conclude that changes in mRNA expression do not reveal the full regulatory potential of miR-137. [score:4]
miR-137 directly targets the SHANK2 3′UTR. [score:4]
Our network analysis revealed that many validated miR-137 target genes are linked to developmental, neurological, and psychiatric disorders, particularly SCZ. [score:4]
We concluded that miR-137 directly and specifically targets the predicted binding site in the 3′UTR of SHANK2 in the SH-SY5Y cells and primary hippocampal neurons. [score:4]
This indicates that regulation of miR-137 expression varies in different cell types. [score:4]
Bar plots show mean ± SEM; *** P < 0.001, * P < 0.05 two-way ANOVA; b, c, and e (n = 5 experiments) Alterations in the microRNA machinery have been described in various cancers [29]; therefore, we further analyzed the regulatory effect of miR-137 on Shank2 expression in mouse primary hippocampal neurons. [score:4]
Differential expression of 23% (16/69) of known miR-137 target genes was detected in the DLPFC of schizophrenia individuals compared with controls. [score:4]
SHANK genes converge with miR-137 on several levels: (i) both are expressed at the synapse, (ii) both influence dendrite and spine formation in glutamatergic neurons [8, 21], and (iii) both have a strong link to neurodevelopmental and neuropsychiatric disorders like ID, ASD, and SCZ [18, 22, 23]. [score:4]
Endogenous miR-137 was sequestered by the inhibitor; therefore, the regulatory effect on the SHANK2 3′UTR was lost and luciferase activity was increased. [score:4]
miR-137 directly targets the 3′UTR of SHANK2 in a site-specific manner. [score:4]
To find out if the miR-137 signaling network is altered in schizophrenia, we compared miR-137 precursor and miR-137 target gene expression in the DLPFC of schizophrenia and control individuals using the CommonMind Consortium RNA sequencing data. [score:4]
miR-137 regulates the expression of several proteins that function at glutamatergic synapses, e. g., EFNB2, GluA1, and Mib1 and thereby influences neuronal maturation and signal transduction [8, 35, 36]. [score:4]
The majority of differentially expressed miR-137 target genes (12/16) showed elevated mRNA levels in SCZ individuals compared with controls. [score:4]
However, we and others have identified neuronal miR-137 target genes which were regulated on protein [35, 36] and not on mRNA level. [score:4]
SHANK2 and AMPA receptors are both regulated by miR-137 and are important for synaptic maturation and plasticity; therefore, this control by miR-137 may have synergistic effects on synaptic regulation. [score:3]
No difference in miR-137 precursor expression was found between SCZ and control individuals. [score:3]
The control inhibitor does not influence miR-137 and was used to control for unspecific effects of the treatment. [score:3]
This compiled evidence raised the question if the SHANKs might be targets of miR-137. [score:3]
Putative miR-137 targets are enriched in SCZ risk loci [18], suggesting that convergent pathways connected by this microRNA contribute to SCZ etiology. [score:3]
Analyzing miR-137 expression in specific cortical layers, cell types, or even cell compartments might reveal distinct local alterations in the DLPFC of SCZ patients. [score:3]
org/resources/sfari-gene#refs, accessed May 2017) are predicted or confirmed miR-137 targets (Additional file  1: Table S1). [score:3]
To determine the effect of miR-137 on endogenous Shank2 expression real-time quantitative PCR (RT-qPCR) was performed. [score:3]
miR-137 expression levels were analyzed with the same method using 21 different human tissue RNA samples (specified in Additional file  1: Table S3). [score:3]
Fig. 2 a Expression profile of miR-137 in mouse primary hippocampal cultures over 11 days in vitro (DIV). [score:3]
First, we analyzed the endogenous miR-137 expression profile in primary hippocampal neurons. [score:3]
Reduced levels of precursor and mature miR-137 concurrently with significantly increased levels of downstream target genes (MITF, EZH2, and KLF4) were determined in lymphoblastoid cells isolated from two patients with this 1q21.3 micro deletion [6]. [score:3]
Finally, we performed a functional network analysis of validated miR-137 targets (Table  2). [score:3]
Validated targets of miR-137 were collected from miRTarBase (http://mirtarbase. [score:3]
Based on our experimental results, we speculate that reduced miR-137 expression may also increase SHANK2 levels in these patients, which may contribute to the ID and ASD phenotype seen in these patients. [score:3]
Overexpression of miR-137 in mouse primary hippocampal neurons significantly lowered endogenous Shank2 protein levels without detectable influence on mRNA levels. [score:3]
These neurons express Shank2 and Mir137, and the miR-137 binding site is conserved in the mouse Shank2 3′UTR (Additional file  1: Figure S2B). [score:3]
Finally, we analyzed the consequences of endogenous miR-137 inhibition on Shank2 protein levels by. [score:3]
We identified a direct regulatory link between microRNA-137 and SHANK2, which is of importance for a spectrum of disorders including ID, ASD, and SCZ. [score:3]
RNA sequencing data for the miR-137 target genes HCRT, SLC6A3, and SNAI1 was not available in the CommonMind dataset. [score:3]
We examined the data for miR-137 precursor expression and found that it did not differ between SCZ and control individuals (MIR137HG, ENSG00000231269, P = 0.699). [score:3]
Selection of experimentally validated miR-137 targets and network analysis. [score:3]
Analysis of the 3′UTR of the differentially expressed miR-137 genes in the DLPFC between SCZ and control individuals for additional putative miR-124 and miR-128 binding sites. [score:3]
The validated miR-137 target genes (including SHANK2) were ranked according to their point-wise P values from the CommonMind analysis, and the Benjamini-Hochberg method was used to correct for multiple testing with a false discovery rate of 10% (Additional file  1: Table S5). [score:3]
Four miR-137 target genes (RORA, CPLX1, TCF4, SIRT1) even show significant differences on the whole-transcriptome level, according to data provided by the CommonMind Consortium [25]. [score:3]
Our study provides evidence that a direct regulatory link exists between miR-137 and SHANK2 and supports the finding that miR-137 signaling might be altered in schizophrenia. [score:3]
Taken together, these findings indicate that deregulation of miR-137 is the key to various psychiatric and neurodevelopmental disorders. [score:3]
To determine the effect of miR-137 on Shank2 protein expression, cellular protein was isolated using RIPA buffer from cell cultures on DIV10, and the lysates were run on Novex™WedgeWell™4–12% Tris-Glycine Gels (Thermo Fisher Scientific) and then blotted onto a PVDF membrane (Immobilon-FL, Millipore, Billerica, Massachusetts, USA) as recommended by the manufacturer. [score:3]
miR-137 overexpression did not alter endogenous Shank2 mRNA levels in hippocampal neurons (Fig.   1d). [score:3]
Beside the regulation of postsynaptic genes, miR-137 has also been shown to regulate presynaptic genes and presynaptic neurotransmitter release [38]. [score:3]
This suggests that SHANK genes might be targets of miR-137. [score:3]
The data for miR-137 precursor but not mature miR-137 expression levels were available in this data set. [score:3]
Different postsynaptic proteins are probably regulated by miR-137 at the same time, which may increase the intensity of the neuronal response. [score:2]
Homozygous knockout of Mir137 is embryonically lethal in mice, indicating that embryonic development is dependent on at least one functional allele [9]. [score:2]
Genetic alterations of MIR137 have been associated with neurodevelopmental disorders. [score:2]
Luciferase reporter assays were performed by overexpressing wild type and mutated SHANK2-3′UTR and miR-137 in human neuroblastoma cells and mouse primary hippocampal neurons. [score:2]
We showed a regulatory influence of miR-137 on SHANK2 expression in mouse hippocampal neurons, whereas the relevance in other brain regions and in human neurons warrants future investigation. [score:2]
miR-137 regulates Shank2 protein levels. [score:2]
However, Western blotting revealed a 29% reduction of Shank2 protein (*** P = 0.00003, two-way ANOVA) after miR-137 overexpression in hippocampal neurons compared with the negative control miRNA mimics (Fig.   1e). [score:2]
This emphasizes the importance of miR-137 in early developmental processes. [score:2]
miR-137 inhibition increased the relative luciferase activity for the SHANK2 wt reporter construct by 70% (* P = 0.044, two-way ANOVA) compared with the control (Fig.   2b). [score:2]
b Luciferase assay in primary mouse hippocampal neurons treated with hsa-miR-137 or control power inhibitors at DIV5. [score:2]
miR-137 target genes are enriched among ASD risk genes (29%, CI 18.6–41.8%) compared with the random frequency (2.9%, predicted in the miRDB database [14]; CI 2.7–3.2%, 525/17860) (P ≤ 0.000001, Fisher’s exact test, two-sided). [score:2]
Fig. 1 a Alignment of miR-137 with the human SHANK2-3′UTR (NM_012309) wild type and mutated seed sequence. [score:1]
The rare chromosomal micro deletion 1p21.3 encompassing MIR137 and DPYD was identified in individuals with intellectual disability (ID), comorbid with autism spectrum disorder (ASD), and obesity [6, 10, 11]. [score:1]
b Luciferase activity using the wild type (wt) and mutated (mut) 3′UTR of SHANK2 co -transfected with hsa-miR-137 mimic or control miRNA in the SH-SY5Y cells. [score:1]
In silico analysis revealed a putative binding site for microRNA-137 (miR-137) in the SHANK2 3′UTR, while this was not the case for SHANK1 and SHANK3. [score:1]
microRNA-137 (miR-137) is enriched in the human and mouse brain [5], especially in cortical regions and in the hippocampus [6]. [score:1]
The SH-SY5Y cells were seeded in antibiotic-free medium and transfected after 24 h with 200 ng of empty psiCHECK™-2 vector and wild type or mutated SHANK2 3′UTR constructs with 12 nM miR-137 or control mimics (mirVana® miRNA hsa-miR-137 mimic MIMAT0000429 and Pre-miR™ miRNA Precursor Molecules Negative Control #2, AM17111, Thermo Fisher Scientific, Darmstadt, Germany) in technical triplicates using Lipofectamine®2000 (Thermo Fisher Scientific, Darmstadt, Germany). [score:1]
Previous studies have shown no difference in the levels of precursor and mature miR-137 between SCZ and control individuals [31, 41, 42]. [score:1]
This is supported by the finding that altered miR-137 levels impact synaptic function and neuronal network formation in the mouse hippocampus [36]. [score:1]
A heterozygous micro deletion on 1q21.3 encompassing the genes MIR137 and DPYD was previously described in ID and ASD patients [6, 10, 11]. [score:1]
The amount of miR-137 mimics had to be optimized for each cell type separately. [score:1]
This indicated that the miR-137 signaling network might be altered in the DLPFC of SCZ individuals. [score:1]
In contrast, no difference was observed between miR-137 and negative control miRNA for the mutated 3′UTR. [score:1]
miR-137 expression has been investigated in fibroblasts and fibroblast-derived neurons isolated from individuals homozygous for four schizophrenia -associated SNPs at the MIR137 locus. [score:1]
Human neuroblastoma cells (SH-SY5Y) were transfected with a dual luciferase reporter plasmid (psiCHECK™-2) containing either the wild type (wt) SHANK2 3′UTR sequence or a miR-137 binding site-mutated 3′UTR (mut) together with either miR-137 or negative control miRNA mimics (Fig.   1a). [score:1]
