sort by

47 publications mentioning mmu-mir-184

Open access articles that are associated with the species Mus musculus and mention the gene name mir-184. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 532
We observed 1,263 mRNAs and 592 mRNAs that were significantly upregulated and downregulated respectively in cells overexpressing miR-184 compared with the negative control, suggesting dramatic remo delling of gene expression by miR-184 expression. [score:12]
Despite the overexpression of these direct target genes individually (Additional file 5: Figure S4A, B, C) or in combination (Fig.   5d, e), protein synthesis was nonetheless suppressed by miR-184 expression in these cell lines. [score:10]
a Analysis of miR-184 seed matches in the promoter, 5′ UTR, open reading frame (ORF) and 3′ UTR of miR-184 downregulated and upregulated transcript reveals strong enrichment for miR-184 seed matches in the 5′ and 3′ UTRs of downregulated genes. [score:10]
To identify direct targets of miR-184 from the profiling data, we adopted a comprehensive seed match analysis method previously described by Melton et al. [30], which interrogates the promoter, 5′ UTR, CDS and 3′ UTRs of transcripts downregulated following microRNA overexpression for the presence of miR-184 seed matches. [score:9]
Overexpression of miR-184 direct targets does not rescue the suppression of protein synthesis. [score:8]
Fig. 6miR-184 is downregulated in triple negative breast cancer, methylated in metastatic lesions and reduced expression of stringent miR-184 targets correlates with poor overall survival in breast cancer patients. [score:8]
The analysis revealed highly significant enrichment of miR-184 seed matches within the 5′ UTR and 3′ UTR regions of the downregulated transcripts, suggesting that miR-184 modulates its targets by targeting the UTRs (Fig.   4a). [score:8]
Despite the overexpression of AKT2, PRAS40 and GSK3A in combination, we were unable to rescue the miR-184 mediated suppression of protein synthesis and hence more work needs to be conducted to define the rate limiting targets in protein synthesis and proliferation downstream of miR-184. [score:7]
We did not observe any significant enrichment of miR-184 seed regions within the upregulated genes, suggesting that this method identifies bone fide direct targets. [score:7]
As expected, there was a marked decrease in total AKT2 and PRAS40 expression in cells overexpressing miR-184 and no change in the total protein expression of AKT1 and AKT3. [score:7]
By performing microarray studies and informatic analysis, we discovered that miR-184 regulates the AKT/mTORC1 pathway by targeting AKT2, TSC2 and PRAS40 in suppressing activity of S6K1 and protein synthesis. [score:6]
Given the increase in expression of miR-184 as mammary epithelia differentiated in vivo, we asked whether ectopic miR-184 expression regulates the self-renewal capacity of breast cancer cells. [score:6]
Therefore we tested if direct targets AKT2, PRAS40 or GSK3A were responsible for the effect of miR-184 on MDA-MB-231 cell protein synthesis by stably overexpressing AKT2, PRAS40 and GSK3A individually or in combination, together with transfection of miR-184 or negative control mimics. [score:6]
However, elevated expression of a signature composed of high-confidence direct targets of miR-184 predicted poor overall survival (Fig.   6c). [score:6]
MicroRNA-184 (miR-184) was exclusively expressed in epithelial cells and markedly upregulated during differentiation of the proliferative, invasive cells of the pubertal terminal end bud (TEB) into ductal epithelial cells in vivo. [score:6]
Within the cohort of mice bearing miR-184 -overexpressing tumour cells, the expressions of a number of miR-184 targets (e. g., AKT2, GSK3A and S6K2) were reduced in three out of four mice when compared to the control tumours. [score:6]
From the GSEA, there was enrichment for targets genes such as TSC2, RPS6KB2, implicated in mTORC1 mediated protein synthesis in cells overexpressing miR-184, and hence, we asked if miR-184 could be an important regulator of AKT/mTORC1 protein synthesis pathway. [score:6]
Reduced expression of stringent miR-184 targets correlates with poor overall survival in two independent cohorts of breast cancer patients. [score:5]
There was a marked reduction in the total protein expression of AKT2, PRAS40 and GSK3A when miR-184 was overexpressed (Fig.   4d). [score:5]
Interestingly, we also observed a loss of TSC2 expression and an increase in PRAS40 expression in the miR-184 cohort. [score:5]
To verify this result in a bigger patient cohort, we analysed miR-184 expression in the METABRIC cohort of 980 breast cancers [31] and also observed that miR-184 mean expression was highest in HER2 -positive breast cancers and significantly lower in basal breast cancers, a subset of TNBC (Fig.   6b). [score:5]
We observed robust repression (>50 %) in the luciferase activity of reporters carrying the 3′ UTR from CSF1, GSK3A, AKT2 and PRAS40 signifying that miR-184 expression can act via the 3′ UTR to destabilise the mRNA of these targets (Fig.   4e). [score:5]
The total expression of mTOR was reduced in the miR-184 cohort, potentially inhibited the formation of the mTORC1 and therefore reducing the activity of S6K1. [score:5]
microRNA expression was normalised to SnoRNA202 (G0 miR-184 suppresses proliferation in MDA-MB-436 and HS578T cells in vitro. [score:5]
Despite the increased AKT activity, the inhibition on TSC2 was completely abrogated, as observed from the dephosphorylation of Thr1462, possibly by miR-184 targeting AKT2. [score:5]
To elucidate its function in cancer, miR-184 was acutely overexpressed in highly proliferative human breast cancer cell lines: MDA-MB-231, BT-549, MDA-MB-436 and HS578T, which express undetectable levels of endogenous levels of miR-184. [score:5]
Integration of miR-184 expression and activity in PI3K-AKT-mTOR pathway analysis may help better predict pathway dynamics and response to therapeutics targeting this pathway. [score:5]
In contrast, the expression of miR-184 was almost abrogated in the Tp53 [−/−] tumours and the MMTV-Neu tumours, however, miR-184 expression in the C3 SV40 Tag and MMTV-PyMT tumours was comparable to normal mammary epithelial cells suggesting that miR-184 might be specifically silenced in certain breast cancers or that they derive from different cells of origin (Fig.   2a). [score:5]
These studies elucidate a new layer of regulation in the PI3K/AKT/mTOR pathway with relevance to mammary development and tumour progression and identify miR-184 as a putative breast tumour suppressor. [score:5]
However, elevated expression of high-confidence targets repressed by miR-184 predicted poor prognosis, consistent with our evidence from animal mo dels that elevated miR-184 activity improves outcome. [score:5]
This study suggests that miR-184 suppresses the protein synthesis pathway by targeting several important members of the AKT/mTOR pathway. [score:5]
These data indicate that miR-184 represses many of its mRNA targets by targeting the 3′ UTR and that the number of miR-184 binding sites within the 3′ UTR does not correlate with degree of mRNA destabilisation. [score:5]
Regulatory targets of miR-184. [score:4]
miR-184 represses the total levels of AKT2, which relieves the inhibitory function on TSC2, the crucial negative regulator of the mTORC1 pathway. [score:4]
miR-184 suppresses protein synthesis by negatively regulating certain substrates in AKT/mTORC1 pathway. [score:4]
C Total number of miR-184 seed matches present only in the 5′UTR of downregulated transcripts. [score:4]
The t test was performed: * p <0.05 indicates significant difference in proliferation in cells overexpressing miR-184 compared with non -targeting miRNA control. [score:4]
First, AKT2 has been shown to be an miR-184 direct target in neuroblastoma [44]. [score:4]
e Protein synthesis in cells overexpressing AKT2 (a), PRAS40 (P) and GSK3A or control (empty vector, EV), transfected with miR-184 mimics (184) or controls (Neg) We also further examined if this miR-184-regulated signalling cascade was recapitulated in vivo. [score:4]
ITGB1 is a negative control and a reporter containing 3′ UTR sequences perfectly complementary to mIR-184 (PMR) serves as a positive control Of the 557 downregulated genes, 193 of the genes possessed a miR-184 seed match in the UTR; of these 193 genes, 135 of them had a miR-184 seed match only in the 3′ UTR, 30 genes contained a miR-184 seed match only in the 5′ UTR and 23 genes possessed a miR-184 seed region in both the 3′ and 5′ UTR. [score:4]
Core enrichment of gene targets potentially regulated by miR-184 is represented by Yes under the core enrichment column. [score:4]
These results suggest that miR-184 regulates the protein synthesis process by modulating expression of genes in addition to AKT2, PRAS40 and GSK3A. [score:4]
ITGB1 is a negative control and a reporter containing 3′ UTR sequences perfectly complementary to mIR-184 (PMR) serves as a positive controlOf the 557 downregulated genes, 193 of the genes possessed a miR-184 seed match in the UTR; of these 193 genes, 135 of them had a miR-184 seed match only in the 3′ UTR, 30 genes contained a miR-184 seed match only in the 5′ UTR and 23 genes possessed a miR-184 seed region in both the 3′ and 5′ UTR. [score:4]
Interactions between miR-184 and its putative targets were assessed by quantitative PCR, microarray, bioinformatics and 3′ untranslated region Luciferase reporter assay. [score:4]
e Protein synthesis in cells overexpressing AKT2 (a), PRAS40 (P) and GSK3A or control (empty vector, EV), transfected with miR-184 mimics (184) or controls (Neg)We also further examined if this miR-184-regulated signalling cascade was recapitulated in vivo. [score:4]
Gene expression studies uncovered multi-factorial regulation of genes in the AKT/mTORC1 pathway by miR-184. [score:4]
We asked whether the number of miR-184 seed matches within the downregulated genes correlated with a greater degree of repression. [score:4]
B Total number of miR-184 seed matches present only in the 3′ UTR of downregulated transcripts. [score:4]
A Total number of miR-184 seed matches in the promoter, 5′ UTR, open reading frame (ORF) and 3′ UTR of downregulated transcripts. [score:4]
D Total number of miR-184 seed matches present only in both 3′ and 5′ UTR of downregulated transcripts. [score:4]
A significantly lower proportion of cells overexpressing miR-184 were positive for phospho-histone H3 positive cells and mitotic figures compared to the control group (Fig.   2h), confirming the suppression of proliferation by miR-184. [score:4]
In clinical breast cancer tissues, expression of miR-184 is lost in primary TNBCs while the miR-184 promoter is methylated in a subset of lymph node metastases from TNBC patients. [score:3]
From the profiling data, we filtered and identified the top miR-184 repressed mRNA targets based on their fold change (Table  2). [score:3]
In order to ascertain whether these genes were targets of miR-184, HEK293T cells were transfected with miR-184 or negative control in combination with 3′ UTR luciferase reporters for CSF1, GSK3A, AKT2 or PRAS40 in addition to ITGB1 (used as a negative control) and a construct containing perfect matches to the miR-184 sequence as a positive control (PMR). [score:3]
Genes with miR-184 seed match in their 3′ UTR were also significantly more downregulated compared to those with a miR-184 seed match in the 5′ UTR (Fig.   4c). [score:3]
Overexpression of AKT2, PRAS40 or GSK3A does not rescue miR-184 repression of protein synthesis. [score:3]
a miR-184 expression in luminal A, human epidermal growth factor (HER2), triple negative and matched normal tissue. [score:3]
miR-184 suppresses tumour initiation and proliferation in vivo. [score:3]
Though several downstream targets of miR-184 such as AKT2, NUMBL, SHIP2, NFAT1 have been identified in different cell types, nevertheless there have been no definite reports on the functional role of miR-184 in breast cancer nor detailed analysis of signalling pathways that are potentially modulated by miR-184 [44, 54, 62, 63]. [score:3]
Mice were transplanted with MDA-MB-231 cells expressing miR-184, Let-7a or negative control and aged to ethical endpoint. [score:3]
miR-184 expression and prognostic significance in breast cancer. [score:3]
HER2 human epithelial growth factor receptor 2, neg negativeWe interrogated the relative expression of miR-31, miR-184, miR-17 and miR-19a in a panel of human breast cancer cell lines. [score:3]
One of the miRNAs that followed this expression pattern was miR-184. [score:3]
miR-184 inhibited cell proliferation significantly in all four mo dels (Fig.   2c, d, Additional file 1: Figure S1G). [score:3]
Kaplan-Meier survival analysis comparing outcome of patients stratified by signature score of miR-184 repressed targets. [score:3]
The exogenous overexpression of miR-184 resulted in levels comparable to the endogenous levels of miR-184 detected in the MDA-MB-175 (not shown). [score:3]
We observed unique expression patterns for miR-184 across these subtypes. [score:3]
Control and miR-184 overexpressing MDA-MB-231 cells were separately injected into the mammary fat pad of cohorts of immunocompromised NOD/SCID mice (n = 5). [score:3]
CSF1 and LAT1 were also significantly repressed when miR-184 was overexpressed. [score:3]
miR-184 suppresses proliferation of human breast cancer cell lines in two-dimensional and suspension culture. [score:3]
In contrast, there was a pronounced increase in methylation in metastatic tumours in the lymph nodes of three of eight patients (Fig.   6d), suggesting a selective pressure to silence miR-184 during metastatic dissemination, consistent with the capacity of miR-184 to suppress metastasis in animal mo dels (Fig.   3). [score:3]
HER2 human epithelial growth factor receptor 2, neg negative We interrogated the relative expression of miR-31, miR-184, miR-17 and miR-19a in a panel of human breast cancer cell lines. [score:3]
miR-184 targets AKT/mTOR protein synthesis pathway. [score:3]
Further functional characterisation of miR-184 revealed that it is a potential tumour suppressor miRNA in breast cancer; in suppressing cell proliferation, self-renewal in vitro and delaying the formation of metastatic lesions in distant sites in vivo. [score:3]
Lastly, the clinical prognostic significance of miR-184 putative targets was assessed using publicly available datasets. [score:3]
After ascertaining the inhibitory effect of miR-184 on proliferation and self-renewal in vitro, we wanted to examine the role of miR-184 in vivo. [score:3]
However, we do not fully comprehend how miR-184 suppresses protein synthesis. [score:3]
miR-184 expression prolongs survival and reduces metastatic burden. [score:3]
Our experimental evidence suggests that the anti-tumourigenic properties displayed by miR-184 are a consequence of miR-184 inhibiting the activity of the PI3K/AKT/mTORC1 pathway, therefore limiting protein synthesis. [score:3]
We validated the expression of miR-31, miR-184, miR-17 and miR-19a in TEBs and ducts by quantitative RT-PCR (Fig.   1c). [score:3]
In a separate study, researchers performed bisulphite sequencing on umbilical cord blood graft CD4+ T cells and discovered a small putative CpG island just upstream of the miR-184 locus, and an additional 32 CpG sites present within the adjacent regions of the miR-184 locus making it an ideal target for epigenetic silencing [63]. [score:3]
e MDA-MB-231 stably overexpressing miR-184 and control were cultured in low adherent plates and enumerated for primary and secondary tumourspheres. [score:3]
f Tumour mass in NOD/SCID mice (n = 5) after injection of MDA-MB-231 constitutively overexpressing miR-184, let-7a or negative control into the mammary fat pad. [score:3]
Fig. 2Expression of miR-184 is lost in cancer mo dels. [score:3]
There were no significant differences in the expression of miR-184 between luminal cancers and matched normal. [score:3]
Several studies have established that miR-184 is lowly expressed in different malignancies such as childhood neuroblastoma, brain cancers, clear cell renal cell carcinoma and prostate cancer [44, 57– 60]. [score:3]
Ectopic reactivation of miR-184 inhibited the proliferation and self-renewal of triple negative breast cancer (TNBC) cell lines in vitro and delayed primary tumour formation and reduced metastatic burden in vivo. [score:3]
c Kaplan-Meier survival analysis comparing the outcome of METABRIC patients stratified by signature score of miR-184 repressed targets (red, samples with top 25 % signature score (n = 246); blue, samples with bottom 75 % signature score (n = 734)). [score:3]
d Immunoblot of total AKT2, PRAS40, GSK3A and Actin in MDA-MB-231 transfected with negative (neg) control or miR-184 mimics for 48 h. e Luciferase 3′ UTR reporter assay performed in HEK293T confirmed that CSF1, GSK3A, AKT2 and PRAS40 are direct targets of miR-184. [score:3]
Conversely when cells overexpressing miR-184 were treated with EGF, we observed a modest increase in p-AKT Thr308, indicating that there was increased AKT activity. [score:3]
c Distribution of gene expression changes in genes with miR-184 seed regions in either 5′ UTR or 3′ and 5′ UTR only. [score:3]
b Distribution of gene expression changes in genes with miR-184 seed regions in either 3′ UTR or 5′ UTR only. [score:3]
a Growth rate of tumours after injection of MDA-MB-231 into the mammary fat pad in NOD/SCID mice (n = 10 per group) constitutively overexpressing miR-184, let-7a or negative control. [score:3]
Upon functional characterisation, there was compelling evidence to suggest that miR-184 is a tumour suppressor in certain cancer subtypes, as it suppressed cell proliferation and self-renewal in vitro and tumour growth in the primary and distant sites. [score:3]
We propose that miR-184 mimics the role of a capacitor to control signalling current through the PI3K-mTOR pathway in the presence of a stimulus by targeting intermediates of the AKT/mTOR cascade and in turn tuning the signalling output. [score:3]
These results suggested that cells overexpressing miR-184 have impaired proliferation in vivo. [score:3]
b Analysis of miR-184 expression in the Molecular Taxonomy of Breast Cancer International Consortium (METABRIC) patient cohort stratified by intrinsic subtype: p <1 × 10 [−18]. [score:3]
In this cohort, miR-184 expression did not correlate with prognosis (data not shown). [score:3]
Conversely, the expression of miR-184 was undetectable in a majority of cell lines with the exception of MDA-MB-175 (Fig.   2b). [score:3]
miR-184 expression is attenuated in mouse mo dels of breast cancer and human breast cancer cell lines. [score:3]
Interestingly, miR-184 also decreased the total protein expression of mTOR (Additional file 4: Figure S3A). [score:3]
H&E staining identified a bolus of miR-184 overexpressing cells localised to the injection site (Fig.   2g). [score:3]
These data are consistent with a role for miR-184 in suppressing proliferation or metastatic dissemination. [score:3]
We are the first to provide evidence to suggest that the attenuated expression of miR-184 in cancer is potentially a result of epigenetic mechanisms. [score:3]
However within the HER2 subtype, the patients fell into two groups: normal-like and high miR-184 expression. [score:3]
miR-184 was methylated in a subset of lymph node metastases in TNBC, providing supportive evidence that miR-184 may play a role as a novel mammary tumour suppressor. [score:3]
B Immunoblots of members of AKT/mTOR pathway in primary tumour lysates derived from xenografts of mDA-MB-231 cells overexpressing miR-184 or control, harvested at ethical end point. [score:3]
miR-184 modulates the activity of a number of gene targets within the PI3K/AKT pathway. [score:3]
[39] were performed in MDA-MB-231 cells constitutively overexpressing miR-184. [score:3]
We conducted a survival experiment to ascertain if miR-184 expression extended survival. [score:3]
When miR-184 was ectopically overexpressed in vitro, it resulted in cell cycle arrest and apoptosis [44, 57, 58], as well as impeding neuroblastoma xenograft formation resulting in longer survival in vivo [61]. [score:3]
Next, we aimed to identify the repertoire of miR-184 targets to explain the impact of miR-184 on proliferation. [score:3]
miR-184 is crucial in regulating certain developmental processes such as the differentiation of neural stem cells, germ line cells and corneal epithelial cells [54– 56]. [score:3]
Conversely, miR-184 expression was significantly enriched approximately 4.2-fold in the mature ducts compared to the TEBs. [score:2]
These changes in the signalling pathway correlate with our protein synthesis assay, where we observe less synthesised proteins in cells overexpressing miR-184. [score:2]
miR-184 expression was silenced in mouse tumour mo dels compared to non-transformed epithelium and in a majority of breast cancer cell line mo dels. [score:2]
a miR-184 expression is lost in several mouse mo dels of breast cancer, compared to total mouse mammary epithelium. [score:2]
Last, miR-184 expression was significantly lower in the triple negative subtype compared to the matched normal (Fig.   6a). [score:2]
The t test was performed: * p <0.05 indicates significant difference in positive phospho-histone H3 expression and mitotic figures in miR-184 cohort compared to control cohort. [score:2]
miR-184 was reactivated by transient or stable overexpression in breast cancer cell lines and examined using a series of in vitro (proliferation, tumour-sphere and protein synthesis) assays. [score:2]
MDA-MB-231 cells overexpressing miR-184 had a 50 % reduction in tumoursphere-forming potential in primary tumourspheres as well as in secondary tumourspheres when compared to the negative control (Fig.   2e). [score:2]
The t test was performed: * p <0.05 indicates significant difference in tumoursphere-forming potential in cells overexpressing miR-184 compared to control. [score:2]
This assay requires cells to be in cultured in suspension for an extended period, therefore, miR-184 was overexpressed via retroviral transduction. [score:2]
miR-184 has been previously shown to be controlled by epigenetic mechanisms in development. [score:2]
We transfected miR-184 or control microRNA mimics into MDA-MB-231 breast cancer cells and analysed global gene expression changes compared to controls by affymetrix gene arrays. [score:2]
Upon interrogating a large breast cancer cohort (METABRIC) dataset, we also observed a significant decrease in miR-184 expression in the ER -negative tumours compared to the ER -positive tumours. [score:2]
Measurement of protein synthesis by using B-scintillation in MDA-MB-231 cells overexpressing AKT2 (A), PRAS40 (B), GSK3A (C) or in combination transfected with negative control or miR-184 mimics for 24 h, serum starved and treated with labelled H3 leucine in the absence and presence of epidermal growth factor (EGF). [score:1]
To directly assay the impact of EGF stimulation and miR-184 expression on protein synthesis, we transfected MDA-MB-231 cells with the miR-184 mimics, and measured the amount of protein synthesised in the cell by incorporating radiolabelled tritiated (H [3]) leucine into cells in the presence of EGF. [score:1]
In this cohort, very few microRNAs associate with prognosis [53], as we found for miR-184. [score:1]
Interestingly, miR-184, being the most highly enriched miRNA in the mature ducts was clustered tightly to a subset of epithelial specific miRNAs, which included members of the miR-183 family (miR-183, miR-96) and all members of the miR-200 family (miR-141, miR-200a, miR-200b, miR-200c and miR-429). [score:1]
In contrast, only approximately 20 % of mice within the miR-184 cohort developed any metastatic lesions in the lung (p = 0.06) (Fig.   3b). [score:1]
This was identified in the mouse brain, where the genomic region proximal to the miR-184 locus in adult neural stem cells contains CpG rich sequences instead of canonical CpG islands. [score:1]
miR-184 is epigentically silenced in human cancers. [score:1]
It is possible that these changes are compensation to circumvent the anti-proliferative effects of miR-184 during tumour progression. [score:1]
All the mice in the control group developed solid tumours, however, in stark contrast, none of the mice within the miR-184 cohort had developed any palpable tumours at this time point (Fig.   2f). [score:1]
We identify miR-184 as a microRNA associated with epithelial differentiation and demonstrated that miR-184 is silenced and methylated in a subset of TBNC. [score:1]
We hypothesised that the methylation of miR184 in metastatic tissue suggests a selective pressure against maintenance of miR-184 particularly during metastatic dissemination. [score:1]
In order to demonstrate that this regulatory phenomenon exhibited by miR-184 was not restricted to the MDA-MB-231 mo del, we performed the same assay with the HEK293E cells using another growth factor, insulin. [score:1]
Furthermore, this signalling event was partially recapitulated in vivo, where miR-184 repressed several substrates within the AKT/mTORC1 pathway in a majority of tumours. [score:1]
MDA-MB-231 cells were transfected with miR-184 or control mimics for 48 h before total RNA was extracted using the modified Trizol reagent protocol with an additional ethanol precipitation step. [score:1]
The positive control let-7a also exhibited an anti-proliferative effect, which was of a similar magnitude to the result obtained with miR-184 (Fig.   2c, d). [score:1]
Methyl-CpG binding protein 1 (Mbd1) binds to these CpG-rich sequences in the genomic regions surrounding miR-184, and represses the transcriptional activity of miR-184 [54]. [score:1]
In contrast, there was delayed latency in tumour growth in the miR-184 group where mean time to tumour palpation was by day 38. [score:1]
This result suggests that miR-184 impedes tumour initiation and growth. [score:1]
A stringent 18-gene signature repressed by miR-184 (fold-change >2, Table  2) was assessed for survival analysis using two independent cohorts from METABRIC [31] and a cohort of women receiving neo-adjuvant chemotherapy [32]. [score:1]
MDA-MB-231 cells were first transduced with the retroviral vector pRQ-rtTA-GFP followed by pRQ-miR184. [score:1]