Furthermore, the MIR137 gene has been reported as a schizophrenia (SCZ) susceptibility locus because the common SNP rs1625579, located in an intron of MIR137, was associated with SCZ in several studies [15– 18]. [score:1]
Hippocampal cultures were transfected with the optimized hsa-miR-137 mimic concentration of 300 nM and negative miRNA control on DIV5 using the AD1 4D-Nucleofector™ Y Unit system (Lonza, Basel, Switzerland) according to manufacturer’s instructions. [score:1]
Primary mouse hippocampal neurons were transfected with either hsa-miR-137 or control miRNA. [score:1]
Luciferase reporter constructs were transfected at DIV6, and luciferase activity was measured after 48 h. c Western blot with lysate from primary mouse hippocampal neurons treated with hsa-miR-137 or control power inhibitor at DIV5 and protein was harvested after 5 days. [score:1]
was performed with miRCURY LNA™ microRNA PCR ExiLENT SYBR® Green PCR sets for hsa-miR-137, U6, and spike-in (Exiqon), measuring the endogenous miR-137 expression profile in primary hippocampal neurons over a time period of 11 DIV. [score:1]
e Western blot of primary mouse hippocampal neurons 5 days posttransfection with hsa-miR-137 or control miRNA. [score:1]
miR-137 has been linked to various disorders including ID, ASD, and SCZ [6, 10, 11, 18]. [score:1]
Morphological effects caused by altered Shank2 levels in hippocampal neurons do not correlate to the morphological changes found when miR-137 levels are altered. [score:1]
[1 to 20 of 122 sentences]
2
[+] score: 377
Other miRNAs from this paper: mmu-mir-206, hsa-mir-137, hsa-mir-206
To explore the mechanisms involved in suppressing tumour formation when miR-137 is over-expressed in MDA-MB-231 cells, we performed IHC to monitor cell proliferation, angiogenesis and expression of tumour suppressors. [score:9]
Mesenchymal expression of Gata3 was induced but epithelial expression was reduced by miR-137 over -expression (Figure 2F and 2H). [score:7]
Interestingly, ER1 is expressed in the mesenchyme surrounding the mammary bud at E12.5 [5] and is a target of miR-206, which is also expressed in the mesenchyme at E11.5 and E12.5 (earlier than miR-137) but not at E13.5 [35]. [score:7]
A recent study also reported that miR-137 impairs proliferation and migration of cells of a breast cancer cell line by targeting expression of the nuclear receptor estrogen-related receptor alpha (ERRα) [28], suggesting that miR-137 may suppress the formation of breast cancer. [score:7]
To determine whether miRNA-137 inhibits or simulates expression of genes involved in mammary gland formation, we applied miR-137 to cultured mouse flanks and examined expression of Gata3, T-box transcription factor Tbx3, Tac1, and Lef1 (lymphoid enhancing factor 1) (Figure 2E- 2T). [score:7]
In transverse section showed that Tac1 was expressed in mesenchyme under surface ectoderm region but it was not expressed mesenchyme below mammary bud after miR-137 over -expression (Figure 2K and 2L asterisks). [score:7]
G. - L. Over-expressed miR-137 inhibits VEGF expression. [score:7]
Moreover, the cells in the tumours formed from miR-137 over -expressing cells induced the epithelial marker E-cadherin expression (Supplementary Figure S5A-S5F) but mesenchymal marker, Vimentin expression was reduced compare to control (Supplementary Figure S5G-S5L). [score:7]
We used miExpress [TM] precursor miRNA expression clone (GeneCopoeia [TM], USA) for miR-137 over -expression in mouse embryo flank and MDA-MB-231 cell. [score:7]
Expression pattern of angiogenesis and tumour suppressor markers after miR-137 overexpression. [score:7]
On the other hand, expression of known tumour suppressors, Runx3 and p53, was increased in the tumours formed by miR-137 over -expressing cells (Figure 4S- 4X; Figure 5A- 5C). [score:7]
Upon over -expression of miR-137 in mouse embryo flank during organ culture, the mammary epithelium thickened but it did not express several key genes known to be required for gland development and it also failed to invaginate into the underlying mesenchyme. [score:6]
All these results indicate that over -expression of miRNA-137 suppresses development of the mammary gland in mouse embryos. [score:6]
For each 100 mm dish, helper plasmid pCD-NL/BH*ΔΔΔ 3 μg, envelope pLTR-G 300 ng, target miR-137 expressing lentivirus DNA 3 μg were mixed in 500 μl transfection reagent FuGENE HD (Roche). [score:5]
These data suggest that miR-137 is a potential therapeutic target for breast cancer by controlling of Tac1 expression. [score:5]
However, Gata3 expression was lost its typical pattern in mammary epithelium and surface ectoderm after miR-137 over -expression (Figure 3H). [score:5]
When miR-137 is over-expressed, mammary placode formed and thickened but failed to invade the underlying mesenchyme and did not express either Tbx3 or Lef1 in mammary epithelium. [score:5]
After miR-137 over -expression, Tbx3 expression pattern was similar as control in surface view of the dorsal part embryo flank (Figure 2N). [score:5]
When we over-expressed miR-137 in this breast cancer cell line, tumour formation in vivo was suppressed. [score:5]
Staining for the sinusoidal endothelial cell marker CD31 indicated that there were a smaller number of blood vessels in the tumours made by miR-137 over -expressing MDA-MB-231 cells (Figure 4A- 4F) and furthermore the expression of vasculogenesis markers, VEGF and vWF were dramatically reduced (Figure 4G- 4L; Figure 4M- 4R). [score:5]
Figure 5 A. - C. Expression level of p53 is increased in mammary gland tissue and MDA-MB-231 cells after over -expressing miR-137. [score:5]
S. - X. Tumour suppressor Runx3 expression is substantially increased after miR-137 treatment. [score:5]
Tumour formation after SC inoculation of MDA-MB-231 cells over -expressing scrambled miRNA (controls) or over -expressing miR-137. [score:5]
Figure 3 A. Cells over -expressing miR-137 form smaller tumours than cells over -expressing scrambled miRNA. [score:5]
E. - H. Gata3 expression is disrupted by over-expressed miR-137. [score:5]
In breast cancer cells, miR-137 has been shown to target expression of ERRα [28]. [score:5]
A. - C. Expression level of p53 is increased in mammary gland tissue and MDA-MB-231 cells after over -expressing miR-137. [score:5]
We found that miRNA-137 (miR-137) is highly expressed in the 3 [rd] mammary gland at E13.5 and over -expressing it in the flank region of developing mouse embryos perturbed invasion of the epithelial mammary bud. [score:5]
IHC of vasculogenesis and tumour suppressor markers after miR-137 over -expression. [score:5]
From screens of tissue from mouse embryos for miRNAs differentially expressed in the developing mammary gland, we identified miR-137 was highly expressed. [score:5]
Y. The area of CD31, VEGF, vWF and Runx3 expression in the scramble miRNA and miR-137 over -expression group (n = 7 for each). [score:5]
Gata3 expression pattern was altered by miR-137 over -expression. [score:5]
Ectopic expression of Tac1 was detected between 3 [rd] and 4 [th] mammary gland after miR-137 over -expression (Figure 2I and 2J arrowheads). [score:5]
A. Cells over -expressing miR-137 form smaller tumours than cells over -expressing scrambled miRNA. [score:5]
Moreover, epithelial-mesenchymal transition (EMT) was inhibited in the tumours formed from miR-137 over -expressing MDA-MB-231 cells. [score:5]
Over -expression of miR-137 in in vitro organ culture and breast cancer cellsDuring cell culture (MDA-MB-231), miR-137 expressing lentiviral vector was transduced into cells. [score:5]
Tac1 and Gata3 genes whose expression is also altered by over -expression of miR-137 are also detected at early bud stages. [score:5]
M. - R. vWF expression is decreased in breast cancer after over -expression of miR-137 in MDA-MB-231. [score:5]
However, Lef1 expression was detected in broad region of mammary gland than control after miR-137 over -expression (Figure 2R). [score:5]
Thus, the failure of the mammary placode invagination by loss of Tbx3 and Lef1 after miR-137 over -expression suggests that miR-137 correlated the early stages of mammary gland development. [score:4]
To investigate the function of miR-137 in mouse mammary gland development, we over-expressed miR-137 using a lentiviral system in the flank region of E11.0 mouse embryos and then cultured the flank for 72 h. As controls, we over-expressed scrambled miRNA. [score:4]
A large number of Ki67 -positive proliferating cells were observed in tumours formed by cells expressing the scrambled miRNA compared to tumours formed by cells over -expressing miR-137 (Supplementary Figure S4A-S4D). [score:4]
The outcomes of this study reveal that miR-137 not only perturbs embryonic mammary gland development but also inhibits tumour formation by human breast cancer cells. [score:4]
I. - L. MiR-137 over -expression alters Tac1 expression. [score:4]
Down-regulated miR-137 has been observed in various cancers such as colorectal cancer, gastric cancer, oral cancer, and squamous cell carcinoma of the head and neck [24- 27]. [score:4]
Both weight and volume of tumours developing from miR-137 over -expressing cells were significantly reduced compared with tumours developing from cells over -expressing scrambled miRNA (Figure 3B and 3C). [score:4]
The CD31, VEGF and vWF positive area was reduced in the miR-137 over -expression group than in those treated with scramble miRNA treated group. [score:3]
Our focus on miR-137 initially arose from screening for genes differentially expressed in embryonic mammary glands and this shows how the study of the developing embryonic mammary gland can provide new perspectives on breast cancer. [score:3]
D. A luciferase assay result indicating that Tac1 is a direct target of miR-137. [score:3]
We identified miR-137 as a miRNA highly expressed in the developing mouse mammary gland at a stage when the mammary placode has invaginated the underlying mesenchyme to form a spherical bud. [score:3]
Interestingly, we observed that cell proliferation of subcutaneously inoculated breast cancer cells was reduced when miR-137 was over-expressed. [score:3]
Concentrated miR-137 expressing lentivirus was added 1% (v/v) in culture medium containing polybrene (Santa Cruz Biotechnology). [score:3]
A. - F. Sinusoidal endothelial cell marker CD31 is reduced after miR-137 over -expression. [score:3]
After cells grew to 80-90% confluence, wild type (psiCHECK [TM]-2 Tac1) or mutant (Mut) reporter vectors were co -transfected into Cos-7 cells with or without a miR-137 expressing lentiviral vector using FuGENE [®]H (Promega) and salmon sperm DNA (ssDNA, Sigma). [score:3]
To confirm this possibility in vivo, we over-expressed miR-137 in cells of a breast cancer cell line, then inoculated them into nude mice and found that their ability to form tumours was reduced. [score:3]
The lentiviral system also incorporated an EGFP cassette and successful over -expression of miR-137 or the control scrambled miRNA was confirmed by immunohistochemistry (IHC) using EGFP antibody and real-time quantitative polymerase chain reaction (RT-qPCR) (Figure 2C and 2D; Supplementary Figure S2A). [score:3]
Over -expression of miR-137 in the cells was confirmed by RT-qPCR (Supplementary Figure S2B). [score:3]
Figure 4 A. - F. Sinusoidal endothelial cell marker CD31 is reduced after miR-137 over -expression. [score:3]
With the over -expression of miR-137, thickened epithelium was observed in mammary placode region. [score:3]
The number of Ki67 -positive cells was counted in scramble and miR-137 over -expression group. [score:3]
Cell proliferation was reduced in the tumours formed by miR-137 over -expressing cells. [score:3]
This high level of expression in the 3 [rd] mammary gland forming region was confirmed by carrying out in situ hybridization using a miR-137 locked nucleic acid (LNA) probe to detect miR-137 transcripts (Supplementary Figure S1D). [score:3]
These results indicate that miR-137 have multiple tumour suppress function including prevention of the cell proliferation, epithelial invasion and EMT. [score:3]
Gata3 was observed in the flank mesenchyme besides the mammary bud (Figure 2F) extending both ventrally and dorsally after miR-137 over -expression (Figure 2H). [score:3]
In fact, in 3 of the mice injected with MDA-MB-231 cells over -expressing miR-137 no tumours formed at all. [score:3]
The tumours formed by miR-137 over -expressing cells were noticeably smaller than those formed by cells transfected with the scrambled miRNA (Figure 3A). [score:3]
In addition, ectopic Lef1 expression was observed in mesenchyme around mammary gland after miR-137 over-exrpression (Figure 2T). [score:3]
The area of CD31, VEGF, vWF and Runx3 expression in the scramble miRNA and miR-137 over -expression group was measured (n = 7 for each). [score:3]
The numbers of Ki67 -positive cells were 38.57 cells/100 × 100 μm and 14.14 cells/100 × 100 μm in scramble miRNA and miR-137 over -expressing group, respectively (Supplementary Figure S4E). [score:3]
Our results also showed that over -expression of miR-137 reduced tumour formation in vivo. [score:3]
Moreover, luciferase assay results indicate that Tac1, which confers a poor prognosis in breast cancer [14, 15], was the direct target of miR-137. [score:3]
It is not clear whether ERRα could be the target of miR-137 in the developing mouse mammary gland. [score:3]
Over -expression of miR-137 in in vitro organ culture and breast cancer cells. [score:3]
A., B. HE staining of sections of mammary glands that developed after miR-137 over -expression, shows that normal invasion has not taken place although the placode has thickened. [score:3]
Figure 2 A., B. HE staining of sections of mammary glands that developed after miR-137 over -expression, shows that normal invasion has not taken place although the placode has thickened. [score:3]
During cell culture (MDA-MB-231), miR-137 expressing lentiviral vector was transduced into cells. [score:3]
C., D. EGFP IHC indicates that scrambled miRNA and miR-137 have been successfully over-expressed. [score:3]
In addition, we found that angiogenesis was markedly reduced after miR-137 over -expression. [score:3]
Thus, these results showed that miR-137 can suppress tumour formation in vivo. [score:3]
Mammary gland tissue and MDA-MB-231 cells treated with the scrambled miRNA and miR-137 -expressing lentiviral vectors underwent lysis by sonication (Nextadvance) in radio-immunoprecipitation assay (RIPA) buffer (50 nM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100). [score:2]
In vivo tumour formation assay after miR-137 over -expressionRecent work has shown that miR-137 impairs proliferation and migration of MDA-MB-231 human breast cancer cells in culture [28]. [score:2]
MiR-137 induces p53 expression in mammary gland tissue and breast cancer. [score:2]
This is consistent with miR-206 having a function at a slightly earlier stage in mammary gland development than miR-137. [score:2]
Among these, the expression level of miR-137 was increased about 30 fold in the 3 [rd] mammary gland compared to inter mammary gland region (red box in Figure 1B). [score:2]
In vivo tumour formation assay after miR-137 over -expression. [score:2]
B. Tumour weight is markedly reduced after miR-137 over -expression C. as is tumour volume compared to controls. [score:2]
Runx3 expression region was increased in miR-137 treated group compared to control group (Figure 4Y). [score:2]
Function of miR-137 during mammary gland development. [score:2]
results indicate that Tac1, which confers a poor prognosis in breast cancer [14, 15], was the directly correlated to miR-137 (Figure 5D). [score:2]
Wild-type (WT) Tac1 reporters showed an inhibition of Renilla luciferase activity compared with the mutant reporter (Mut), with mismatched sequences inserted into the seed sequences of the predicted miR-137 binding site (Figure 5D). [score:2]
Relationship between miR-137 and mammary gland development. [score:2]
MiR-137 is also highly expressed in an epithelial cell line derived from the adult human breast. [score:2]
In order to investigate the relationship between miR-137 and breast tumour growth in vivo, MDA-MB-231 cells over -expressing miR-137 were inoculated subcutaneously (SC) in nude mice (n = 34) and formation of tumours were monitored 7 weeks later. [score:1]
Our functional analysis suggests that miR-137 is involved in modulating early stages of mammary gland formation in the embryo especially invasion. [score:1]
Recent work has shown that miR-137 impairs proliferation and migration of MDA-MB-231 human breast cancer cells in culture [28]. [score:1]
[1 to 20 of 95 sentences]
3
[+] score: 286
Our studies showed, for the first time to the best of the authors' knowledge, that miR-124 and miR-137: (1) are expressed at significantly lower levels in GBM tumors relative to non-neoplastic brain tissue; (2) are up-regulated during neuronal differentiation of adult mNSCs induced by growth factor withdrawal; (3) promote neuronal-like differentiation of growth-factor-deprived mNSCs, mOSCs and hGSCs; (4) promote G0/G1 cell cycle arrest in GBM cells and growth-factor-deprived hGSCs; (5) inhibit expression of CDK6 mRNA, CDK6 protein and phosphorylated RB in GBM cells. [score:10]
It remains unclear why miR-124 and miR-137 were not detected previously in GBM tumors, particularly in light of our results that show dramatic expression decreases of miR-124 and miR-137 in GBMs (and AAs) relative to non-neoplastic brain tissue, and results that show clear down-regulation of miR-124 expression in human oligodendrogliomas [28], human astroblastomas [32] and GBM cell lines [32, 33]. [score:8]
CDK6 is an established target of miR-124 in HCT-116 colon cancer cells [26], a predicted target of miR-137 (TargetScan and PicTar), and has been functionally implicated in the development of multiple malignancies. [score:8]
We tested, therefore, whether expression of miR-124 and miR-137 could be activated in GBM cell lines following treatment with 5-aza-2'-deoxycytidine (5-aza-dC), a DNA methylation inhibitor and/or TSA, a histone deacetylase inhibitor. [score:7]
miR-124 and miR-137 are down-regulated in high-grade gliomas and up-regulated during adult NSC differentiation. [score:7]
Overexpression of miR-124 or miR-137 also reduced the expression of phosphorylated RB (Figure 6B), a downstream target of CDK6 [30]. [score:7]
Our studies revealed that miR-137, as well as miR-124, inhibited expression of CDK6, a predicted target of both miRNAs. [score:7]
Figure 1 miR-124 and miR-137 are down-regulated in anaplastic astrocytomas and glioblastoma multiformes and are up-regulated in glioblastoma multiforme cell lines following treatment with DNA demethylating agents. [score:7]
MiRNA-124 is down-regulated in human oligodendrogliomas [28], and both miR-124 and miR-137 are down-regulated over 10-fold in S100β-v- erbB tumor stem cells relative to mNSCs (Additional file 7). [score:7]
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
The second mechanism by which miR-124 and miR-137 expression may be suppressed in GBM stem cells is via epigenetic modification of their transcriptional regulatory sequences. [score:6]
As we observed that expression of miR-124 and miR-137 is reduced in HGAs and that miR-124 and miR-137 promote differentiation of non-neoplastic adult mNSCs, we tested next whether up-regulation of miR-124 and miR-137 could promote differentiation of brain tumor-derived stem cells. [score:6]
Expression of microRNA-137 was increased 3- to 12-fold in glioblastoma multiforme cell lines U87 and U251 following inhibition of DNA methylation with 5-aza-2'-deoxycytidine (5-aza-dC). [score:5]
These results suggest that targeted delivery of microRNA-124 and/or microRNA-137 to glioblastoma multiforme tumor cells may be therapeutically efficacious for the treatment of this disease. [score:5]
Given that activation of EGF [37], PDGF [38] and FGF [39] signaling pathways have each been implicated in gliomagenesis, it is reasonable to speculate that one mechanism by which growth factor signaling promotes brain tumor formation is through suppression of miR-124 and/or miR-137 expression and NSC/TSC differentiation. [score:5]
Our differentiation studies in mNSCs suggested that growth factor signaling, which is recurrently activated in HGAs, suppresses expression of miR-124 and miR-137. [score:5]
These results suggest that targeted delivery of miR-124 and/or miR-137 to GBM tumor cells may be therapeutically valuable for GBM disease treatment. [score:5]
Figure 6 CDK6 expression is inhibited by miR-124 and miR-137 in glioblastoma multiforme cells. [score:5]
miR-124 and miR-137 inhibit CDK6 expression and phosphorylated retinoblastoma levels in GBM cells. [score:5]
To validate that the 3' UTR of CDK6 is a direct target of miR-137, we used a luciferase reporter system in which the predicted miR-137 binding site of CDK6 was cloned downstream of luciferase. [score:4]
To test whether up-regulation of miR-124 and miR-137 promote differentiation of adult mNSCs, we transfected proliferating mNSCs with double-stranded RNA oligonucleotides corresponding to the mature sequences of each miRNA. [score:4]
Therefore, miR-137, in addition to miR-124, is a direct inhibitor of CDK6. [score:4]
To ascertain the molecular mechanisms by which miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells, we assessed expression of CDK6, a regulator of the cell cycle and differentiation (reviewed in [29]), following transfection of these miRNAs to U251 cells. [score:4]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
It is interesting to note that CDK6 is known to regulate both cell cycle progression and differentiation (reviewed in [29]), suggesting that mir-124- and miR-137 -mediated inhibition of CDK6 may, in part, account for the observed effects on GBM cell proliferation and differentiation in this study. [score:4]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
Further, as with miR-124a (see [26]), our results show that miR-137 is a direct inhibitor of CDK6. [score:4]
Mutation of the CDK6 miR-137 seed region rendered the reporter construct insensitive to inhibition by miR-137 (Figure 6D). [score:4]
Regulation of miR-124 and miR-137 expression. [score:4]
The ability of miR-124 and miR-137 to induce potent antiproliferative and prodifferentiation effects in CD133+ and CD133- human GBM cells suggests their potential value for treatment of this disease. [score:3]
Assessment of miR-124a and miR-137 expression in mouse oligodendroglial stem cells. [score:3]
Transfection of microRNA-124 or microRNA-137 induced morphological changes and marker expressions consistent with neuronal differentiation in mouse neural stem cells, mouse oligodendroglioma-derived stem cells derived from S100β-v- erbB tumors and cluster of differentiation 133+ human glioblastoma multiforme-derived stem cells (SF6969). [score:3]
Figure 5 miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme stem cells and induce cell G0/G1 cycle arrest. [score:3]