Under detailed visual examination of the miR-184 cohort by fluorescent microscopy, a small population of GFP+ cells could be detected in the mammary gland. [score:1]
A role in modulating metastasis is supported by analysis of a subset of TNBC patient samples, where miR-184 was epigenetically silenced in lymph node metastases, suggesting silencing of miR-184 can promote metastatic dissemination. [score:1]
The remaining genes contained miR-184 binding sites in either the CDS and/or UTRs. [score:1]
We measured miR-184 expression in snap-frozen primary tumour specimens comprising patient samples diagnosed with luminal, HER2-amplified and triple negative cancers and matched normal tissue. [score:1]
NS not significant Lastly, we also examined if miR-184 could reduce metastatic burden in vivo. [score:1]
We observed that there was minimal methylation detected at the miR-184 locus in normal breast tissue. [score:1]
We transfected MDA-MB-231 cells with miR-184 mimics, serum starved them and stimulated the cells with EGF, which is known to initiate a cascade of signalling events to promote cell proliferation, growth and survival. [score:1]
In addition, we also observed a similar reduction in metastatic burden in the pancreas, where only 10 % of mice from the miR-184 cohort developed any pancreatic metastases (Fig.   3c). [score:1]
c Pancreas of control and miR-184 cohorts and percentage of NOD/SCID mice (n = 10) with 0, 1–20 or 21–30 metastatic lesions in the pancreas. [score:1]
We also saw no added enrichment in repression when there was multiple miR-184 seed match regions located only in the 3′ UTR (Additional file 2: Figure S2B) or the 5′ UTR (Additional file 2: Figure S2C) or in both the 3′ and 5′ UTR (Additional file 2: Figure S2D). [score:1]
NS not significantLastly, we also examined if miR-184 could reduce metastatic burden in vivo. [score:1]
a Immunoblots of members of the AKT/mTOR pathway in MDA-MB-231 transfected with miR-184 mimics and treated with and without epidermal growth factor (EGF). [score:1]
MDA-MB-436 and HS578T breast cancer cells were reverse transfected with 40 nM of either miR-184 mimic or scrambled using Dharmafect 4 reagent (Dharmacon) following manufacturer’s instructions; SiTox (Dharmacon) was used as a positive control. [score:1]
Univariate and multivariate analysis of prognostic associations for miR184 signature. [score:1]
b miR-184 is undetectable in a majority of human breast cancer cell lines. [score:1]
E Gene set enrichment analysis of miR-184. [score:1]
S6K2, a member of 40S ribosomal protein S6 kinase family was also repressed by miR-184 at the mRNA and protein level. [score:1]
A Immunoblots of members of AKT/mTOR pathway in MDA-MB-231 transfected with miR-184 mimics and treated with and without epidermal growth factor (EGF). [score:1]
miR-184 repressed global protein synthesis dramatically (Fig.   5b). [score:1]
We detected that miR-184 similarly repressed global protein synthesis by approximately 30 % in the HEK293E cells stimulated with insulin (Fig.   5c). [score:1]
Orthotopic xenografts of breast cancer cells were used to assess the effect of miR-184 on tumourigenesis as well as distant metastasis. [score:1]
[1 to 20 of 167 sentences]
2
[+] score: 457
Other miRNAs from this paper: hsa-mir-184
The data showed that the up-regulation of miR-184 led to the obviously down-regulated expression of TNFAIP2 and reduced the expression of miR-184 resulted in the significant up-regulation of TNFAIP2 (Figure  3C-D). [score:14]
The present study demonstrated that miR-184 was markedly down-regulated in human glioma cells and tissues, TNFAIP2 was up-regulated in human glioma cells and tissues, and TNFAIP2 expression was inversely correlated with miR-184 expression. [score:11]
The up-regulated expression of miR-184 in U87 and U251 cells led to the obvious down-regulation of TNFAIP2 mRNA and protein expressions. [score:11]
Also, miR-184 targeted TNFAIP2 in vitro and in vivo, but it was neither elaborated upon nor proven whether the high expression of TNFAIP2 led to the process of invasion and proliferation in gliomas or whether miR-184 suppressed the survival and invasion of gliomas by down -regulating the expression of TNFAIP2. [score:10]
Also, the overexpression of miR-184 led to the down-regulation of TNFAIP2, and miR-184 regulated the expression of TNFAIP2 by binding to the 3′-UTR of TNFAIP2 mRNA. [score:9]
Up-regulation of miR-184 directly regulated the low expression of TNFAIP2 in human glioma cells. [score:8]
The results confirmed that both TNFAIP2 mRNA and protein expressions were substantially down-regulated by the high expression of miR-184 in gliomas. [score:8]
Up-regulation of miR-184 suppressed glioma cell proliferation in vitro and in vivo, induced apoptosis, and inhibited the cell cycle. [score:8]
Up-regulation of miR-184 suppressed glioma cell proliferation in vitro and in vivo, induced apoptosis, and inhibited the cell cycleAs shown in Figure  5C, the CCK-8 assay was performed to detect the effects of miR-184 on U87 and U25 cells growth in vitro. [score:7]
The up-regulation of miR-184 inhibited glioma cell proliferation and invasion and induced apoptosis. [score:6]
miR-184 could regulate TNFAIP2 expression and affected its translation in glioma. [score:6]
Emdad L, Janjic A, Alzubi MA, Hu B, Santhekadur PK, Menezes ME, et al. Suppression of miR-184 in malignant gliomas upregulates SND1 and promotes tumor aggressiveness. [score:6]
To examine whether miR-184 regulated TNFAIP2 expression in gliomas, U87 and U251 cells were infected with miR-184 mimic, inhibitor, negative control miRNA. [score:6]
For glioma, miR-184 exhibited a progression -associated down-regulation miRNA; Overexpression of miR-184 in A172 and T98G glioma cells significantly decreased cell viability and proliferation [17]. [score:6]
The results showed that miR-184 may regulate the expression of TNFAIP2 by binding to the 3′-UTR of TNFAIP2 mRNA and affecting its translation in gliomas. [score:6]
The miR-184 expression level was significantly increased after transfection with miR-184 mimic, while its expression was decreased after transfection with inhibitors, as compared to their corresponding negative control (miR-NC and anti-NC). [score:6]
Reducing the expression of miR-184 resulted in the significant up-regulation of TNFAIP2 mRNA and protein. [score:6]
Therefore, both TNFAIP2 mRNA and protein expressions were down-regulated by ectopic miR-184 in glioma cells. [score:6]
The overexpression of miR-184 inhibited the wound closure speed of U87 and U251 cells compared with the Negative group or inhibitor group. [score:6]
A. To keep a high transfection efficiency, qRT-PCR was used to detect the expression of miR-184 in U87 and U251 cells 48 h after transfection with miR-184 mimic, inhibitors, and the negative control miRNA. [score:5]
Recently, researchers have shown that miR-184 functions as a potential oncogene in human hepatocellular carcinoma by suppressing Sox7 expression [13]. [score:5]
In vitro, the proliferation of glioma cells was found to be significantly inhibited by the forced expression of miR-184. [score:5]
The miR-184 expression levels were determined in 49 glioma tissues and 5 glioma cell-lines by qRT-PCR analysis, which displayed a remarkable down-regulation of miR-184 in gliomas compared to 6 non-tumor brain tissues. [score:5]
A. shows that miR-184 overexpression induced apoptosis in U87 and U251 cells and down-regulated of miR-184 reduced apoptosis compared with Negative group. [score:5]
Foley et al. found that miR-184 ectopic overexpression in neuroblastoma cell-lines had pro-apoptotic and anti-proliferation functions through inhibiting AKT2, which was one downstream gene of the PI3K/AKT pathway [28]. [score:5]
Figure 3 The expression of miR-184 in U87 and U251 cells after transfection modulated the expression of TNFAIP2. [score:5]
Thus, miR-184 inhibited the progression of gliomas and may serve as a novel therapeutic target for the treatment of gliomas. [score:5]
B. shows that miR-184 expression in 5 glioma cell-lines was down-regulated compared to 6 normal brain tissues (N1, N2, N3, N4, N5, N6). [score:5]
These results suggested that low expression of miR-184 might be associated with the malignant glioma process and might act as a tumor suppressor in gliomas. [score:5]
Biological information software (Targetscan, miRwalk, miRanda) have predicted that TNFAIP2 was one of the miR-184 target genes (Figure  3B) and have characterized TNFAIP2 as a direct target of miR-184 by a dual-luciferase reporter assay in lung cancer cells [22]. [score:5]
Also, miR-184 down-regulation might be linked to glioma development. [score:5]
miR-184 could also inhibit glioma progression and might serve as a novel therapeutic target in glioma. [score:5]
B. shows the bioinformatic analysis using Targetscan, miRwalk, and miRanda, which predicted that miR-184 targeted TNFAIP2. [score:5]
The results of this experiment implied that miR-184 might be a suppressor gene and conformed that miR-184 could target TNFAIP2 in gliomas. [score:5]
Figure 1 miR-184 was down-regulated in human glioma tissues and glioma cell-lines. [score:4]
However, miR-184 functions both as oncogene and tumor suppressor in the development and progression of numerous cancers. [score:4]
D. depicts the results of the qRT-PCR analysis, which showed that miR-184 inhibited the mRNA expression of TNFAIP2 in U87 and U251 cells compared with their corresponding negative control. [score:4]
Up-regulation of miR-184 reduced the invasion and migration of U87 and U251 cells. [score:4]
TNFAIP2, which can be induced by treatment of TNF-α that with miR-184 can directly target TNFAIP2 in carcinoma (NPC) tissues, and is closely related to invasion and metastasis and poor survival in NPC patients [21]. [score:4]
Previous studies have shown that miR-184 was down-regulated in glioma cell-lines and tissues and decreased with the increasing degree of malignancy [17, 18], but too few cases were studied. [score:4]
Biological information software also predicted that miR-184 could directly target TNFAIP2 mRNA sequences at the region from 1870 to 1876. [score:4]
Wound healing and Matrigel invasion assays were performed to conclude that the overexpression of miR-184 markedly suppressed the invasiveness of U87 and U251 cells in comparison with the negative control group. [score:4]
In additional, Yuan et al. reported that miR-184 was significantly upregulated in human glioma cells. [score:4]
Even though previous studies have confirmed that miR-184 was down-regulated in gliomas and decreased with the increasing degree of malignancy, the number of cases used was too limited. [score:4]
C. shows the left panel, in which the Western blot analysis showed that miR-184 inhibited the expression of TNFAIP2 compared with the Mock group or the negative control miRNA group. [score:4]
Studies have shown that miR-184 was down-regulated in glioma and TNFα -induced protein 2 (TNFAIP2) was closely related to tumorigenesis. [score:4]
In vivo, the xenografted tumor size in the miR-184 overexpressing group were smaller than the miR-NC group. [score:3]
Figure  3A shows that the expressions of miR-184 in U87 and U251 cells after transfection were detected by qRT-PCR. [score:3]
The expression and function of TNFAIP2 have not been studied in gliomas; the relationship between TNFAIP2 and miR-184 also has not been studied. [score:3]
The collective data provided sufficient indication that miR-184 might serve as a tumor suppressor gene in gliomas. [score:3]
In vivo, U87 cells transduced with either lentiviral over-expressed miR-184 or control lentivirus were injected into nude mice subcutaneously and intracranial respectively. [score:3]
U87 and U251 cells were transfected with miR-184 mimic, miR-184 inhibitor, and their corresponding negative control (miR-NC and anti-NC) by Lipofectamine2000 (Invitrogen Inc. [score:3]
Cells (2 × 10 [3] per well) were seeded in a 96-well plate and incubated for 24 h. Then, the cells were transfected with miR-184 mimic, miR-184 inhibitor, or the negative control miRNA (Negative)at a final concentration of 50 nmol/L. [score:3]
It is reasonable to hypothesize that miR-184 inhibited the proliferation of glioma cells by increasing the percentage of early apoptotic cells, and it was suggested that miR-184 might be a novel specific biomarker for gliomas. [score:3]
The overexpression of miR-184 might play an onco-miRNA role in the anti-apoptotic and proliferation processes. [score:3]
Previous experimental studies have demonstrated that miR-184 acted as a modulator in the malignant progression of gliomas [17] and was expressed lower in glioma cells and tissues [18]. [score:3]
To achieve stable transfectant overexpression of miR-184 and negative control oligonucleotide, pLenti-miR-184-GFP and pLenti-NC-GFP (Genechem Co. [score:3]
Cells transfected with miR-184 mimic, inhibitor, or negative control miRNA were collected and resuspended in 400 μl of 1× binding buffer containing 5 μl 7-AAD (7-amino-actinomycin D) and 5 μl PI at room temperature in the dark for 10–15 min. [score:3]
TNFAIP2 expression and its correlation with miR-184 in gliomas have not been previously reported. [score:3]