pMIR-REPORT vectors harboring CDK6-3'UTR sequences with wild type (WT) miR-137 binding sites or mutated (MUT) miR-137 binding sites were generated by cloning the following oligonucleotides into the HindIII and SpeI restriction sites of pMIR-REPORT: CDK6-UTR-WT fw 5'-AGCTTGATCACAGAAATATTGCTAGCTGATACATATTATTGCATTTCATAAAACTA CDK6-UTR-WT rv 5'-CTAGTAGTTTTATGAAATGCAATAATATGTATCAGCTAGCAATATTTCTGTGATCA CDK6-UTR-MUT fw 5'-AGCTTGATCACAGAAATTAACGAAGCTGATACATATTATTGCATTTCATAAAACTA CDK6-UTR-MUT rv 5'-CTAGTAGTTTTATGAAATGCAATAATATGTATCAGCTTCGTTAATTTCTGTGATCA Cells were transfected with (1) miR-137 or cel-miR-67 -negative-control mimics (50 nM), (2) pMIR-REPORT vectors containing WT or MUT miR-137 binding sites (400 ng) and (3) pRL-SV40 (Promega) expressing Renilla luciferase (400 ng) for normalization. [score:3]
Further analyses are required to determine the relative contributions of EGF-, FGF- and PDGF -induced signaling on suppression of miR-124 and miR-137 transcription in adult NSCs and GBM tumor stem cells. [score:3]
Further analyses of miR-137 and miR-124 promoter sequence methylation in primary tumors, TSCs and NSCs are warranted to establish the degree to which epigenetic mechanisms contribute to suppression of these miRNAs in HGAs. [score:3]
Levels of phosphorylated retinoblastoma (RB) (pSer 807/811), a known target of CDK6 [30], were also reduced in response to miR-124 and miR-137 transfection (Figure 6B). [score:3]
The first mechanism is growth factor signaling: removal of EGF, and FGF from the culture media resulted in robust increases in miR-124 and miR-137 expression in adult NSCs. [score:3]
Our results reveal two potential mechanisms by which miR-124 and miR-137 may be suppressed in stem cells and/or tumor cells. [score:3]
We observed that the majority of the HGA-miRNAs show expression changes during, or have been implicated in, differentiation of various cell lineages: miR-7 during photoreceptor differentiation [23]; miR-124 and miR-137 during erythropoiesis [24]; miR-124 and miR-218 during neuronal differentiation of embryonal carcinoma cell differentiation [25]; miR-124 during neuronal differentiation of ES cells [12]. [score:3]
Thus, overexpression of miR-124 and miR-137 enhances neuronal-like differentiation of adult NSCs in vitro. [score:3]
To further investigate the role of miR-137 in neuronal differentiation of GBM cells, we assessed expression of an additional neuronal marker, MAP2, following overexpression of miR-137. [score:3]
Click here for file Assessment of miR-124a and miR-137 expression in mouse oligodendroglial stem cells. [score:3]
Consistent with our observations in mNSCs, we observed a significant increase in the numbers of cells that express the neuronal marker Tuj1 following transfection with miR-124, miR-137 or a combination of both miRNAs (Figure 4A). [score:3]
Our studies revealed that expression levels of microRNA-124 and microRNA-137 were significantly decreased in anaplastic astrocytomas (World Health Organization grade III) and glioblastoma multiforme (World Health Organization grade IV) relative to non-neoplastic brain tissue (P < 0.01), and were increased 8- to 20-fold during differentiation of cultured mouse neural stem cells following growth factor withdrawal. [score:3]
We observed that miR-137 expression increased in GBM cell lines U87 and U251 following treatment with the DNA demethylating agent 5-aza-dC (Figure 1B). [score:3]
miRIDIAN miRNA mimic negative control (cel-miR-67) and miRIDIAN miRNA mimics (mmu-miR-124, mmu-miR-137) were purchased from Dharmacon (Lafayette, CO) and validated using the pMIR-REPORT miRNA Expression Reporter Vector System (Ambion, Austin, TX). [score:3]
While this does not change our conclusions that miR-124 and miR-137 can induce mNSC-, mOSC- and human GBM-derived stem cell (hGSC)-differentiation, it indicates that in situ expression analyses of miRNAs in HGAs, non-neoplastic adult brain tissue, and during fetal- and post-natal development of the mammalian central nervous system will be an important component of studies aimed at investigating the functions of miRNAs during normal brain development and tumorigenesis. [score:3]
Transfection of microRNA-124 or microRNA-137 also induced G1 cell cycle arrest in U251 and SF6969 glioblastoma multiforme cells, which was associated with decreased expression of cyclin -dependent kinase 6 and phosphorylated retinoblastoma (pSer 807/811) proteins. [score:3]
Our results indicate that overexpression of either miR-124 or miR-137 promotes neuron-like differentiation of non-neoplastic adult (mNSCs), mOSCs and CD133+ hGSCs. [score:3]
miR-124 and miR-137 inhibit proliferation of GBM cell lines. [score:3]
Overall, the most robust effects of miR-124 and miR-137 overexpression on cellular differentiation and proliferation were observed in growth factor-deprived human cells (Figures 4B and 5B). [score:3]
Although we restricted further analyses of these six miRNAs to miR-124 and miR-137 because of their elevated expression during adult NSC differentiation (Figure 1B), assessments of the other HGA-miRNAs may lead to novel insights into the biology of high-grade gliomas. [score:3]
Since exit from the cell cycle is required for induction of differentiation, we tested whether miR-124 and miR-137 inhibit proliferation of GBM cells. [score:3]
Our results show that miR-124 and miR-137 can induce neuronal differentiation of OSCs and GBM stem cells and inhibit proliferation of GBM cell lines. [score:3]
A total of 100 nM miRIDIAN miRNA mimics (50 nM each for miR-124 and miR-137 co-transfections) were complexed with LipofectAMINE 2000 (Invitrogen) and added directly to cells growing in proliferating medium. [score:2]
Regulation of differentiation and the cell cycle by miR-124 and miR-137. [score:2]
MiRNA-137 expression increased up to 8-fold in GBM cell lines treated with 5-aza-dC, and up to 12-fold in cells treated with both 5-aza-dC and TSA (Figure 1B and Additional file 8). [score:2]
These data suggest that epigenetic modification of regulatory sequences in CpG islands may contribute to miR-124 and miR-137 silencing in GBMs. [score:2]
Further investigations are needed to define the relationship between CDK6 down-regulation and cell cycle arrest and/or differentiation in GBM stem cells, and to identify and characterize additional miR-124 and miR-137 target genes. [score:2]
miR-124 and miR-137 promote neuronal differentiation of adult NSCs. [score:1]
Our studies show that miR-124 and miR-137 enhance neurogenesis of mNSCs, mOSCs and hGSCs in the absence of growth factor signaling. [score:1]
Unsorted SF6969 GBM cells were transfected with miR-137 and cultured for 10 days in NBE media without growth factors. [score:1]
Transfection with either miR-124 or miR-137 resulted in rounded or trapezoidal cellular morphology of Tuj1 -positive cells with reduced neuritic outgrowth. [score:1]
Cells were transfected with miR-124 and/or miR-137 (100 nM) or a negative control oligonucleotide for 4 hours using lipofectamine. [score:1]
Further testing of miR-124 and miR-137 in pre-clinical mo dels of GBM [52, 53] in conjunction with various delivery strategies will help define their ultimate therapeutic potential for treatment of GBM. [score:1]
Levels of phosphorylated RB (pSer 807/811) are also markedly reduced in response to miR-124 or miR-137 transfection. [score:1]
In addition to the expected increase of cells positive for Tuj-1 after 10 days, we also observed an evident increase in MAP2-postive cells following transfection of miR-137 (Figure 4C). [score:1]
miR-124 and miR-137 promote neuronal differentiation of brain TSCs. [score:1]
We also observed that transfection of miR-124 and miR-137 reduced the numbers of GFAP -positive mOSCs (Figure 4A). [score:1]
Collectively, our results suggest that while miR-124 and miR-137 have the capacity to induce alone cell cycle arrest and differentiation in human GBM cells and stem cells, abrogation of growth factor signaling enhances their capacity to do so. [score:1]
Figure 3 miR-124 and miR-137 promote neuronal differentiation of subventricular zone-neural stem cells. [score:1]
Relative to control oligonucleotides, transfection of miR-124 or miR-137 resulted in a marked reduction in the number of cells in the S-phase of the cell cycle and a marked increase in the number of cells in G0/G1 in U251 GBM cells (Figure 5A) and early passage GBM cells derived from a newly diagnosed human GBM (Figure 5B). [score:1]
Distinct morphological changes were also apparent for each miRNA; miR-124 induced neuritic branching of the cells whereas miR-137 induced a rounded or trapezoidal cellular appearance with no neuritic outgrowth (Figure 3A and 3B). [score:1]
Figure 4 Induction of neuronal differentiation of tumor-derived neural stem cells by miR-124 and miR-137. [score:1]
Finally, transfection of miR-124, but not miR-137, resulted in a 2-fold decrease in the numbers of GFAP -positive cells (Figure 3A and 3C). [score:1]
A control reporter vector was also developed in which the seed region of the miR-137 binding site was mutated (Figure 6C). [score:1]
We also identified a number of miRNAs, including miR-124 and miR-137, which have not been described in prior GBM profiling studies. [score:1]
However, cell cycle arrest was more pronounced in miR-124- and miR-137 -transfected GBM cells (SF6969) that were deprived of growth factors (Figure 5B). [score:1]
microRNA-124 and microRNA-137 induce differentiation of adult mouse neural stem cells, mouse oligodendroglioma-derived stem cells and human glioblastoma multiforme-derived stem cells and induce glioblastoma multiforme cell cycle arrest. [score:1]
Therapeutic potential of miR-124 and miR-137. [score:1]
Although we have not tested whether miR-124 and miR-137 alone can induce differentiation of the various stem cells tested in this study, transfection of miR-124 or miR-137 alone was sufficient to induce G1 cell cycle arrest in standard GBM cell lines (Figure 5A). [score:1]
These results suggest that miR-124 and miR-137 may be useful therapeutic agents for the treatment of GBMs. [score:1]
Transfection of miR-124 and/or miR-137 dramatically increased the percentage of Tuj1 -positive cells, and reduced the percentage of GFAP -positive cells and in both CD133+ and CD133- GBM cell fractions (Figure 4B). [score:1]
Our data suggest that miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells. [score:1]
Transfection of either miR-124 or miR-137 resulted in a 5-fold increase in the numbers of cells stained with the neuronal marker Tuj1 relative to controls (Figure 3A, B and 3C). [score:1]
Mutated bases (underlined) were also introduced into the miR-137 seed region (boxed) of the cyclin -dependent kinase 6-3'UTR (mutated). [score:1]
was conducted by fluorescence-activated cell sorter at 48 hours after transfection of 100 nM (final total microRNA concentration) miR-124, miR-137, miR-124 and miR-137 together or negative control oligonucleotides (neg#1, neg#2) to U251 (A) and SF6969 (B) glioblastoma multiforme cells. [score:1]
Further, miR-137 is closely associated with a large CpG island [27], suggesting that it may also be epigenetically silenced in tumors. [score:1]
Again, as in mNSCs and oligodendroglioma tumor spheres, miR-137 induced rounded morphology with little evidence of neuritic outgrowth (Figure 4C). [score:1]
Both CD133+ and CD133- cells were transfected with miR-124 and/or miR-137 and then cultured for 10 days in NBE media without growth factors. [score:1]
Co-transfection of U251 cells with a WT CDK6-3'UTR (CDK6-WT) reporter and the miR-137 mimic resulted in a significant decrease in luminescence (P < 0.0001) relative to cells co -transfected with CDK6-WT and a negative control miRNA mimic (Figure 6D). [score:1]
In independent experiments we observed marked reductions of CDK6 transcript (Figure 6A) and CDK6 protein (Figure 6B) in response to miR-124 and miR-137 transfection. [score:1]
The inset shows a Tuj1+ cell with neuronal morphology from a miR-124 and/or miR-137 cotransfection. [score:1]
Collectively, our results show that in the absence of growth factor signaling, miR-124 and miR-137 enhance neuron-like differentiation of oligodendroglial and GBM TSCs. [score:1]
We tested next whether miR-124 and miR-137 could promote differentiation of human GBM stem cells. [score:1]
[1 to 20 of 96 sentences]
4
[+] score: 211
We also found c-Met expression could be up-regulated by silencing of miR-137 and suppressed by coexpression of Mecp2 and miR-137. [score:10]
In the current study, our results suggested Mecp2 could upregulate c-Met expression by silencing miR-137 expression (Fig. 6d). [score:8]
The expressions of c-Met were suppressed again when the miR-137 expression was recovered (Fig. 6a), (Fig. 6b,c). [score:7]
The findings strongly suggested miR-137 could directly target c-Met and regulate c-Met expression in vitro and in vivo. [score:7]
The epigenetic silencing of miR-137 caused by the upregulation of Mecp2 induces c-Met expression and contributes CRC development. [score:7]
Furthermore, the expression of c-Met, the target of miR-137, was significantly increased because of inhibition of miR-137 (Fig. 5c). [score:7]
Cluster analysis of aberrant mRNA expression in colorectal ACS according to a mRNA sequencing and validation of Mecp2 regulating miR-137 expressions in CRC cell lines. [score:6]
The miR-137 whose expression was down-regulated in colorectal adenomas and carcinomas was further validated. [score:6]
Aberrant epigenetic regulation of miR-137 promoter, such as DNA hypermethylation, may represent a key mechanism for miR-137 down-regulation in several human cancers 16. [score:5]
In coordination with in vivo study, overexpression of miR-137 was found to inhibit colorectal tumor progression and hepatic metastasis as well. [score:5]
Over expression of miR-137 inhibits CRC cell proliferation, colony formation, migration, and invasion in vitro. [score:5]
QRT-PCR analysis of miR-137 expression in 30 colorectal adenoma tissues and in 70 CRCs showed miRNA-137 was not only differentially expressed in colorectal adenoma (Fig. 1b; P = 0.041), but also significantly reduced in tumor tissues (Fig. 1c; P < 0.001). [score:5]
In this study, we focused on Mecp2 which was reported to epigenetically regulate specific miRNAs in adult neural stem cells 9. Our results suggested miR-137 expression in CRC was subjected to epigenetic regulation mediated by Mecp2. [score:5]
Cluster analysis of aberrant miRNA expression in colorectal ACS according to a small RNA sequencing and qQRT-PCR validation of miR-137 expressions in human tissues. [score:5]
In addition, we overexpressed Mecp2 in HCT116 and LoVo cells and found that miR-137 expression was significantly decreased (Fig. 5b). [score:5]
C-Met was selected for further analysis because of its involvement in various malignances and was predicted to be a target of miR-137 in melanoma 7. In vitro and in vivo assays were conducted to determine if miR-137 could regulate c-Met expression in CRC. [score:5]
Overexpression of miR-137 inhibits colorectal tumor growth and hepatic metastasis in vivo. [score:5]
We found miR-137, a key molecular in cross talk between microRNAs and epigenetic regulation in the carcinogenesis 9, was significantly down-regulated in colorectal adenomas and carcinomas, comparing to normal tissues. [score:5]
In both cell lines, colony formation ability was inhibited by the overexpression of miR-137 (Fig. 2c). [score:5]
Overexpressed Mecp2 relieved the suppression of c-Met by miR-137. [score:5]
Both Target Scan and Pictar systems were used to identify putative gene targets of miR-137. [score:5]
Over expression of miR-137 inhibits CRC cell proliferation, colony formation, migration, and invasion in vitroThe biological role of miR-137 was examined in vitro by functional assays. [score:4]
MiR-137 is constitutively expressed in colonic epithelium and epigenetic silencing of miR-137 is an early event in colorectal carcinogenesis 8. To study the epigenetic profile and its role in regulating human ACS, a transcriptome analysis in 18 colorectal ACS tissues collected from the same 6 patients was performed. [score:4]
Mecp2-regulated epigenetic silencing of miR-137 contributes to colorectal ACS and tumor progression by relieving the suppression of c-Met. [score:4]
Taken together, we have shown the tumor suppressor role of miR-137 in CRC development. [score:4]
C-Met is one of the miR-137 targets and is negatively regulated by miR-137. [score:4]
Overexpression and knockdown of miR-137. [score:4]
How to cite this article: Chen, T. et al. Mecp2 -mediated Epigenetic Silencing of miR-137 Contributes to Colorectal Adenoma-Carcinoma Sequence and Tumor Progression via Relieving the Suppression of c-Met. [score:3]
Forced expression of miR-137 was associated with reduce c-Met mRNA levels in both cell lines (Fig. 4a,b). [score:3]
The results from cell migration and invasion assays showed that the overexpression of miR-137 significantly inhibited HCT116 and LoVo cell migration and invasion via cell migration and invasion assays (Fig. 2d,e). [score:3]
Furthermore, the results obtained from qRT-PCR and Western blot analysis confirmed both mRNA and protein of c-met are negatively associated with miR-137 expression. [score:3]
Similarly, less hepatic metastasis nodes were found in rats with cells that overexpressed miR-137 (Fig. 3c,d). [score:3]
MiR-137 mimics were transfected into HCT116 and LoVo cell to transiently increase the miR-137 expression. [score:3]
MiR-137 was found to be consistently down-regulated in 6 pairs of adenoma and carcinoma tissues. [score:3]
MiR-137 alterations affect ACS and tumor progression by down regulating c-Met expression. [score:3]
It has been reported that miR-137 functioned as a tumor suppressor in cancer types such as head-neck cancer and gastric cancer 11 12. [score:3]
Lower expression of miR-137 increased c-Met mRNA levels in both cell lines (Fig. 4a,b). [score:3]
To identify the role of the miR-137 in CRC development, functional assays were performed and aberration of miR-137 expression was shown to alter cell proliferation, colony formation, migration, and invasion in CRC cell lines as well as tumor growth and liver metastasis in mouse mo dels. [score:3]
Taken together, our results identified a new regulatory network of the miR-137/c-Met nexus, which is not reported in ACS but functions as an oncogenic miRNA in CRC development. [score:3]
Overexpression of miR-137 inhibits colorectal tumor growth and hepatic metastasis in vivoTo further investigate the in vivo effect of miR-137 on tumor formation and metastasis, HCT116 cells, which were stably transfected with either LV. [score:3]
Expression of miR-137 in 6 CRC cell lines and colon mucosa cell line NCM640 was shown in Fig. 2a. [score:3]
We found that the expression of both c-Met was negatively correlated with miR-137 (Fig. 4c,d). [score:3]
At 4 weeks post-injection, the average tumor size was found to be significant smaller in rats injected with cells that overexpressed miR-137 compared with the control group (Fig. 3a,b). [score:2]
These results suggest a regulatory cascade from MeCP2, miR-137, to c-Met exists (Fig. 6d). [score:2]
Mecp2 is a DNA methyl-CpG -binding protein and was reported to epigenetically regulate miR-137 in adult neural stem cells 9. In the current study, a ChIP assay was performed and we confirmed that Mecp2 could directly bind to the promoter of miR-137 (Fig. S1). [score:2]
Effect of miR-137 on proliferation, colony formation, migration, and invasion of HCT116 and LoVo cells. [score:1]
When the clinicopathological implication of miR-137 was analyzed in CRC patients it is found that low miR-137 levels were negatively correlated to tumor TNM stage (Fig. 1d; P = 0.019) and metastasis (Fig. 1e; P = 0.017). [score:1]
In addition, the miR-137 level was significantly correlated with CRC progression. [score:1]
HCT116 and LoVo cells were transfected with miR-137 or control mimics respectively. [score:1]
LV-miR-137, si-miR-137, and miR-137 mimics were purchased from GeneChem, Shanghai China. [score:1]
miR-137)-infected HCT116 and LoVo cells comparing with the negative control (LV. [score:1]
Anti-miR-137, and anti-miRNA control were then transfected into the above 2 cell lines. [score:1]
In this study, we focus our investigation on the role of miRNAs in colorectal ACS via small RNA sequencing analysis and found low expression of miR-137 may be involved in. [score:1]
To further confirm the deduction, Mecp2 plasmid and miR-137 mimics were transfected into HCT116 and LoVo cells. [score:1]
HCT116 cells infected with LV-miR-137 or LV-NC were harvested and injected into female nude (nu/nu) mice (5 × 10 [6] viable tumor cells/mouse for the subcutaneous xenograft tumor mo del and 1 × 10 [6] viable tumor cells/mouse for the intraspleenic liver metastasis mo del). [score:1]
A significant decrease in cell proliferation was observed in both miR-137 lentivirus (LV. [score:1]
Epigenetic silencing through promoter methylation of miR-137 is an early event in colorectal adenomas and the following carcinogenesis 8. from silico analysis have found several epigenetic genes altered in ACS. [score:1]
miR-137 or LV. [score:1]
[1 to 20 of 58 sentences]
5
[+] score: 190
Other miRNAs from this paper: hsa-mir-137
Inhibition of CXCL12 expression enhances miR-137 -mediated inhibition. [score:7]
In order to identify the effect of CXCL12 expression inhibition on miR-137 -mediated the development of GBM, the CXCL12 siRNAs were co -transfected into U87 and U251 cells with miR-137 mimics. [score:6]
Subsequently, we used bioinformatics analysis and cell transfection to demonstrate the tumor-suppressing effects of miR-137 were due to down-regulation of CXCL12. [score:6]
In addition, miR-137 mimics and si-CXCL12 synergically inhibited the expression of CXCL12 (Figure 7B). [score:5]
In conclusion, our work demonstrated that miR-137 serves as a tumor suppressor by inhibition of CXCL12 in human GBM. [score:5]
These findings suggested that miR-137 expression exerts the inhibitory effects on GBM cell migration and invasion. [score:5]
The target genes of miR-137 were selected based on target scan algorithms [microRNA. [score:5]
We found that miR-137 mimics or si-CXCL12 obviously inhibited the expression of CXCL12 than miR-NC or si-control group respectively (Figure 7A). [score:5]
In vitro data further indicated that miR-137 expression plays a suppressive role in tumor cell proliferation, migration and invasion. [score:5]
Furthermore, the expression of CXCL12 protein was reduced in the miR-137 mimics and 3′-UTR-wt-co -transfected U87 cell lines as compared with the miR-137 mimics and 3′-UTR-mut-co -transfected U87 cell lines These results suggested that the 3′-UTR of CXCL12 is a direct target of miR-137. [score:5]
We found that the expression of EGFR and Bcl-2 protein was significantly decreased in U87 and U251 cells transfected with miR-137, while the expression of EGFR and Bcl-2 protein in miR-NC group were not affected (Figure 3B). [score:5]
CXCL12 over -expression attenuates miR-137 -mediated inhibition. [score:5]
We found that the expression of miR-137 was significantly decreased in U87 and U251 cells, while the expression of miR-137 was obviously increased in normal NHA cells (p<0.01; Figure 2A). [score:5]
The 3′-UTR of CXCL12 is a direct target of miR-137. [score:4]
These findings indicated that miR-137 expression affected cell proliferation in the development of GBM. [score:4]
To identify whether the 3′-UTR of CXCL12 mRNA was a direct target of miR-137, we inserted a 3′-UTR (wt/mut) sequence of CXCL12 mRNA into a luciferase reporter vector, and then we detected the luciferase density. [score:4]