In concordance with the previous results, Tivnan et al. have demonstrated that miR-184 mediated inhibition tumor growth and prolonged the survival time in an orthotopic murine mo del of neuroblastomas [16]. [score:3]
The expression level of miR-184 was low in 49 cases of glioma and 5 glioma cell-lines. [score:3]
Quantitative reverse transcriptase PCR (qRT-PCR) results demonstrated that miR-184 expression in 49 glioma tissues was markedly lower than in 8 noncancerous brain tissues and decreased with the increasing degree of malignancy in gliomas (low-grade vs high-grade, P < 0.01, Figure  1A, Table  1). [score:3]
To select stably expressed cells, U87 cells were transfected with pLenti-miR-184-GFP or pLenti-NC-GFP. [score:3]
The stable expression of U87 cells of miR-184 or miR-NC were established through a lentivirus infection method and inoculated into nude mice in intracranial and subcutaneous, respectively. [score:3]
Biological information software have predicted that miR-184 could target TNFα -induced protein 2 (TNFAIP2), Which was further validated by Western blot and qRT-PCR in glioma cells. [score:3]
Protein and mRNA expression of TNFAIP2 were inversely correlated with miR-184 in glioma. [score:3]
These findings suggested that miR-184 inhibited the migration and invasion of U87 and U251 cells in vitro. [score:3]
The sequences were as follows: miR-184 mimic, 5′-UGGACGGAGAACUGAUAAGGGUCCUUAUCAGUUCUCCGUCCAUU-3′; the negative control (miR-NC), 5′-UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT-3′; miR-184 inhibitor, 5′-ACCCUUAUCAGUUCUCCGUCCA-3′; and the negative control (anti-NC), 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:3]
In human gliomas, TNFAIP2 was one of the specific targets of miR-184. [score:3]
The present study increased the glioma cases to further confirm the expression and function of miR-184 in gliomas. [score:3]
The immunohistochemical staining results also showed that the glioma xenografts of the U87-miR-184 group expressed less TNFAIP2 than the tumors in the U87 -negative group (Figure  4F). [score:3]
The average expression rate of Ki-67 is only 33% in U87 -miR-184 group, 75% in U87 negative group (p < 0.01) (Figure  4F). [score:3]
Real-time reverse-transcription PCR detected expression of miR-184 and TNFAIP2. [score:3]
The miR-184 binding site single nucleotide polymorphisms [SNP (rs8126 T > C)] in the 3′-UTR of TNFAIP2 modulated TNFAIP2 expression and contributed to susceptibility to squamous cell carcinoma of the head and neck (SCCHN) [22]. [score:3]
miRNA-184 is an oncogene in human hepatocellular carcinoma but acts as a tumor suppressor in tongue squamous cell carcinoma. [score:3]
F. shows that miR-184 reduced TNFAIP2 and ki-67 expression in an in vivo mice mo del. [score:3]
Meanwhile, miR-184 expression was also examined in glioma cell-lines (U87, U251, U373, A72, SHG44). [score:3]
The tumor size of the xenografts further confirmed that the U87 miR-184 overexpression group showed slower tumor growth than the U87 negative control group in vivo. [score:3]
Figure 6 miR-184 overexpression induced apoptosis and increased the cell population in the G0/G1 phase. [score:3]
The plasma expression levels of miR-184 were also associated with the presence of primary tumors and might be used as a novel cancer marker in tongue squamous cell carcinoma [14]. [score:3]
However, the high expression of miR-184 reportedly causes a decrease in cell numbers and increases apoptosis in neuroblastoma cell-lines [15]. [score:3]
All the experiments showed that miR-184 was a suppressor gene in the malignant procession and carcinogenesis of gliomas and may be used to develop a miRNA -based therapeutic strategy against glioma. [score:3]
Therefore, the expressions of miR-184 and TNFAIP2 were negatively correlated in gliomas. [score:3]
In vivo, the growth curve of tumor xenografts showed that high expression level of miR-184 obviously slowed tumor growth. [score:3]
The effects of miR-184 on malignant progression are debated because it can act as a tumor promoter or suppressor in some solid tumors [14, 13, 26]. [score:3]
It showed that miR-184 expression in 49 gliomas was markedly lower than in 8 non-cancerous brain tissues and decreased with the increasing degree of malignancy in gliomas (low grade vs high grade). [score:3]
These collective results suggested that TNFAIP2 is a genuine target of miR-184 in gliomas. [score:3]
Figure 4 miR-184 reduced glioma growth and TNFAIP2 expression in vivo in the mice mo del. [score:3]
A. shows the qRT-PCR analysis results of miR-184 expression in glioma tissues and normal brain tissues (NBT). [score:3]
To confirm the results of the present study, the number of glioma cases was increased to detect the expression of miR-184. [score:3]
A previous study showed that miR-184 directly targeted the 3′-UTR of TNFAIP2 using a dual-luciferase reporter assay in lung, head, and neck cancer cell-lines. [score:3]
miR-184 had a significant suppressive effect on glioma proliferation, migration, and invasion. [score:3]
Besides, a study by Emdad et al. confirmed that miR-184 is down-regulated in human malignant glioma cells and tumor tissue as compared with their non-neoplastic counterpart [18]. [score:3]
B. Transwell assay shows the invasion of U87 and U251 cells transfected with miR-184 mimics or inhibitor. [score:2]
The data demonstrated that the growth curve was significantly inhibited in the miR-184 mimic -transfected cells compared to the negative control groups, and there was a significant difference between the control (miR-NC)group and miR-184 group (Table  3). [score:2]
Contrarily, wound closure speed was improved by transfection with miR-184 inhibitor compared with Negative and miR-184 groups (Figure  5A). [score:2]
The IHC results of the nude mice intracerebral transplantation tumors also showed that U87 cells transfected with miR-184 had reduced ki-67 expression compared to the control group. [score:2]
As shown in our experiments, tumors were efficiently suppressed in miR-184 group compared to negative group (Figure  4A). [score:2]
Expression of miR-184 was significantly lower in glioma tissues and cell-lines compared to normal brain tissues. [score:2]
As demonstrated in Figure  1B, the expression of miR-184 was significantly reduced in 5 glioma cell-lines compared to 6 non-tumor brain tissues. [score:2]
A. Wound healing assay shows that the migration of U87 and U251 cells transfected with miR-184 mimics or inhibitor. [score:2]
In accordance with the results of the wound healing assay, the Transwell matrix penetration assay showed that the overexpression of miR-184 markedly suppressed the invasiveness of U87 and U251 cells compared to Negative and anti-miR-184 groups (Figure  5B). [score:2]
As in other reports, the results of the present study indicated that miR-184 could regulate TNFAIP2 in glioma cells. [score:2]
U87 and U251 cells were transfected with miR-184 mimic, inhibitor, or negative control miRNA, and their invasion abilities were assayed. [score:2]
Concordantly, U87 and U251 cells transfected with miR-184 mimic had a higher apoptosis rate, triggering an accumulation of cells at the G0/G1 phase and decreased cells in S-phase. [score:1]
Whether miR-184 inhibits glioma survival by blocking the PI3K/AKT2 pathway needs further investigation. [score:1]
U87-miR-184 and U87-miR-NC cells were established and inoculated into nude mice (4 to 5 weeks old) in intracranial (1 × 10 [5]) and subcutaneous (1 × 10 [6]) fashions, respectively (n = 6 /group). [score:1]
Representative intracranial H&E stainings of xenograft tumors in nude mice showed that miR-184 reduced glioma growth, as shown in Figure  4E. [score:1]
Figure 5 Up-miR-184 reduced the invasiveness and growth of glioma cells. [score:1]
B. - D. show that miR-184 reduced glioma growth in the subcutaneous glioma nude mice mo del. [score:1]
This study aimed to determine the functions of miR-184 in glioma and the mechanisms of miRNA-184-TNFAIP2 mediated glioma progression. [score:1]
In vitro, proliferation and invasion abilities were also decreased in U87 and U251 cells after transfection with miR-184 mimic. [score:1]
A. shows the T2-weighted MRI imaging of subcutaneous tumor growth at days 25 and 35 in U87-miR-184 and U87-Negative nude mice (red arrows indicate tumors). [score:1]
This study confirmed that miR-184 was lower in glioma cell-lines and in 49 glioma specimens than in normal brain tissues. [score:1]
The role of miR-184 in growth was next explored in vivo. [score:1]
miR-184 is particularly enriched in the brain and testes in humans and is located in region 25.1 on the q-arm of chromosome 15. [score:1]
The functions and exact mechanisms of miR-184 in glioma are poorly uderstood. [score:1]
The miR-184 expression level was measured using All-in-One™miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) according to the instructions. [score:1]
miR-184 performed an important function in glioma invasion. [score:1]
miR-184 effects on glioma cell apoptosis and cell cycle were assessed by flow cytometer. [score:1]
E. shows the representative H&E staining, which revealed that miR-184 reduced glioma growth in the encephalic glioma nude mice mo del. [score:1]
In gastric cancer and SCCHN, miR-184 bonded to the 3′-UTR of TNFAIP2, and the miR-184 binding site single nucleotide polymorphisms in TNFAIP2 contributed to tumor susceptibility [22, 30]. [score:1]
The present study identified that miR-184 induced the apoptosis of U87 and U251 cells, increased the cell population in the G0/G1 phase, and reduced the percentage of cells in the S phase. [score:1]
Cell proliferation was dramatically decreased in U251 and U87 cells after transfection with miR-184. [score:1]
The results indicated that the proportion of apoptosis cells transfected with miR-184 was significantly higher than in the anti-miR-184 group and the negative group (Figure  6A). [score:1]
The wound healing assay showed that miR-184 expression reduced the wound closure speed of U87 and U251 cells compared with negative control oligonucleotide (Negative) and anti-miR-184 groups. [score:1]
To illustrate the mechanisms how miR-184 modulates glioma cell growth, flow cytometry was applied to detect the effects of miR-184 on cell apoptosis and the cell cycle. [score:1]
The left panel shows representative pictures of up-miR-184, which increased the apoptosis of U87 and U251 cells. [score:1]
miR-184 TNFAIP2 Proliferation Invasion Glioma Gliomas are the most common and lethal primary brain tumors in adults. [score:1]
[1 to 20 of 129 sentences]
3
[+] score: 298
Other miRNAs from this paper: mmu-mir-383
In this study, we have found that the miR-184 expression levels were increased during the postnatal development of the mouse testis, miR-184 localization was restricted to testicular germ cells from spermatogonia to round spermatids, overexpression of miR-184 could promote GC-1spg proliferation and miR-184 downregulated Ncor2 by targeting its 3'-UTR through inhibiting NCOR2 protein translation. [score:15]
MiR-184 downregulated Ncor2 through inhibiting NCOR2 protein translation in vitroMiRNAs regulate gene expression at posttranscriptional levels by either preventing mRNAs from being translated or causing them to be degraded. [score:12]
Moreover, miR-184 downregulated nuclear receptor corepressor 2 (Ncor2) by targeting its 3' untranslated region through inhibiting NCOR2 protein translation. [score:12]
We further provided evidence that miR-184 could downregulate nuclear receptor corepressor 2 (Ncor2) by targeting its 3'- untranslated region (3'-UTR) and inhibiting NCOR2 protein translation. [score:12]
The inverse expression patterns between miR-184 and NCOR2 are consistent with our data showing that miR-184 could downregulate Ncor2 through targeting its 3'UTR (Figure 4). [score:8]
These results indicate that miR-184 could downregulate Ncor2 through inhibiting translation in vitro. [score:8]
MiR-184 targeted Ncor2 at its 3'UTRMiRNAs have been predicted to regulate genes expression through binding to the 3'UTR of the target mRNAs. [score:7]
Our data showed that overexpression of miR-184 in GC-1spg could promote its proliferation, suggesting that miR-184 might target Ncor2 to decrease its expression and reduce the amount of NCOR2 available for interaction with B-Myb. [score:7]
MiR-184 downregulated Ncor2 through inhibiting NCOR2 protein translation in vitro. [score:7]
Here, we reported for the first time that miR-184 expression levels increased with the postnatal development of the mouse testis and its expression was restricted to testicular germ cells. [score:6]
Here, we found that miR-184 was expressed during the postnatal development of the mouse testis and its expression levels were increased with age (Figure 1). [score:6]
Interesting, we also found that the expression levels of NCOR2 were decreased from postnatal 30 day testis to adult mouse testis comparing with those in postnatal 7 day testis (Figure 3), which was also different from our data showing that miR-184 expression levels increased during the postnatal development of mouse testis (Figure 1). [score:6]
To answer this question, TargetScan software [13] was used to screen the potential targets of miR-184. [score:5]
There are 18 predicted targets of miR-184 based on TargetScan screening. [score:5]