To figure out the role and significance of miR-137 and CXCL12 in the development of GBM, we firstly detected the expression of miR-137 and CXCL12 in 50 cases of tumor tissues and paired adjacent non-tumor tissues. [score:4]
In the present work, our study showed that U87 and U251 cells transfected with miR-137 mimics indeed decreased the expression of EGFR, MMP2 and MMP9 proteins than control, suggesting that miR-137 reduced GBM cell proliferation and invasion. [score:3]
The miR-137 mimic inhibited the luciferase activity controlled by wild-type CXCL12-3’-UTR (B) but did not affect the luciferase activity controlled by mutant CXCL12-3’-UTR (C) in U87 and U251 cells. [score:3]
These results indicated that miR-137 exerts the inhibitory effects on GBM cell migration and invasion. [score:3]
Figure 1 (A-B) The RT-PCR analysis of miR-137 and CXCL12 mRNA expression were conducted in tumor tissues and matched non-tumor tissues. [score:3]
Figure 6 (A) The proliferation capacity of miR-137 -overexpressing U87 and U251 cells was partially improved when cells were transfected with CXCL12 plasmids in comparison with miR-NC. [score:3]
CXCL12 is a candidate target of miR-137. [score:3]
This result suggested that cell proliferation was obviously inhibited owing to transfection of miR-137 mimics. [score:3]
miR-137 -overexpressing or control cells (5 × 10 [6] per mouse, 3 mice per group) were subcutaneously injected into the right flanks of mice. [score:3]
In the present study, the expression detection of miR-137 and CXCL12 was subjected to qRT-PCR analysis. [score:3]
The expression profile of miR-137 and CXCL12 in GBM tissues. [score:3]
The expression of miR-137 and CXCL12 in GBM tissues. [score:3]
The expression of miR-137 and CXCL12 in GBM cell lines. [score:3]
Figure 2 (A-B) RT-PCR analysis of miR-137 and CXCL12 expression in glioblastoma U87 and U251 cell lines. [score:3]
Thus, miR-137-CXCL12 can be recommended as a useful and effective target for treatment of GBM. [score:3]
We found the expression of miR-137 was obviously decreased in tumor tissues than that in paired non-tumor tissues (p<0.01; Figure 1A). [score:3]
miR-137 inhibits glioblastoma cell proliferation. [score:3]
Previous reports suggested that miR-137 expression is reduced and suggested as a prognosis biomarker in many kinds of tumors, involving lung cancer, colorectal cancer [9], and oral squamous cell carcinoma [10]. [score:3]
However, the expression and the role of miR-137 in GBM have not been clearly reported till now. [score:3]
The expression profile of miR-137 and CXCL12 in GBM cell lines. [score:3]
Besides, we applied western blot to investigate the change of cell invasion-related molecules, and observed that the expression of MMP2 and MMP9 protein in U87 and U251 cells with miR-137 mimics was obviously reduced, while their expression levels were increased in U87 and U251 cells with miR-NC (p<0.01) (Figure 4C). [score:3]
Our study firstly showed that the expression of miR-137 was reduced in tumor tissues than that in paired non-tumor brain tissues. [score:3]
We further evaluated whether CXCL12 is an objective target of miR-137, which would be a potential target for treatment of human glioblastoma. [score:3]
The wound healing analysis showed that miR-137 mimics had the capacity to inhibit U87 or U251 cell migration as compared with miR-NC group (p<0.01) (Figure 4A). [score:2]
In addition, our transwell analysis further showed that CXCL12 siRNAs in U87 and U251 cells with miR-137 mimics inhibited U87 and U251 cell invasion as compared with their controls (Figure 6D). [score:2]
Meanwhile, the expression of Bax protein was also increased in U87 and U251 cells transfected with miR-137 mimics as compared with miR-NC group (Figure 3B). [score:2]
In order to identify the effect of CXCL12 on miR-137 -mediated the development of GBM, the pcDNA3.1(+)-CXCL12 plasmids were co -transfected into U87 and U251 cells with miR-137 mimics. [score:2]
MiR-137 affects engrafted tumor growth in vivoAs mentioned above, in-vitro assay demonstrated that miR-137 expression affected GBM progression. [score:2]
This is the first study to explore the post-transcriptional regulation of CXCL12 by miR-137 in human GBM. [score:2]
These results were consistent with some previous reports, indicating that miR-137 is involved into the development of human GBM [18]. [score:2]
As mentioned above, in-vitro assay demonstrated that miR-137 expression affected GBM progression. [score:2]
Tumor volume analysis showed that the volume value of U87-engrafted tumor with miR-137 mimics got significantly slower than their controls (Figure 7D), indicating that miR-137 mimics repressed U87-engrafted tumor growth. [score:1]
For 3’UTR luciferase assay, the putative binding sites of miR-137 and its homologous mutation sites in the 3’-UTR region of CXCL12 mRNA were amplified and cloned into pGL3-contral luciferase reporter plasmid (Invitrogen, Carlsbad, CA). [score:1]
However, the role of miR-137/CXCL12 in human GBM is still unknown. [score:1]
Quantification analysis was defined as the relative density of miR-137 and CXCL12 mRNA to U6 and GAPDH, respectively. [score:1]
Cells were transfected with or without NC miRNAs or miR-137 mimics. [score:1]
U87 and U251 cells were transfected with miR-137 mimics or scramble control. [score:1]
Figure 3 (A) Cells were transfected with miR-137 mimics and identified by RT-PCR. [score:1]
Quantification analysis was defined as the relative density of miR-137 and CXCL12 mRNA to U6 and GAPDH respectively. [score:1]
We demonstrated no toxic effects of miR-137 on nude mice. [score:1]
We observed that miR-137 mimics decreased the luciferase intensity of U87 cells transfected with CXCL12-3’UTR-wt in a dose -dependent fashion (Figure 5B), while miR-137 mimics did not altere the luciferase activity of U87 cells transfected with CXCL12-3’UTR-mut (Figure 5C). [score:1]
CXCL12 affects the effect of miR-137 on cell proliferation and invasion. [score:1]
Cells were transiently transfected with 50 nmol of the miR-137 mimic with Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendation. [score:1]
In the present study, firstly, we used three miRNA databases to predict common and putative miR-137 -binding sequences located in the 3′-UTR of CXCL12 mRNA (Figure 5A). [score:1]
Transient transfection of miR-137 oligonucleotides. [score:1]
Tumor weight analysis showed that the weight value of U87-engrafted tumor with miR-137 mimics was significantly lower than their controls (Figure 7C). [score:1]
We found that miR-137 mimics effectively reduced the number of viable cells of U87 and U251 cells, while cells in miR-NC group were not affected (p<0.01) (Figure 3A). [score:1]
miR-137 affected the growth of U87-engrafted tumor. [score:1]
Effects of miR-137 on GBM cell proliferation. [score:1]
Figure 5 (A) The WT and Mut of 3′UTR of CXCL12 mRNA contains the binding sequences of miR-137. [score:1]
Effects of miR-137 on GBM cell migration and invasion. [score:1]
miR-137 reduces GBM cell migration and invasion. [score:1]
Based on results above, we evaluated the expression of miR-137 and CXCL12 in U87 and U251 cell lines. [score:1]
Panels show U87 and U251 cell invasion after transfection with miR-137 mimics or miR-NC. [score:1]
[1 to 20 of 70 sentences]
6
[+] score: 57
miR-137 is an important regulator of cellular proliferation and differentiation, through regulating translation of the histone methylase, EZH2, thus influencing H3K27 tri-methylation (Mahmoudi and Cairns, 2017). [score:5]
In agreement with this, a recent study has shown that miR-137 overexpression inhibits the inflammatory reaction resulting from spinal cord injury (Gao et al., 2017). [score:5]
MiR-137 inhibited inflammatory response and apoptosis after spinal cord injury via targeting of MK2. [score:4]
Additionally, the correlation analyses we performed suggest that the degree of hydroxymethylation at the miR-137 promoter region interrogated is higher in hippocampi with higher TET1 and TET2 expressions. [score:3]
Changes in neurogenesis, miR-137 expression and hydroxymethylation patterns at the miR-137 gene could then be examined. [score:3]
The correlation between the levels of 5hmC in miR-137 and TET2 expression in the hippocampus was not significant [Pearson's r [(13)] = 0.5244, p = 0.0658] (Figure 2H). [score:3]
The exercise-related changes to TET1 and TET2 expression in aged hippocampi of old mice were accompanied by an approximately 3-fold increase to the level of 5hmC at the internal promoter of the neurogenic factor, miR-137. [score:3]
Therefore, change in hydroxymethylation at the miR-137 internal promoter could affect neurogenesis levels by modifying miR-137 expression. [score:3]
Correlation between 5hmC (miR-137) levels and hippocampal expression of (G) TET1 or (H) TET2 in aged mice. [score:3]
Additionally, we found significant positive correlation between the levels of 5hmC in miR-137 and TET1 expression in the hippocampus [Pearson's r [(12)] = 0.598, p = 0.0400] (Figure 2G). [score:3]
We found that voluntary exercise counteracts the age-related decrease in TET1 and TET2 expression, improves memory and increases miR-137 5hmC levels in the hippocampus of aged mice. [score:3]
Additionally, an increase in miR-137 promoter hydroxymethylation could be implicated in regulating aged-related neuroinflammation. [score:2]
Amongst others, miR-137 regulates the levels of Ezh2, the histone methylase responsible for tri-methylating lysine 27 in histone 3 (H3K27me3), which defines the “poised state” (H3K27me3, H3K4me3) found in many neurogenic genes during neurogenesis (silent genes poised to be activated upon H2K27me3 demethylation). [score:2]
miR-137 was chosen for this study due to its crucial role in a feedback loop regulating adult neurogenesis (which also includes MeCP2 and Ezh2). [score:2]
The miR-137 sequence was obtained from www. [score:1]
Interestingly, there was a significant positive correlation between the preference index of the mice and their levels of hippocampal miR-137 5hmC [Pearson's r [(12)] = 0.6965, p = 0.0119] (Figure 3B). [score:1]
A portion of the 5mC oxidized by TET enzymes is located within the genes of micro RNAs crucial for adult neurogenesis, such as RNA miR-137. [score:1]
While voluntary exercise had no effect on the miR-137 5mC levels of aged mice [t [(10)] = 0.08454 p = 0.9343] (Figure 2E), it resulted in a significant increase in the amount of hippocampal miR-137 5hmC [t [(12)] = 5.289 p = 0.0002] (Figure 2F). [score:1]
The impact of increased 5hmC levels at the miR-137 NRSE/RE1 region is more difficult to interpret due to the complexity of its ligand's actions (RE-1 Silencing Transcription factor, REST/NRSF). [score:1]
Physical exercise significantly increased hippocampal 5hmC content on miR-137 internal promoterIt is known that the impact of aging on 5mC levels differs depending on the gene. [score:1]
The miR-137 region we studied contains the NRSE/RE1 response element (Warburton et al., 2015). [score:1]
Thus, further studies should explore the functional implications of the increase to hydroxymethylation at the NRSE/RE1 in miR-137. [score:1]
Physical exercise significantly increased hippocampal 5hmC content on miR-137 internal promoter. [score:1]
In our study we found that exercise increased 5hmC content at the internal promoter region of miR-137, a neurogenic miRNA, and this increase is correlated with an improvement in memory. [score:1]
Figure 2Impact of exercise and aging on total 5hmC, 5mC(miR-137), and 5hmC (miR-137) levels in the hippocampus. [score:1]