However, the NCOR2 protein levels did decrease after miR-184 overexpression in these two cell lines, indicating that miR-184 decreased NCOR2 protein levels not by mRNA degradation, but by translational repression in vitro. [score:5]
Chen and Forley et al found that miR-184 overexpression induced neuroblastoma cell cycle arrest and apoptosis through targeting the serine/threonine kinase AKT2 [21, 22]. [score:5]
MicroRNA-184 (miR-184) has been shown to be mainly expressed in the testis and brain, and that its expression levels are by far the highest in the testis. [score:5]
Unlike the expression pattern of miR-184, Ncor2 is expressed ubiquitously. [score:5]
About the biological functions of miR-184, studies have linked its overexpression to squamous cell carcinoma of the tongue [20], its downexpression to gliomas [31] and MYCN-amplified neuoblastoma [21, 22]. [score:5]
B, results showed the expression levels of NCOR2 protein dropped after GC-1spg overexpression of miR-184. [score:5]
It has been shown that miR-184 is mainly expressed in the testis and brain, and that its expression levels in the testis are much higher than those in the brain [9, 10]. [score:5]
And the expression levels in brain are higher than those in testis [17], which is also different from the miR-184 expression levels between these two organs. [score:5]
Taken together, the testis-preferential spatiotemporal expression pattern of miR-184 during postnatal development of the mouse testis indicates that miR-184 could play a role in mouse spermatogenesis. [score:4]
To determine whether Ncor2 function as a target of miR-184 in vivo, assays were used to test the protein levels of NCOR2 after overexpressed miR-184. [score:4]
The mechanism of how miR-184 regulates Ncor2 expression remains unresolved. [score:4]
Our data also showed that the expression levels of Ncor2 mRNA and NCOR2 protein were higher in premature mouse testis than those in adult mouse testis (Figure 3), which showed an anti-correlation compared with the expression levels of miR-184 in developing mouse testis. [score:4]
Previous studies have tested that miR-184 is only expressed in brain, testis and cortical epithelium in mouse [9, 10]. [score:3]
Round spermatids in stage I to stage VIII also expressed miR-184. [score:3]
Additionally, miR-184 expression levels in the testis were much higher than those in the brain [9]. [score:3]
The increased levels of miR-184 upon overexpression were demonstrated by quantitative RT-PCR (Figure 4C). [score:3]
The increased levels of miR-184 upon overexpression were demonstrated by quantitative RT-PCR (Figure 2A). [score:3]
A, Quantitative RT-PCR showed the increased levels of miR-184 upon overexpression. [score:3]
A 517 bp region of the 3'-UTR of mouse Ncor2 containing three potential miR-184 target sites was cloned into the firefly luciferase vector (Ncor2-wt). [score:3]
Figure 1 Expression pattern of miR-184. [score:3]
X axis, different postnatal days of mouse testes; Y axis, miR-184 expression levels relative to postnatal day 7; Values are presented as the mean ± SD. [score:3]
miRNA mimics for miR-184 and cy3-labeled nontargeting scramble control were obtained from Ambion (Austin, TX, USA). [score:3]
Which cell type expresses miR-184 in the testis? [score:3]
In this study, we have found that the mRNA of Ncor2 did not change after overexpression of miR-184 in GC-1spg and Hela cells. [score:3]
Our data showed that overexpression of miR-184 in GC-1spg could induce GC-1spg cell cycle promotion and proliferation (Figure 2), which was similar to or different from the reports of other groups. [score:3]
Specifically, miR-184 expression was restricted to the germ cells from spermatogonia to round spermatids. [score:3]
MiR-184 expression levels increased during the postnatal development of the mouse testis. [score:3]
Ncor2-wt: A 517 bp region of the 3'-UTR of mouse Ncor2 containing the overlapping potential miR-184 target sites was inserted into the XbaI-FseI site immediately downstream of the stop codon in the pGL3 Firefly Luciferase reporter vector (Promega, Madison, WI, USA). [score:3]
To determine the mechanism of miR-184 downregulation of Ncor2, quantitative RT-PCR and assays were performed. [score:3]
A, Quantitative RT-PCR results showed the levels of Ncor2 mRNA did not change after GC-1spg overexpression of miR-184. [score:3]
To test whether miR-184 can alter the expression of Ncor2, we cloned the 3'UTR of Ncor2 mRNA containing the overlapping miR-184 binding sequences into a firefly luciferase reporter vector (Ncor2-wt) and cotransfected Ncor2-wt and a Rellina luciferase reporter vector and miR-184 into Hela cells, in which endogenous miR-184 was at very low or close to none levels (data not shown). [score:3]
Which gene might be the target of miR-184? [score:3]
In this study, we have found that Ncor2 is a target gene of miR-184 (Figure 4). [score:3]
This result suggests that overexpression of miR-184 in GC-1spg could promote cells from G1 phase to S/G/M2 phase, indicating that miR-184 could induce GC-1spg proliferation. [score:3]
Overexpression of miR-184 promoted the proliferation of a germ cell line, GC-1spg. [score:3]
Ncor2-wt construct in the presence of 10 pmol of miR-184 mimic showed the inhibitory activity of this reporter. [score:3]
Taken together, we conclude that Ncor2 is the target gene of miR-184. [score:3]
Wong et al found that inhibition of miR-184 in tongue squamous cell carcinoma (SCC) cell lines could reduce cell proliferation rate, which indicates that miR-184 might play an oncogenic role in the antiapoptotic and proliferative processes of tongue SCC [20]. [score:3]
As shown in Figure 1, levels of miR-184 increased during the postnatal development of the mouse testis. [score:2]
In this study, we demonstrated that miR-184 levels were increased during mouse postnatal testis development. [score:2]
FCS analysis revealed that miR-184 overexpression resulted in significantly lower number of cells in the G1 phase (P < 0.001) and significantly higher number of cells in the S/G/M2 phase (P < 0.001) compared with the scramble negative control (Figure 2 B, C). [score:2]
The MTS assay showed that the relative cell number was significantly increased with overexpression of miR-184 (P < 0.01) (Figure 2D). [score:2]
MiR-184 targeted Ncor2 at its 3'UTR. [score:2]
MiR-184 overexpression promoted GC-1spg proliferation. [score:2]
NCOR2 protein levels decreased in Hela cells after overexpression of miR-184 mimic (lane 184-mim) for 48 h compared with the cells transfected with scrambled control oligonucleotide (lane scramble). [score:2]
Our findings suggest that miR-184 may be involved in the post-transcription regulation of mRNAs such as Ncor2 in mammalian spermatogenesis. [score:2]
Based on our data, it is suggested that miR-184 may be involved in the post-transcription regulation of mRNAs such as Ncor2 in mammalian spermatogenesis. [score:2]
To investigate the specificity of interactions between miR-184 and Ncor2 target mRNA sequence, we created one mutation construct in the Ncor2 binding site for miR-184 (Ncor2-mut). [score:2]
Moreover, it has been reported that miR-184 has multiple roles in Drosophila female germline development [32]. [score:2]
The Ncor2-mut construct showed that miR-184 mimic cannot inhibit the luciferase activity compared with the wild-type construct. [score:2]
As shown in Figure 5A, the normalized mRNA levels of Ncor2 did not change after overexpression of miR-184 in GC-1spg compared with the scramble control. [score:2]
Based upon the above-mentioned reasons, we focused our efforts on miR-184 and Ncor2 mRNA interactions. [score:1]
miR-184 was first observed in the murine eye [30]. [score:1]
And we also demonstrated that miR-184 was localized to the germ cells of mouse testis from spermatogonia to round spermatids (Figure 1). [score:1]
Moreover, the 3'UTR of Ncor2 contains critical binding site (TCCGTCC) of miR-184. [score:1]
Lower panel, Localization of miR-184 in adult mouse testes. [score:1]
MiR-184 (brown granules) was restricted to the cytoplasm of spermatogonia (S), spermatocytes (P) and round spermatids (R) in stage I-VI and stage VII-VIII, while the elongating or elongated spermatids (E) in stage IX-XI, stage I-VI were negative for miR-184. [score:1]
B, Flow cytometry analysis of GC-1spg transfected with miR-184 -mimic (B-1) or scrambled oligonucleotide (B-2). [score:1]
MiR-184 may be involved in the post-transcription regulation of mRNAs such as Ncor2 in mammalian spermatogenesis. [score:1]
No decreases in luciferase activity was seen when miR-184 was replaced with a scrambled miRNA. [score:1]
So the transcription level of B-Myb was increased, which may explain the proliferation-promoting effects of miR-184. [score:1]
C, MiR-184 overexpression resulted in significantly lower number of cells in the G1 phase (P < 0.001) and significantly higher number of cells in the S/G/M2 phase (P < 0.001) compared with the negative control. [score:1]
As shown in Figure 1, miR-184 was mainly detected in the cytoplasm of spermatogonia, spermatocytes in all stages of seminiferous epithelium. [score:1]
These results indicate that miR-184 promotes GC-1spg proliferation. [score:1]
By quantifying levels of the normalized luciferase activities in the presence of miR-184, we observed an ~ 45.8% decrease in luciferase activity with the construct bearing the 3'UTR of Ncor2 mRNA (Figure 4D). [score:1]
Moreover, Leydig cells in the interstitial tissue of the testis, peritubule myoid cells around the seminiferous tubule and Sertoli cells in the seminiferous tubule were negative for miR-184. [score:1]
Tissues were hybridized in the presence of 2.5 pmol locked nucleic acid (LNA) -modified, digoxigenin (DIG)-labeled miR-184 probe (5'-DIG-ACCCTTATCAGTTCTCCGTCCA-3', Exiqon, Vedbaek, Denmark) for 4 h at 52°C. [score:1]
And the overlapping complementary region in rat and mouse to the miR-184 seed match is in red or boxed. [score:1]
In this construct, six nt of the overlapping binding site for miR-184 were mutated (Figure 4B). [score:1]
The region complementary to the miR-184 seed match highly conserved among human, Macaca mulatta, rat and mouse is in red. [score:1]
The discrepancy could be explained by the different targets of miR-184 in the different cell lines among the above investigations. [score:1]
Upper panel, Relative quantity of miR-184 at different postnatal ages of mouse testes. [score:1]
However, the role of miR-184 in mammalian spermatogenesis remains unclear. [score:1]
[1 to 20 of 87 sentences]
4
[+] score: 177
Although not all of these genes might be directly modulated by miR-184, it is plausible that miR-184 by [2]inhibiting translation of some target genes might contribute to the regulation of these processes. [score:9]
The qPCR results confirmed the downregulation in the mTLE + HS group and revealed a more heterogeneous expression of miR-184 in mTLE -HS patient samples, while in mTLE + HS the expression of miR-184 was consistently low (Fig. 1B). [score:8]
Consistent with down-regulation of miR-184 three of the four experimentally validated miR-184 genes, AKT2, BIN-3 and NCOR2 were significantly upregulated in mTLE + HS in comparison with mTLE –HS (Fig. 3A–C). [score:7]
Expression of miR-184 target genes in hippocampal tissue. [score:5]
Differential expression analysis and miR-184 target genes. [score:5]
However previous findings also suggest that miR-184 inhibits cell proliferation via targeting AKT2 in vitro in neuroblastoma cell lines and in vivo in tumor patient samples 38. [score:5]
Interestingly, miR-184 targets several genes involved in immune response and apoptosis that are differentially expressed in mTLE + HS patients. [score:5]
These results identified a potential translational regulation of PRKCB by miR-184 as no difference was observed on the mRNA level between the two patient groups (Supplementary Figure S4). [score:4]
While the overall expression pattern of all detected miRNAs was not significantly different, we identified one miRNA, miR-184, with significantly reduced expression levels in samples from mTLE + HS patients when compared to mTLE -HS patients. [score:4]
No impact on astrocyte viability was observed in vitro, suggesting that miR-184 expression levels do not directly modulate astrocyte proliferation. [score:4]
These data suggest miR-184 is regulating AKT2, BIN3, and PRKCB expression, genes that are known to be involved in immune response and apoptosis related pathways (Supplementary Table S1). [score:4]
Overall, based on available data it cannot be ruled out that a decreased expression of miR-184 might contribute to the more pronounced neuronal death observed in mTLE + HS patients. [score:3]
In our study we observe that overexpression of miR-184 is decreasing the activation of primary murine microglial cells which are known to be key players in neuroinflammatory processes. [score:3]
Potential target genes for miR-184 and biological pathways in which they are involved were identified using the MetaCore [TM] software suite (http:// thomsonreuters. [score:3]
Overexpression levels of miR-184 in primary neurons were confirmed by qPCR (Supplementary Figure S6B). [score:3]
Expression of miR-184 in mTLE patients. [score:3]
Influence of miR-184 overexpression on primary neurons. [score:3]
Overexpression of miR-184 was confirmed by qPCR (Supplementary Figure S6A). [score:3]
Thus, two independent studies, using two different profiling methodologies (microarray and sequencing) consistently detect a reduced expression of miR-184 in patients with mTLE + HS. [score:3]
In this study, miR-184 expression was increased upon preconditioning in pyramidal neurons of the CA1 and CA3 region of the hippocampus leading to reduced seizure induced neuronal death 21. [score:3]
Furthermore, no direct protective role of miR-184 in neurons and no direct modulation of astrocyte viability were detectable. [score:3]
How to cite this article: Danis, B. et al. Differential expression of miR-184 in temporal lobe epilepsy patients with and without hippocampal sclerosis – Influence on microglial function. [score:3]
Many of the miR-184 predicted targets belong to pathways related to immune response and apoptosis. [score:3]
For miR-184 overexpression 30 nM of miRNA-184 -mimic (Life Technologies, mirVanaTM miRNA Mimics, MC10207, sequence: 5′-UGGACGGAGAACUGAUAAGGGU-3′) were complexed with 0.5 μl Lipofectamine RNAiMAX Transfection Reagent (Life Technologies, 13778) according to manufacturer’s instructions. [score:3]
Neither overexpression of miR-184 nor control miRNA mimic had any effect on the cell viability of primary murine astrocytes throughout the entire time course of 11 days (Fig. 6). [score:3]
Overexpression of miR-184 in stimulated microglial cells resulted in significant changes in cytokine levels while a control miRNA mimic (miR-scr) had no significant effect. [score:3]
com/site/systems-biology), we found 83 predicted target genes for miR-184, four of them being experimentally validated: AKT2 (PMID: 20409325), NCOR2 (PMID: 22017809), TNFAIP2 (PMID: 21934093) and BIN3 (PMID: 20795863). [score:3]
miR-184 target genes. [score:3]
Similarly, using a neuronal cell line (murine neuroblastoma cell line N1E-115), we observed a moderate dose dependent reduction of cell viability and an induction of caspase 3/7 activity after overexpression of miR-184 (Supplementary Figure S7). [score:3]
Influence of miR-184 overexpression in primary murine microglial cells. [score:3]
The expression of selected target genes of miR-184 was investigated by qPCR in samples of mTLE -HS and mTLE + HS patients. [score:3]
Overexpression levels of miR-184 in primary astrocytes was verified by qPCR (Supplementary Figure S6C). [score:3]
Although we were able to generate in situ data only for two mTLE + HS patients and two mTLE -HS patients, these experiments indicate lower expression levels of miR-184 in mTLE + HS compared to tissue from mTLE -HS (Fig. 2B and Supplementary Figure S3). [score:2]
MiR-184 showed a decreased expression validated by qPCR only in the mTLE + HS group, which is consistent with our data. [score:2]
Moreover, our results are consistent with the clinical observations in mTLE patients; higher miR-184 expression is observed in mTLE -HS patients showing moderate neuronal death compared to mTLE + HS patients with more pronounced and characteristic neuronal cell loss and low miR-184 expression. [score:2]
Overall, this implies a potential involvement of miR-184 in the regulation of inflammatory processes and apoptosis. [score:2]
Indeed, astrogliosis is observed in both mTLE -HS patients and mTLE + HS patients suggesting that miR-184 is not likely to directly modulate astrogliosis. [score:2]
In contrast a study by Kaalund et al., reported an increase in miR-184 expression in the mTLE + HS group when compared to 2 autopsy controls samples 20. [score:2]
We overexpressed miR-184 in murine primary neurons using miRNA mimic and assessed the cell viability 72 h after transfection using an ATPlite-Assay. [score:2]
Among the 11 genes tested AKT2, BIN3 and PRKCB showed reduced luciferase expression upon co-transfection with miR-184 compared to the control miRNA mimic (miR-src) and untransfected cells while other genes did not (Supplementary Figure S5). [score:2]
In conclusion, this study identified miR-184 being dysregulated between mTLE + HS and mTLE -HS patients. [score:2]
Taken together, miR-184 was expressed at lower levels in mTLE + HS patients compared to mTLE -HS patients (Figs 1 and 2). [score:2]
To evaluate whether miR-184 might modulate expression of these genes by blocking translation a 3′ UTR luciferase reporter gene assays was conducted for the same genes. [score:2]
Further investigation of the molecular targets of miR-184 in the hippocampal cell population could yield important information to delineate molecular pathways to strengthen our understanding of TLE and ultimately for the development of new therapies modulating the inflammatory response and consequently neuronal death in the brain of mTLE patients. [score:2]
Although the molecular mechanism of miR-184 and the exact cellular pathways involved are currently unknown it is plausible that miR-184 could act as a negative regulator in microglial cells interfering with the inflammatory processes induced by seizures in the brain. [score:2]
In our in vitro assay miR-184 overexpression itself did not positively affect cell viability of murine primary neurons. [score:2]
Nevertheless it is plausible that the decreased miR-184 expression observed in mTLE + HS patients is a consequence and not the cause of the more pronounced neuronal death observed in these patients when compared to mTLE -HS. [score:2]
miRNA-184 is significantly dysregulated in mTLE +HS patients. [score:2]
It is therefore tempting to speculate that the absence of miR-184 in mTLE patients with HS could lead to the more pronounced inflammation observed in those patients. [score:1]
Although overall miRNA signature seems to be similar among the different epilepsy patients, we identified one microRNA (miR-184) that was significantly (FDR < 0.01) down regulated in mTLE + HS patients compared to samples from mTLE -HS patients (Fig. 1A). [score:1]
To verify the results from the RNA sequencing analysis, we investigated the patient samples for expression of miR-184 using RT-qPCR (Fig. 1B). [score:1]
Influence of miR-184 on astrogliosis. [score:1]
Influence of miR-184 on microglial activation. [score:1]
Based on our in vitro data miR-184 could act as a potential modulator of the inflammatory processes occurring in mTLE patients by modulating the activation state of the microglial cells and thereby reducing cytokine release. [score:1]
Next we set out to detect miR-184 in the resected tissue by in situ hybridization. [score:1]
Transfection with miR-184 mimics did not affect neuronal viability relative to cells transfected with control miRNA mimic (miR-scr) (Fig. 5). [score:1]
Primary murine neurons were transfected with miR-184 mimic and mir-scr. [score:1]
Previous in vivo studies did indicate that miR-184 could play a protective role in neuronal death as demonstrated in a mouse seizure preconditioning mo del 21. [score:1]
MiRNA sequences used for transfection were: mir-184: 5′-UGGACGGAGAACUGAUAAGGGU-3′ (Life Technologies, MC10207) and the negative control miRNA -mimic (Life Technologies, 4464058). [score:1]
On DIV 4 cells were transfected with 30 nM of miRNA-184 -mimic (Life Technologies, mirVanaTM miRNA Mimics, MC10207, sequence: 5′-UGGACGGAGAACUGAUAAGGGU-3′) and the corresponding scr-control (Life Technologies, 4464058) using 0.5 μl Lipofectamine RNAiMAX Transfection Reagent (Life Technologies, 13778) according to manufacturer’s instructions. [score:1]
However, this elevation of miR-184 was only seen in the initial microarray data and not confirmed by qPCR or in a second independent patient cohort. [score:1]
Levels of TNF-α were lower in miR-184 transfected cells relative to miR-scr transfected cells – albeit not significantly (Fig. 4A). [score:1]
HELA cells were co -transfected in a 96 well plate using GenMute™ siRNA Transfection Reagent with modified reporter vector (Genecopoeia pEZX-FR02) and 40pmol of miR-184 mimic (Life Technologies, mirVanaTM miRNA Mimics, MC10207) or miRNA mimic control (miR-scr, Life Technologies, 4464058). [score:1]
In situ hybridisation analysis of miR-184 in mTLE patients. [score:1]
Influence of miR-184 on the viability of astrocytes. [score:1]
Influence of miR-184 on neuronal viability. [score:1]
Each sample was then run in triplicates for miR-184 as well as for two reference miRNAs (miR-125a-5p and miR-191-5p). [score:1]
Sections were incubated with probes for miR-184 (B). [score:1]
Therefore, we determined the levels of different pro- and anti-inflammatory cytokines in the supernatant of activated microglial cells upon transfection with miR-184 or control miRNA mimic (miR-scr). [score:1]
However, to strengthen this hypothesis more studies are required to delineate the function of miR-184 on neuronal viability. [score:1]
[1 to 20 of 70 sentences]
5
[+] score: 135
Among three selected targets for mosquito-specific miRNAs that were inserted into the 3’NCR of DEN4 genome, the presence of a target for the highly expressed miRNAs in mosquito cells Aag2 or C [7]10 (mir-184 and mir-275) reduced DEN4 replication to a greater extent than the inclusion of a target for the less expressed mir-1 miRNA (Figs 2 and S1) [37]. [score:11]
Therefore, to explore if targeting of an ORF region of DEN4 by mosquito-specific miRNAs can result in specific viral attenuation in mosquitoes, targets for mosquito-expressed mir-184 and mir-275 as well as three targets for human neuron-specific mir-124 miRNA were introduced in the DEN4 genome between sequences encoding the two C-terminal stem-anchor domains of DEN4 E protein (D4-E virus; Fig 1). [score:9]
Even though a combined expression of mir-184 and mir-275 targets in the 3’NCR was sufficient to greatly restrict the D4-275-184 virus replication in mosquito cells and abolish infectivity in adult mosquitoes, an escape mutant lacking both authentic target sequences can theoretically emerge as a result of error prone flavivirus replication under miRNA -mediated selective pressure. [score:7]
Thus, replication of D4-275-184 containing targets for mir-275 and mir-184 in the 3’NCR was not detected in either Aag2 or C6/36 cells, whereas D4-E containing the same targets in the duplicated E-NS1 region replicated to titers of 2.5 and 5.5 log [10] pfu/ml in these cells, respectively. [score:5]
1004852.g001 Fig 1 Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
In contrast, the D4-275-184 virus was unable to infect the midgut and thus failed to disseminate in both mosquito species indicating that a combined expression of mir-184 and mir-275 targets in D4-275-184 was sufficient to completely block DEN4 replication in the principal mosquito vectors (Fig 4C and 4D, p<0.001; Fisher’s exact test). [score:5]
Target sequences for mosquito specific mir-1 (5’-CTCCATACTTCTTTACATTCCA-3’), mir-184 (5’-GCCCTTATCAGTTCTCCGTCCA-3’) and mir-275 (5’-GCGCTACTTCAGGTACCTGA-3’) or human brain-specific mir-124 (5’-GGCATTCACCGCGTGCCTTA-3’) were introduced into the 3’NCR of DEN4 genome between nts 10,277 and 10,278 (position 1, Fig 1) or 10,474 and 10,475 (position 2, Fig 1); these sites of target insertion are located 15 or 212 nts downstream of the TAA stop codon in the 3’NCR, respectively. [score:5]
To minimize the probability of such events, we generated a virus (D4-E-NCR1; Fig 1) expressing mir-184 and mir-275 target sequences in both the ORF and 3’NCR of DEN4 genome. [score:5]
Based on this data, three mosquito-specific miRNAs (mir-184, mir-275 and mir-1) were selected for DEN4 genome targeting because they satisfy the following criteria: 1) they are highly expressed in different mosquito organs and mosquito-derived cell lines, and also remain abundant during flaviviruses infection [37]; 2) these miRNAs are evolutionarily conserved among insect species including mosquitoes, but they are different from their miRNA analogs in mammals. [score:5]
Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
In addition, combined expression of mir-275 and mir-184 targets in the 3’NCR was sufficient to completely block the D4-275-184 virus infectivity for A. aegypti and A. albopictus (Fig 4), whereas D4-E was detected in 5.6% (1/24) of A. aegypti mosquitoes (Fig 6). [score:5]
Both D4-E and D4-E-NCR1 viruses contained miRNA targets for mosquito-specific mir-184 and mir-275 and three copies of target sequences for vertebrate brain-specific mir-124 in the duplicated E/NS1 region (Fig 1). [score:5]
Synonymous mutations introduced into mir-184 and mir-275 target sequences of D4-E* are highlighted in bold letters. [score:4]
of a single copy of miRNA target for either mir-184 or mir-275 miRNA resulted in a significant reduction of the DEN4 titer in mosquito bodies (Fig 4A and 4B; p≤0.002 one-tailed Student's t-test) in both mosquito species as well as viral infectivity and ability of virus to develop a disseminated infection in A. aegypti (Fig 4C; p<0.05 one-tailed Fisher’s exact test). [score:3]
1004852.g004 Fig 4Effect of combined mir-184 and mir-275 co -targeting of DEN4 genome in the 3’NCR on virus fitness in A. aegypti and A. albopictus. [score:3]
S1 FigRelative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