In order to find out whether this applies to 5hmC we studied the effect of exercise on 5mC and 5hmC levels in the internal promoter region of miR-137 in the hippocampus of aged mice (Figure 2B). [score:1]
MiR-137: an important player in neural development and neoplastic transformation. [score:1]
[1 to 20 of 27 sentences]
7
[+] score: 29
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
Twist1 is also a predicted target of mir-137 and mir-363, both of which were repressed in their expression by VPA (cf. [score:5]
The most VPA-sensitive miRNA was mir-137 (3.8-fold downregulated in comparison to control). [score:4]
miRNAs involved in embryonic and adult neurogenesis such as mir-137, mir-128, mir-124a, mir-326, or mir-7 were found significantly downregulated by VPA. [score:4]
Mir-128 and mir-137 were downregulated, while mir-124 was not. [score:4]
Myogenesis regulating mir-206 is highly expressed in skeletal muscles in both species [62], [63] as is mir-124, mir-9, mir-128 and mir-137 in mouse and human brain where they are responsible for fine-tuning of neurogenesis [62] [64]. [score:4]
Most regulated miRNAs shown in our study are highly conserved between mice and humans (e. g. mir-206, mir-214, mir-10a, mir-124, mir-137, mir-128, mir-9) [61], [62]. [score:2]
[1 to 20 of 7 sentences]
8
[+] score: 28
MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1. Stem Cells 28 1060– 1070 10.1002/stem. [score:4]
The miRanda database lists 5,487 genes as targets of miR-137 (John et al., 2004). [score:3]
Analysis of miR-137 expression and rs1625579 in dorsolateral prefrontal cortex. [score:3]
All four genes have recently been validated as miR-137 targets (Kwon et al., 2013). [score:3]
Experimental validation of candidate schizophrenia gene ZNF804A as target for hsa-miR-137. [score:3]
Research in post-mortem brain samples suggests that the functional effect of the miR-137 risk allele may result in a reduced miR-137 expression (Guella et al., 2013). [score:3]
Validation of schizophrenia -associated genes CSMD1, C10orf26, CACNA1C and TCF4 as miR-137 targets. [score:3]
Four other loci with genome-wide significance in this study contained predicted targets of MIR137 (TCF4, CACNA1C, CSMD1, C10orf26). [score:3]
Further down-stream this may be responsible for the reduced white matter integrity, smaller hippocampi, and larger lateral ventricles observed in schizophrenia patients with the miR-137 risk genotype (Lett et al., 2013). [score:1]
The genome-wide supported microRNA-137 variant predicts phenotypic heterogeneity within schizophrenia. [score:1]
A single-nucleotide polymorphism (SNP) in an intron of MIR137 was the second strongest finding (odds ratio = 1.12). [score:1]
[1 to 20 of 11 sentences]
9
[+] score: 25
Using specific antagomiRs we demonstrated that inhibition of miR-124 and let-7 expression decreased some of the inhibitory effect of phenformin on GSC self-renewal, whereas inhibition of miR-137 expression did not have a significant effect (Figure 2B). [score:11]
We found that phenformin induced the upregulation of miR-124, miR-137 and let-7 in the GSCs and that let-7 and miR-124 played a role in the inhibitory effect of phenformin on the self-renewal of these cells. [score:6]
Using qPCR analysis, we found that the expression of miR-124, 137 and let-7 was significantly increased following phenformin treatment (Figure 2A), whereas metformin induced a significant increase only of let-7 and miR-137 expression (Supplementary Figure S2). [score:5]
Figure 2(A) The expression of miR-124, miR-137 and let-7 was analyzed in phenformin -treated GSCs by qPCR following 3 days of phenformin treatment. [score:3]
[1 to 20 of 4 sentences]
10
[+] score: 20
miR-137 which shares the least common downstream target and miR-181a-3p which don’t have interaction site with OIP5-AS1 and nor seed match for stemness TFs was upregulated in undifferentiated oral tumors. [score:6]
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
However, except miR-137 other miRNAs target all the shortlisted genes. [score:3]
Out of the 8 selected miRNAs, miR-137, miR-140–5p, miR-148a-3p, miR-30a-5p and miR-338-3p were significantly downregulated in the tumors compared with normal tissue (P < 0.001, <0.001, 0.001, 0.001 and 0.0003, respectively) (Fig.   3a). [score:3]
Six miRNAs miR-137, miR-148a-3p, miR-338-3p, miR-30a/b-5p and miR-22-3p known to be associated with several cancers were chosen to study the expression levels in oral tumors 20, 25, 26. [score:3]
[1 to 20 of 5 sentences]
11
[+] score: 16
We performed microarray analysis of miRNA expression of glioma cells silenced for TALNEC2 and found that silencing of TALNEC2 increased the expression of several tumor suppressor miRNAs such as miR-137, miR-124, miR-205, miR-7 and miR-492, whereas it decreased the expression of some oncomiRs such as miR-21, miR-155, miR-33b and miR-191. [score:9]
We found that silencing of TALNEC2 in U87 cells resulted in an increased expression of miRNAs associated with tumor suppression [38, 39] (e. g., let-7b, miR-7, miR-124, miR-137, miR-129-3p, miR-142-3p, miR-205, miR-376c, miR-492, miR-562 and miR-3144) and in a decrease in the expression of miRNAs associated with tumor promotion [38– 40] (e. g., miR-9, miR-21 miR-33b, miR-155, miR-191, miR-525-3p, and miR-767-3p). [score:7]
[1 to 20 of 2 sentences]
12
[+] score: 15
Other miRNAs from this paper: hsa-mir-137
Further analysis using STRING identified four main gene networks (IL-6, BCL2, PTGS2 and CXCR4) that were downregulated in glioma cells silenced for RTVP-1. The identification of CXCR4 as a major signaling molecule in these cells further confirmed our recent findings that miR-137 inhibited GSC self-renewal and promoted their differentiation by targeting RTVP-1 which downregulated CXCR4 [29]. [score:11]
Indeed, we recently demonstrated that RTVP-1 regulates the stemness of GSCs as determined by increased self-renewal and expression of the stemness genes Oct4 and Nanog and decreased differentiation ability downstream of miR-137 and upstream of the CXCR4-Shh-Gli pathway [29]. [score:4]
[1 to 20 of 2 sentences]
13
[+] score: 14
We conclude that miR-9, miR-137, miR-200c, miR-381, miR-455, miR-495, and miR-543 represent an FGF2 -dependent system of multiple miRNAs that target specific genes operating in pathways and processes related to the lens differentiation (via c-Maf, Med1/PBP, N-myc, and Nfat5), miRNA-regulated RNA processing (via Cpsf6 and Tnrc6b) and nuclear/chromatin -based processes (via Med1/PBP, As1l, and Kdm5b/Jarid1b/Plu1). [score:4]
The current data suggest that multiple miRNAs, including miR-9, miR-137, miR-155, miR-301a, miR455, and miR-543 (Figure 7A and Figure 8A), regulate c-Maf expression through its 3′-UTR. [score:4]
We found that seven miRNAs, including miR-9, miR-137, miR-200c, miR-381, miR-455, miR-495, and miR-543, target at least two “early” genes examined (i. e., c-Maf, N-Myc, and Nfib). [score:3]
Both c-Maf and Med1/PBP are predicted to be regulated by similar miRNAs, including miR-137, miR-200c, and miR-495 (Figure 7). [score:2]
Seven miRNAs, including miR-9, miR-137, miR-200c, miR-381, miR-455, miR-495, and miR-543, and connections to specific functional groups of genes are shown. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 13
Upon integration of the list of miRNAs predicted to target EZH2 and the differential GBM/NNB miRNA expression ratios, we found that miR-101, miR-98, miR-137, and miR-139 were down-regulated in GBM tissue as compared to NNB and have the potential to regulate EZH2 (Supplemental Table S1B). [score:8]
Besides miR-101, we also found the predicted EZH2 targeting miRNAs miR-98, miR-137, and miR-139 to be down-regulated in GBM cells as compared to NNB tissue. [score:5]
[1 to 20 of 2 sentences]
15
[+] score: 11
Four of the six most highly expressed of these miRNAs were not differentially regulated and were among the top 25 most expressed miRNAs in the neuronal cultures (mmu-miR-137, mmu-miR-9*, mmu-miR-17, mmu-miR-30c). [score:6]
We found that other words among the six most depleted corresponded to the seed regions of 12 more steady-steate highly expressed miRNAs: The mmu-miR-125 family, mmu-miR-137, mmu-miR-128 and the mmu-let-7 family. [score:3]
Many of the miRNAs that were previously linked to neuronal biology (e. g. mmu-miR-124, mmu-miR-125 family, mmu-miR-137, mmu-miR-128, mmu-miR-9 and mmu-let-7) [6, 25- 32, 57, 58] belong to this category. [score:1]
The sixth most depleted word contains a 6-mer complementary to positions 3 - 8 of mmu-miR-137, and the seventh to positions 2 - 8 of miR-128. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 9
miR-137 expression is enriched in the hippocampus [74], especially in the DG [75]. [score:3]
A functional target of miR-137 is mind bomb-1 (MIB1), which facilitates neuron maturation [75]. [score:3]
Strong evidence suggests that individuals with schizophrenia exhibit altered gene expression of MIR137, the gene encoding the miRNA miR-137 [72, 73]. [score:3]
[1 to 20 of 3 sentences]
17
[+] score: 9
HTT gene expression is regulated by miR-137, miR-148a, and miR-214, with HTT mRNA concentrations reduced by 40%–50% in HEK293T cells after transfection with each of these microRNAs [101]. [score:4]
Based on these findings, upregulation of miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214 may have therapeutic potential against mutant HTT, REST, HDAC4, apoptosis, and other pathobiological factors in HD. [score:4]
The effects of psychotropics on the other miRNAs listed in Table 2, particularly miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214, as well as on REST, deserve study in HD mo dels. [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 8
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-124b
RT-QPCR was performed on the same samples to validate expression levels of microRNA of interest (microRNA-124 and microRNA-137), normalized to RNU6B expression levels. [score:5]
As previously described in Schouten et al. [14], we found the RT-QPCR data to support the microRNA profiling data for the expression levels of microRNA-124 and microRNA-137. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 8
Equally, we observe that a potential oncosuppressor gene, such as miR-137, is regulated negatively, whereas another one, such as miR-323, is regulated positively. [score:5]
The results presented in Fig.   1 confirm a drastic overexpression of miR-181, miR-137, miR-199, miR-706 and miR-719 and repression of miR-155 in Cbx7 KO MEFs in comparison with the WT ones. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 8
Other miRNAs from this paper: hsa-mir-137
A further study showed that overexpression of miR-137 in transgenic mice results in altered coat color, thereby validating the functional role of miR-137 on MITF gene expression and indicating the complexity of the regulation mechanisms for melanogenesis and coat color gene expression post-transcriptionally [24]. [score:8]
[1 to 20 of 1 sentences]
21
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MiR-137 functions as a tumor suppressor in neuroblastoma by downregulating KDM1A. [score:5]
miR-137. [score:1]
Epigenetics, microRNAs, and carcinogenesis: functional role of microRNA-137 in uveal melanoma. [score:1]
When an anti-miR-137 is used, Jarid1b is not post-transcriptionally silenced and the differentiation of ESCs is blocked (Tarantino et al., 2010). [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 6
MiR-137 inhibited mitophagy by regulating the mitophagy receptors FUNDC1 and NIX (Li W. et al., 2014). [score:3]
MicroRNA-137 is a novel Hypoxia-responsive MicroRNA that inhibits mitophagy via regulation of two mitophagy receptors FUNDC1 and NIX. [score:3]