1004852.g006 Fig 6Effect of mir-184 and mir-275 co -targeting of DEN4 genome in the ORF and 3’NCR on virus fitness in A. aegypti mosquitoes. [score:3]
Two additional constructs were developed based on D4-275s that contained additional target sequence for either mir-184 or mir-275 at nt position 212 of DEN4 3’NCR (Fig 1). [score:3]
Effect of combined mir-184 and mir-275 co -targeting of DEN4 genome in the 3’NCR on virus fitness in A. aegypti and A. albopictus. [score:3]
This likely reflects that insertions of heterologous sequences (mir-275 and mir-184 targets) in the ORF can result in partial attenuation of DEN4 replication in the brain of mice. [score:3]
Mir-184 and mir-275 target sequences are indicated as red and green boxes, respectively. [score:3]
In contrast, the replication of viruses D4-184s and D4-275s carrying a target for mir-184 or mir-275 was significantly impaired (p<0.001; 2-way ANOVA). [score:3]
Relative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
Specifically, the introduced sequence was inserted between nts 2451 and 2452 of DEN4 genome and contained five tandem targets for mir-124, mir-184 and mir-275 that were followed by a duplicated DEN4 E/NS1 region (nts from 2130 to 2451 of DEN4 genome) encoding 98 amino acids from the C-terminal end of the DEN4 E protein and 7 amino acids from the N-terminal end of the NS1 protein (Fig 1). [score:3]
Effect of mir-184 and mir-275 co -targeting of DEN4 genome in the ORF and 3’NCR on virus fitness in A. aegypti mosquitoes. [score:3]
The modified parental and mir-184- or mir-275 -targeted DEN4 viruses (designated D4, D4-184, and D4-275; Fig 1) were re-generated by cDNA transfection into Vero cells (S2 Table). [score:3]
Combined targeting for mir-184 and mir-275 miRNAs in the 3’NCR greatly reduced the DEN4 replication in mosquito cells and Aedes mosquitoes. [score:3]
Effect of combined mir-184 and mir-275 co -targeting of DEN4 genome in the 3’NCR on virus replication in mosquito and Vero cells. [score:3]
To investigate if miRNA targeting of DEN4 genome results in selective restriction of DEN4 replication in mosquitoes, a single copy of mir-184, mir-275, or mir-1 target sequence was introduced into the genome of DEN4 strain 814669 [40] (abbreviated D4s) between nucleotides (nts) 10277 and 10278 (15 nts downstream of the TAA stop codon preceding the 3’NCR). [score:3]
Two additional viruses (D4-275-184 and D4-275x2) were developed based on the D4-275 genome and contained a second target sequence for either mir-184 or mir-275 at nt position 212 of the 3’NCR (Fig 1). [score:3]
As a control, we generated a D4-E* virus, in which mir-184 and mir-275 target sequences of D4-E were synonymously mutated in the third base position of each codon. [score:3]
In both cell lines, these viruses exhibited a 1000-fold or higher reduction in virus titer at 3 days post-infection (dpi) compared to the D4s virus, correlating with mir-184 and mir-275 expression levels in Aag2 and C [7]10 cell lines (S1 Fig) [37]. [score:2]
For each line 14 μg of total RNA was used in northern blot analysis and then hybridized with biotinylated probes complementary to mir-184 (A), mir-275 (B), and mir-1 (C). [score:1]
The biotinylated probes complementary to mir-184 (5’Biotin-GCCCTTATCAGTTCTCCGTCCA-Biotin3’), mir-275 (5’Biotin-GCGCTACTTCAGGTACCTGA-Biotin3’), and mir-1 (5’Biotin-CTCCATACTTCTTTACATTCCA-Biotin3’) were synthesized by Bioresearch Technologies and used at 2–10 ng/mL. [score:1]
Ribo-oligonucleotides for artificial mir-184 (5’UGGACGGAGAACUGAUAAGGGC), mir-275 (5’UCAGGUACCUGAAGUAGCGC), and mir-1 (5’UGGAAUGUAAAGAAGUAUGGAG3’) were synthesized by Integrated DNA Technologies, and were used in northern blot as positive controls and molecular weight standards. [score:1]
[1 to 20 of 35 sentences]
6
[+] score: 37
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic lung and human lung cancer therefore demonstrating clinical relevance of this particular disease mo del. [score:6]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic mouse lung and human lung cancer thus further validating this mo del as relevant for human lung cancer (Figure 7). [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
With the Agilent platform significant up-regulation of, miR-21, miR-184 and miR-146b (borderline significant in male, Table 1) in male and female transgenic animals was observed, although at different levels in the two sexes. [score:4]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
Similarly, it is not clear why Affymetrix fails to see variations in all but two miRs (-127 and -433), since for example the probe for miR-184 has similar parameters to those for miR-127 and miR-433. [score:1]
Only the Agilent data for miR-184 and miR-146b, as well as for miR-21 (here female mice), were confirmed by the qPCR. [score:1]
[1 to 20 of 13 sentences]
7
[+] score: 36
Findings regarding the miRNA -mediated silencing of LGTV replication in the tick cell line are in an agreement with our data on miRNA -mediated suppression of mosquito-borne DEN4 virus demonstrating that DEN4 genome targeting for mosquito-enriched miRNAs attenuates virus replication in several mosquito-derived cell lines 5. Thus, both studies indicate that: (1) targets for miRNAs with high arthropod vector abundance [mir-1 in ticks 20 and mir-275 or mir-184 in mosquitoes 21] should be used for the effective virus suppression in the respective vector host; (2) target insertions for arthropod vector-specific miRNAs into several distant genome regions are more effective to control virus replication in invertebrate cells than targeting of only single site such as the 3′ NCR (Fig. 4); (3) co -targeting of virus genome for invertebrate vector-specific and brain tissue-enriched miRNA is associated with independent, simultaneous silencing of virus replication in both biological species/tissue types without the interference between miRNA targets (Fig. 4). [score:17]
Previously, we showed that insertion of targets for mosquito specific mir-184 and mir-275 into a distant position within the 3′ NCR of DEN4 genome completely blocks virus replication in mosquito-derived Aag2 and C6/36 cells 5. To explore if insertion of multiple miRNA targets into the 3′ NCR of LGTV can increase virus attenuation in tick cells, we generated a panel of viruses containing two or three copies of homologous (mir-1) or heterologous (mir-1, mir-275, mir-279) targets sequences (Fig. 3A), and compared their replication kinetics in Vero and ISE6 cells infected at a low MOI of 0.01 pfu per cell (Fig. 3B and S2). [score:6]
Growth of viruses containing the mir-1, mir-275, or mir-279 target was severely restricted, whereas replication of LGTV with target for mir-184 was only slightly attenuated as compared to wt-EcoR* (Fig. 1G). [score:4]
To generate a set of 3′(T) viruses carrying a single target in the 3′ NCR, complementary sequence for tick-specific mir-1, mir-184, mir-275, mir-279, or mir-263a miRNA was inserted at nt position 14 of the 3′ NCR of wt LGTV genome. [score:3]
In contrast insertion of targets for mir-184 or mir-263a had a moderate (<5 fold) or negligible (<1.5 fold) effect on LGTV RNA abundance in ISE6 cells, respectively (Fig. 1B–F). [score:3]
Viruses containing miRNA target for mir-1, mir-184, mir-275, mir-279 or mir-263a in the 3′ NCR and wt-EcoR* were recovered by transfection of plasmid DNA into Vero cells. [score:3]
[1 to 20 of 6 sentences]
8
[+] score: 24
Liu Z Candidate tumour suppressor CCDC19 regulates miR-184 direct targeting of C-Myc thereby suppressing cell growth in non-small cell lung cancersJ. [score:9]
In addition, miR-184 acts as a tumor suppressor in nasopharyngeal carcinoma, lung cancer, and neuroblastoma by targeting c-Myc, BCL-2, and AKT2 38– 40. [score:5]
Dysregulation of miR-184 promotes cell proliferation in hepatocellular carcinoma by targeting INPPL1 and SOX7 36, 37. [score:4]
Foley NH MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2Mol. [score:4]
Gao B Gao K Li L Huang Z Lin L miR-184 functions as an oncogenic regulator in hepatocellular carcinoma (HCC)Biomed. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 20
Conversely, overexpression of miR-184 in neuroblastoma cell lines resulted in a significant inhibition of tumor cell proliferation and reduction of tumor growth in a xenograft mo del by induction of apoptosis (Foley et al., 2010), leading us to speculate that apoptosis in the lung tumors of exposed mice might be inhibited. [score:7]
High expression of miR-184 has been reported in squamous cell carcinomas of the tongue, and when expression of the mature miRNA was knocked down by RNA interference, tongue cancer cells proliferated less and became increasingly apoptotic (Wong et al., 2008). [score:6]
Finally, we found mmu-miRNA-184 expression to be suppressed in response to MS. [score:5]
Interestingly, of the 3 miRNA that were affected by cigarette smoke exposure in tumors only, mmu-miR-151-3p, mmu-miR-130a-3p and mmu-miR-184-3p have previously been implicated in carcinogenesis. [score:1]
Surprisingly, the effects of cigarette smoke on miRNA levels were greater in parenchymal tissues than in tumors (Figure 5 and 7), and miRNA were distributed across three major categories of unequal sizes: 62 mRNA were altered (raw p-values were smaller than 0.05 for the corresponding pairwise comparisons) in parenchyma only, 3 miRNA (mmu-miR-130a-3p, mmu-miR-151-3p, mmu-miR-184-3p) were altered in tumors only and 5 in both tumor and parenchyma. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 18
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The highest upregulated miRNA (miR-184) at the GP-early OP transition shows a strong conserved 8mer binding site to BCL2-like 1 (Bcl2l1), a gene highly expressed in astrocytes [36]. [score:6]
The highest upregulated miRNA at this transition, miR-184, shows a high likelihood of binding to Bcl2l1, a gene which has been shown to be co-expressed with GFAP in various samples of astrocyte tissue [36]. [score:6]
On the other hand, the top upregulated miRNAs at the OP3-OL transition included miRNAs (miR-181a, miR-181b, miR-125b, and miR-184) that are associated with decreased proliferation in maturing CNS cells and decreased malignancy in glioma stem cells [49], [50], [51], [52], [53], [54], [55]. [score:4]
Therefore, it is possible that transfection of miR-184 and/or miR-1183 analogs to GPs may help reduce astrocyte differentiation and promote the production of oligodendrocyte cultures with increased purity. [score:1]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 18
Invasion was similarly inhibited by miR-184, but not by the other Suppressive miRNAs (Figure 4C). [score:5]
The few publications concerning miR-184 in cancer showed contradictory effects, either suppressive [39] or oncogenic [40]. [score:3]
Three miRNAs were within expression range (miR-34a, miR-185 and miR-204, Figure 2C) and two which were silenced (miR-31 and miR-184, Figure 2B) in the HAG cells. [score:3]
Tube formation activity was substantially inhibited by miR-34a and miR-185, and more mildly by miR-31 and miR-184, but not by miR-204, as compared to control (Figure 5, A–F). [score:2]
Most current studies on miR-184 and miR-204 focus on their roles in development and morphogenesis, which could be predicted computationally (Supplementary Table S1). [score:2]
Remarkably, a substantial and consistent inhibition in net proliferation was conferred by miR-31, miR-34a, miR-184 and miR-185 as compared to the control cell (Figure 4B). [score:2]
In contrast, very little is known about miR-184, miR-185 and miR-204 in cancer. [score:1]
[1 to 20 of 7 sentences]
12
[+] score: 9
Moreover, analysis of the miRNA expression profiling data and the list of target mRNAs showed that miR-100, miR-184 and miR-10a were especially expressed in human MII oocytes, while miR-29a, miR-30d, miR-21, miR-93, miR-320a, miR-125a and let7 were expressed in the human cumulus cells. [score:9]
[1 to 20 of 1 sentences]
13
[+] score: 9
Treatment days miRNAExpression change [#] Predicted mRNA target(s)Expression change [#]GD 8/11 [†] miR-1192 ↑ Atf1, Gng4, Map3k1, Rpe, Setd2, Stxbp6, Zc3h6 ↓ miR-532-5p ↑ Atf1, Itpripl2, Stxbp6 ↓GD 14/16 [*] miR-10b ↓ Aak1 ↑ miR-184 ↓ Myl9 ↑ miR-302c ↑ Ccdc6, Mfap3, Ptpro, Rnd3, Rpl36a/r, Sema3c, Stoml3, Supt3h ↓ miR-342-5p ↓ Aak1, Cables2, Rhog ↑ miR-343 ↑ Asic4, Dcn, Gpr116, Ptpro, Stoml3 ↓ miR-449b ↓ Ina ↑PD 4/7 [†] miR-26b ↑ Adam9, Chsy1, Cnr1, Exoc8, Hs6st1, Lingo1, Map3k7, Mras, Pfkfb3, Ppm1b, Rhou, Sema6d, Shank2, Tab3, Tdrd7, Ube2j1 ↓ miR-34b-5p ↓ Kitl ↑ miR-184 ↑ Ncor2, Prkcb ↓ miR-721 ↑ Akap11, B4galt, Cnr1, Efnb2, Fam20b, Ino80, Irf1, Lrrk2, Ncoa3, Pfkfb3, Ppargc1a, Rbm9, Shank2, Spen, Sphk2, Tsc1, Wdfy3 ↓ miR-1970 ↓ Arhgap6 ↑ # Significance for expression change was 1.2-fold, p < 0.05. [score:9]
[1 to 20 of 1 sentences]
14
[+] score: 8
Other miRNAs from this paper: hsa-mir-184
Interestingly, a recent study has shown that MYCN contributes to tumorigenesis, in part, by repressing miR-184, and increasing AKT2 expression, a direct target of miR-184 [22], and thereby indicating that AKT2 is a downstream target of N-myc. [score:8]
[1 to 20 of 1 sentences]
15
[+] score: 8
showed that the expression of the top four most abundant miRNAs (miR-184, miR-100, miR-9b and let-7) is stable during the crab oocyte maturation. [score:3]