[1 to 20 of 2 sentences]
23
[+] score: 6
Among which we found that three miRNAs (miR-363, miR-367, miR-25) were commonly upregulated while six (miR-33a, miR-33b, miR-92a, miR-92b, miR-137, miR-32) were downregulated in IL-6 -treated GBC-SD cell line samples compared to the representative controls (Figure 4A and Figure 4B). [score:6]
[1 to 20 of 1 sentences]
24
[+] score: 6
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-124b
Previous studies have shown that certain miRNAs that target the 3′ untranslated region (UTR) of the Gria1 and Gria2 mRNAs, which encode the GluA1 and GluA2 subunits of AMPARs, respectively, are potent epigenetic regulators of LTP (miR-137: Olde Loohuis et al., 2015; miR-124: Gascon et al., 2014; Hou et al., 2015). [score:6]
[1 to 20 of 1 sentences]
25
[+] score: 6
In addition, miR-137 has been found to suppress uveal melanoma cell growth by targeting MITF and CDK6 [21]. [score:5]
For example, miR-34a and miR-137 have been demonstrated to be involved in the tumorigenesis of uveal melanoma [20, 21]. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 6
Eight high priority miRNAs were identified: miR-215, miR-137, miR-708, miR-31, and miR-135b were differentially expressed in APC tumors and miR-215, miR-133a, miR-467d, miR-218, miR-708, miR-31, and miR-135b in colitis -associated tumors. [score:3]
This curation step reduced the number of high probability differentially expressed miRNAs in APC tumors to 5 and the number of such miRNAs in CAC tumors to 7. As shown in Table 1, two miRNAs were repressed in APC tumors (miR-215 and miR-137), compared to adjacent control epithelium, whereas 3 miRNAs were induced (miR-708, miR-31, miR-135b). [score:2]
In addition, 1 miRNA was uniquely repressed in APC tumors (miR-137), and 3 miRNAs were uniquely induced in CAC tumors (miR-133a, miR-467d, and miR-218). [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 5
It has been shown that microRNA-137 suppresses tumor growth and metastasis in human hepatocellular carcinoma by targeting AKT2 [39]. [score:5]
[1 to 20 of 1 sentences]
28
[+] score: 5
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
[1 to 20 of 1 sentences]
29
[+] score: 5
However, simultaneous transfection of anti-miR-137 and with the Mitf-3′UTR luciferase in MeWo cells blocked the effect of (data not shown). [score:1]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
Transfection with anti-miR-137 similarly blocked the effects of on the endogenous MITF mRNA (Fig. 5B). [score:1]
anti-microRNA where purchased from Ambion and are the following: anti-miR-137 (Product ID: AM10513) and anti-miR-148 (Product ID: AM10263). [score:1]
miR-137. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 5
Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D). [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
Finally, miR-184 and miR-137 trigger NSC proliferation and inhibit differentiation by repressing the NSC fate-regulator Numblike [35] and the polycomb methyltransferase Ezh2 [36], respectively. [score:4]
Thus, miR-124, miR-9, and let-7b elicit NSC differentiation, while miR-184 and miR-137 increase proliferation at the expense of differentiation potential. [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 5
MicroRNA-137/181c regulates serine palmitoyltransferase and in turn amyloid beta, novel targets in sporadic Alzheimer's disease. [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
Restoration of miR-137 expression inhibited proliferation and promoted senescence of pancreatic cancer cells [31]. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
A total of 11 miRNAs, let-7, miR-9, miR-206, miR-138, miR-133, miR-152, miR-137, miR-128, miR-143, miR-27b and miR-218 were co-expressed by 18 synaptic transmission target genes (Table S6). [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
For example, miR-625, miR-103/miR-107, miR-21 and miR-301 have been found to promote CRC to invade and metastasize by stimulating multiple metastasis-promoting genes [27– 30], whereas miR-99, miR-137, miR-132 and miR-128 function as tumor suppressors to inhibit the metastasis of CRC [31– 34]. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 4
Other miRNAs from this paper: mmu-mir-93
We also found that hypoxia-responsive miR-137 regulates mitophagy by targeting two mitophagy receptors FUNDC1 and NIX. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
While our present study only focused downstream of DNMTs, we propose to further study in the future how DNMTs are regulated by IGF-1. In addition, other microRNAs (miR-137, miR-218) may bind to the 3’-UTR of c-kit mRNA and modify the c-kit expression level. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
Coat color determination by miR-137 mediated down-regulation of microphthalmia -associated transcription factor in a mouse mo del. [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1. Stem Cells 28, 1060– 1070. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
J Natl Cancer Inst in press 18 Silber J Lim DA Petritsch C Persson AI Maunakea AK 2008 miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. [score:3]
Silber et al, reported that mir-124 and mir-137 induced differentiation of neural and glioblastoma stem cells, a state associated with cell cycle arrest [18]. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 4
In another study, a set of brain miRNAs (miR-137, -181c, -9, -29a/b) was reported to circulate at decreased levels in the serum of Alzheimer's Disease (AD) patients and AD animal mo dels, and these miRNAs are potentially involved in AD through the regulation of ceramides [49]. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 4
CDK6 is targeted by miR-137 and miR-124a. [score:3]
Transfection of miR-137 or miR-124a causes G [1] arrest in glioblastoma multiforme cells [31]. [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 4
Among the validated direct targets of Foxp2 identified in our study there were a number of microRNA (miRNA) molecules, including mir-124a and mir-137. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 3
Other miRNAs from this paper: mmu-let-7a-1, mmu-let-7a-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-222
MiR-222 is expressed at significantly higher levels in cell lines of microglial origin over those of neuroblastoma origin, and vice versa for miR-137. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
Moreover, MREs of miR-34a, miR-137 and miR-182, whose expression levels are reduced in uveal melanoma cells, render specific introduction of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL) by adenovirus into tumor cells [20]. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, miR-133b, miR-137, miR-155, and miR499 were exclusively expressed in the caudal region of the mouse epididymis but were wi dely distributed throughout the rat and/or human epididymis (S4 Table). [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Second, the balance between NSC proliferation and differentiation has been demonstrated to be under the control of regulatory loops involving both Nr2e1, and microRNA encoding genes such as mir-9, miR-137, and let-7d [22– 24]. [score:2]
A second loop has been reported that includes the repression of the co-interactor Lsd1 by miR-137 that can be relieved by the repression of miR-137 by Nr2e1 [23]. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 3
The expression trend of 12 of them (i. e. miR-21, miR-10b and miR-124) was in line with previously published results, whereas 2 miRNAs (miR-137 and miR-218) showed an opposite trend [24]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Interestingly, recent findings suggest that chronic pain is regulated directly by spinal glial miRNA-124 [43], miRNA-29, and miRNA-137 [44], through a combined operation of spinal neuron miRNA-186-5p and glial pain-related gene [36], or extracellularly released miRNA [39]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
As an example, the mouse skin color changes from black to brown when overexpression of miR-137 in mouse [19]. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Over -expression of miR-137 in C57 mouse resulted in the production of mice with brown and gray skin colors [12]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
As the miR-137 target RTVP-1 (a SCP/TAPS protein related to SmVAL9) has recently been found to influence the self-renewal and differentiation of glioblastoma stem cells (Bier et al., 2013), SmVAL9 localisation to this parasite cell population is intriguing. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
It is also possible that the action of other miRNAs, such as miR-9, miR-124, miR-137, miR-338 or let-7, could compensate for miR-219 inhibition in NSCs. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
Moreover, PXN promotes tumor progression and poor outcome in colorectal cancer patients via decreased miR-137 expression [12]. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
Such seed shift, as previously reported (50), was also identified in miR-133-3p and miR-137-3p across fruitfly and human/mouse (Table 3), and found in miR-79-3p between fruitfly and worm. [score:1]
Similar observations were made for miR-124, miR-137, miR-193, miR-210, miR-2, miR-79 and miR87 across species, with miRNAs following the loop-counting rule having lower arm abundances of 5′-isomiRs. [score:1]
We observed that miRNA orthologues (miR-10, miR-133, miR-137 and miR-79 in Table 3) swapped major miRNAs and 5′-isomiRs and had largely different 5′-isomiR arm abundances across human, mouse, fruitfly and worm. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 2
MiR-124 may act together with miR-137 and miR-128 synergistically to regulate neural cells 25. [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 1
Other miRNAs from this paper: mmu-mir-193a, hsa-mir-137, hsa-mir-193a
The impact of non-coding RNA, especially miRNA, should not be ignored; e. g., miR-137 or miR-193a, as predicted by miRWalk (http://www. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Indeed, it has been reported that multiple miRNAs participate in synaptic and cognitive impairment and AD-like neuropathology, including miR-9, miR-34, miR-132, miR-137, miR-188, miR-204, miR-211, and miR-212 [71– 77]. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
In particular, some of the miRNAs modulated by aspirin in mice protected against the formation of microadenomas (miR-16, miR-133, miR-137, and miR-191) were the same that had been found to be modulated by the same NSAID in A/J mice aged 10 weeks. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
The miRNAs binding to these sites, i. e., miR-137-3p, miR-155a-5p, miR-190b-5p, miR-204-5p, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-384-3p, were selected for the correlation analysis with impulsivity. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
41 mmu-miR-33 −59.71 mmu-miR-222 1.23 mmu-miR-93 −1.52 mmu-miR-124 −97.01 mmu-miR-429 1.07 mmu-miR-192 −1.52 mmu-miR-129-5p −111.43 mmu-miR-100 −1.74 mmu-miR-210 −157.59 mmu-miR-20a −2 mmu-miR-134 −194.01 mmu-miR-137 −2 mmu-miR-215 −222.86 mmu-miR-194 −2.14 mmu-miR-452 −675.59 mmu-miR-196a −2.64 mmu-miR-223 −955.43 Differentiated sample versus control sample [DIF EBs d8/CONTROL EBs d8]. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Shown are the Conserved TFBS and sno/miRNA tracks from the UCSC Genome Browser in the region corresponding to the small hairpin microRNA precursor encoding hsa-mir-137. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
The schizophrenia risk gene product miR-137 alters presynaptic plasticity. [score:1]
[1 to 20 of 1 sentences]