Intriguingly, previous studies in the fruit fly Drosophila showed that miR-184 plays a crucial role in the female germline development. [score:2]
The top 4 most abundant miRNAs include miR-184, miR-100, miR-9b and let-7. Each of these miRNAs has more than 10,000 reads. [score:1]
The selected miRNAs include top four most abundance miRNAs (miR-184, miR-100, miR-9b and let-7) in the ovaries and two miRNAs (miR-275 and miR-252) related to oogenesis in fruit fly [13]. [score:1]
Loss of miR-184 leads to multiple severe defects during oogenesis and early embryogenesis [12]. [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 7
This confirmed differential abundance of 13/28 of these miRNAs; 11 were up-regulated (mmu-miR-126-3p, 135b-3p, 143-3p, 133b-3p, 136-5p, 126-5p, 141-5p, 145a-5p, 337-3p, 30a-5p, and 376a-3p) and 2 were down-regulated (mmu-miR-184-3p, and 1961) (Fig 1, S2 Table). [score:7]
[1 to 20 of 1 sentences]
17
[+] score: 7
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
This analysis indicated that miR-21 and miR-184, which are upregulated in idiopathic pulmonary fibrosis (IPF) [19, 20], were significantly upregulated in IR-injured mouse lung tissue (Fig 2A). [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 7
miR-31, miR-150 and miR-184 have shown to be downregulated in oxygen -induced retinopathy mice mo dels [20]; miR-23~24~27 cluster was upregulated in laser induced CNV mice mo dels [21]. [score:7]
[1 to 20 of 1 sentences]
19
[+] score: 6
Other miRNAs from this paper: dme-mir-2a-1, dme-mir-2a-2, dme-mir-14, dme-mir-184, hsa-mir-184
Experiments using miR-14 and miR-184 gave similar results (Additional file 5, Figure S5). [score:1]
Mutating miRNA nt 2 in miR-2a and miR-184 influenced the order of preference for nt 1 in flies (Figures 4B and 4C). [score:1]
Hence additional features in the miRNA/miRNA* duplex must influence the order of preference for miRNA nt 1. Mutating the overhanging nucleotide in miR-184* did not alter the efficiency of loading miR-184 (Additional file 7, Figure S7), excluding a role for base pairing between nt 1 and the 3′ overhang of the miRNA*. [score:1]
Strikingly, the order of preference for nt 1 was not the same across the three tested miRNA: miR-2a preferred U > A > C (Figure 3), miR-14 preferred U ~ C > A and miR-184 preferred U ~ A > C (Additional file 6, Figure S6). [score:1]
Changing the 5′-nt of miR-2a (C) or miR-184 (D) into 5′-guanidine (5′-G) decreases miRNA loading (relatively to a 5′-A). [score:1]
The Ago2 loading machinery has a moderate effect on miR-184 loading preferences, while it strongly affects miR-184* loading preferences. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 5
It was also shown that miR-184 can interfere with the ability of miR-205 to suppress SHIP2 level, indicating that one miRNA could abrogate the inhibitory function of another [27]. [score:5]
[1 to 20 of 1 sentences]
21
[+] score: 5
Downregulation of miR-31, miR-150, and miR-184 in ischemic retina stimulates ocular neovascularization by increasing VEGF and PDGF [32]. [score:4]
MiR-126, miR-31, miR-150, and miR-184 are involved in ischemia -induced retinal neovascularization. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 5
Expression levels of both let-7a-5p and miR-184-5p in DA neurons from young or old mice were low and remained unchanged. [score:3]
Several miRs, such as miR-133b, miR-7 and miR-153, miR-433, let-7a-5p and miR-184-5p, miR-205, miR-132 and miR-34b/c, have previously been implicated in the development and maintenance of DA neurons and were linked to neurodegeneration. [score:2]
[1 to 20 of 2 sentences]
23
[+] score: 5
Finally, miR-184 and miR-137 trigger NSC proliferation and inhibit differentiation by repressing the NSC fate-regulator Numblike [35] and the polycomb methyltransferase Ezh2 [36], respectively. [score:4]
Thus, miR-124, miR-9, and let-7b elicit NSC differentiation, while miR-184 and miR-137 increase proliferation at the expense of differentiation potential. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 5
They found that miR-320, miR-378, miR-211, miR-200a,b and miR-184 were significantly down-regulated during both stages of hibernation compared with non-hibernating animals, whereas miR-486, miR-451, miR-144 and miR-142 were significantly overexpressed in late torpor phase [22]. [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 4
For example, miR-204 is primarily expressed in insulinomas and co-localizes mainly with insulin [43]; miR-127-3p and miR-184 are positively correlated with insulin biosynthesis and negatively correlated with glucose-stimulated insulin secretion (GSIS) [44]; miR-148 controls the insulin content in β-cells through regulation of the insulin repressor SOX6 [45] and miR-29 contributes to pancreatic β-cell dysfunction in prediabetic NOD Mice [46], and affects the release of insulin from β-cells by silencing of monocarboxylate transporter (MCT1) [47]. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 4
Mutations in miR-184 cause EDICT syndrome, familial keratoconus with cataract, and sporadic keratoconus [52, 53]. [score:2]
For example, miR-96, miR-183, miR-1, and miR-133 have been implicated in retinitis pigmentosa [49], while miR-31, miR-150, and miR-184 have been associated with choroidal neovascularization [50] and diabetic retinopathy [51]. [score:1]
A single-base substitution in the seed region of miR-184 causes EDICT syndrome. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-25, hsa-mir-33a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-141, mmu-mir-155, mmu-mir-10b, mmu-mir-129-1, mmu-mir-181a-2, mmu-mir-183, hsa-mir-192, mmu-mir-200b, hsa-mir-129-1, mmu-mir-122, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-129-2, hsa-mir-184, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-96, mmu-mir-34a, mmu-mir-129-2, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-25, mmu-mir-210, mmu-mir-181a-1, mmu-mir-216a, mmu-mir-223, mmu-mir-33, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-217, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-375, mmu-mir-375, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-33b, mmu-mir-216b, hsa-mir-216b, mmu-mir-1b, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-129b, mmu-mir-216c, bbe-let-7a-1, bbe-let-7a-2, bbe-mir-10a, bbe-mir-10b, bbe-mir-10c, bbe-mir-125a, bbe-mir-125b, bbe-mir-129a, bbe-mir-129b, bbe-mir-133, bbe-mir-1, bbe-mir-183, bbe-mir-184, bbe-mir-200a, bbe-mir-200b, bbe-mir-210, bbe-mir-216, bbe-mir-217, bbe-mir-22, bbe-mir-252a, bbe-mir-252b, bbe-mir-278, bbe-mir-281, bbe-mir-33-1, bbe-mir-33-2, bbe-mir-34a, bbe-mir-34b, bbe-mir-34c, bbe-mir-34d, bbe-mir-34f, bbe-mir-375, bbe-mir-7, bbe-mir-71, bbe-mir-9, bbe-mir-96, bbe-mir-34g, bbe-mir-34h, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, miR-183, miR-184 and miR-96 dominate the population of expressed miRNAs in sensory organs in vertebrates [33], and these were also detected in amphioxus. [score:3]
However, by tracing the phylogenetic histories of miRNAs in Oikopleura dioica, Ciona intestinalis, and B. belcheri (Gray), we found that several phylogenetically conserved miRNAs were either lost or no longer recognizable in Oikopleura dioica (for example, miR-33, miR-34, miR-125, miR-133, miR-184, and miR-210), and we did not detect any miRNAs present in both chordates and vertebrates. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 3
Several differential miRNAs identified in our data, such as miR-21, miR-99b, miR-204 and miR-184, were also found in An's profiling data, implying their abundant expression in the corneal epithelium. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
Another class of miRNAs (e. g. miR-29c, miR-30d, miR-96, miR-99b, miR-124a, miR-182, miR-183, miR-184, miR-381, miR-425) also stained, in the postnatal retina, the Outer Nuclear Layer (ONL) where rod and cone photoreceptors reside (green arrows in the third column of Figure 4A; Database). [score:1]
In a limited number of cases (e. g. miR-96, miR-184), staining at P0 was extended also to the ONBL, where immature photoreceptors are found (see green arrowheads in Figure 4A). [score:1]
miR-96 and miR-184 (lower bracket; panel A) are examples of miRNAs that stain the outer nuclear layer (ONL; green arrows) and/or the photoreceptors at P8 and P60 while at P0 they are detected in the outer neuroblastic layer (ONBL; green arrowheads). [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 3
In addition to mir-34a, p53 protein promotes the expression of other miRNAs in lung cancer cells, including mir-184, mir-148, and mir-181. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
Other miRNAs from this paper: mmu-mir-200b
Takahashi Y, Chen Q, Rajala RV, Ma JX 2015 MicroRNA-184 modulates canonical Wnt signaling through the regulation of frizzled-7 expression in the retina with ischemia -induced neovascularization. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
In accordance with this hypothesis, it has been also shown that mir-184 is differentially expressed in the pancreatic islets of ob/ob mice from age 4–16 weeks (Tattikota et al., 2014). [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 3
Other miRNAs from this paper: mmu-mir-34c
Furthermore, qRT-PCR showed complete loss of miR-34c and miR-184, two miRNAs expressed specifically in spermatocytes/spermatids ([28], and H. Kaessmann, personal communication; Fig. 1C ). [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
Other miRNAs from this paper: mmu-mir-34c
Importantly we showed, by means of qRT-PCR in both GC-Dcr1 and GC-Dgcr8 P60 mutant testes, a complete loss of miR-34c and miR-184, two miRNAs expressed specifically in spermatocytes/spermatids [24], [25] (Fig. 1B ). [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 2
15, 16 Studies have also shown that miR-132, miR-184 and miR-204 are associated with corneal neovascularization. [score:1]
miR-466 and miR-184 are reported to be closely related with corneal lymphangiogenesis. [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 2
Interestingly, Numbl has recently been implicated in promoting adult neural stem cell differentiation; by acting directly on Numbl, miR-184 mitigated neuronal maturation [42]. [score:2]
[1 to 20 of 1 sentences]
37
[+] score: 2
In contrast to Hmga2, Mbd1 was reported to negatively regulate the proliferation of adult neural stem cells via the repression of Fgf2 and mir-184 transcription [37], [38]. [score:2]
[1 to 20 of 1 sentences]
38
[+] score: 2
In this study, we observed that Hmgcs2 (3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2) which encodes an enzyme exhibiting hydroxymethylglutaryl-CoA synthase activity, is potentially regulated by mmu-miR-183, mmu-miR-184, mmu-miR-150*, and mmu-miR-99b. [score:2]
[1 to 20 of 1 sentences]
39
[+] score: 2
In case of miR-184 the disparity was more significant, with corresponding log [2 ]values of approximately 9 (qPCR) versus 2 (microarray). [score:1]
In mouse, a number of miRs (for instance, miR-181a, miR-182, miR-183 and miR-184) were detected at high levels in various parts of the eye, including the lens, cornea, and retina [26, 27]. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 1
These effects were mediated by miR-184* and let-7, through the transcription factors e2f1 and dp. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
In the recent release of miRBase v18 miR-184 and miR-1196 hairpins have miRNA annotations on both arms, although these new miR*s were not derived from experimental evidence. [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
This may involve specific individual miRNAs, such as miR-133b, miR-7, miR-184-5p, miR-153, and others, which are implicated in maintaining DA neuronal homeostasis and involved in the pathogenesis of PD 40– 42. [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
In a previous study, for example, conserved miR-184 and miR-489 were initially ruled out due to the lack of miRNA* reads in sequencing data but were subsequently rescued by experimental validation [8]. [score:1]
[1 to 20 of 1 sentences]
44
[+] score: 1
Moreover, the level of miRNA-375, together with miRNA-127-3p and miR-184 is positively correlated to insulin mRNA levels in islets from human donors and the association between these miRNAs and β-cell function was deranged in islets from glucose intolerant donors [18]. [score:1]
[1 to 20 of 1 sentences]
45
[+] score: 1
Other miRNAs from this paper: mmu-mir-183, hsa-mir-183, hsa-mir-184
We determined the methylation status of the region upstream from the 5′ end of the stem-loop sequences of two miRNAs: Mir183 (ENSMUSG00000065619) and Mir184 (ENSMUSG00000065596). [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
In addition, we did not detect any activity of miR-184 and miR-375 on the 3′ UTR of Bcl2l1-1, which lacks recognition sequences for these control miRNAs (Additional file 12). [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b
Dicer1 excision in male germ cells led to reduced abundance of a subset of miRNAs (miR-34c and miR-184) and significantly increased transcript levels of SINE B1 and B2 transposable elements [16]. [score:1]
[1 to 20 of 1 sentences]