sort by

228 publications mentioning mmu-mir-34c (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-34c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 310
0033861.g004 Figure 4(A) Overexpression and inhibition efficiency of miR-34c mimics or inhibitor, transfected into GC-2 cells after 24 h. Non -treated: no transfection control; mi-NC or in-NC: mimics NC or inhibitor NC transfection with Lipofectamine 2000 as a strict control; mimics 1: 20 nM mimics as a final transfection concentration; mimics 2: 30 nM as a final transfection concentration; inhibitor 1 and inhibitor 2: similar to mimics, 20 nM and 30 nM inhibitor were transfected respectively. [score:15]
Furthermore, the transient transfection of the miR-34c inhibitor resulted in a resistance to flutamide induced germ cell apoptosis in vivo, with an up-regulation of Bcl-2 and a down-regulation of Bax, confirming the pro-apoptotic activity of miR-34c. [score:9]
By transfecting cells, we found that excess expression of miR-34c promotes GC-2 cell apoptosis with an up-regulation of Bax and a down-regulation of Bcl-2 in vitro. [score:9]
Furthermore, ectopic expression of miR-34c reduces ATF1 protein expression without affecting ATF1 mRNA level via directly binding to ATF1's 3′UTR, indicating that ATF1 is one of miR-34c's target genes. [score:8]
In addition, ATF1 protein expression level is specifically upregulated by silencing miR-34c at 16 dpp testes in vivo as well as on GC-2 cells in vitro, but does not have an effect on mRNA expression. [score:8]
The results showed that the local miR-34c inhibition significantly increased Bcl-2 expression and decreased Bax expression (Fig. 2C), which resulted in the rise of the Bcl-2/Bax ratio (Fig. 2D). [score:7]
In order to confirm that the miR-34c targeting of ATF1 affects germ cell apoptosis, siRNA molecules of ATF1 were designed to inhibit ATF1 expression. [score:7]
Non -transfected: no injection testis; in-NC: inhibitor NC transfection with Lipofectamine 2000 testis as a negative control; inhibitor: miR-34c inhibitor transfection with Lipofectamine 2000 testis. [score:7]
In contrast, miR-34c inhibition resulted in a reduced GC-2 cells spontaneous apoptosis rate, with an increased expression of Bcl-2 and a decreased expression of Bax. [score:7]
Ectopic expression of miR-34c in several cell lines resulted in up-regulation of germ cell-specific genes [18]. [score:6]
MiR-34c represses luciferase reporter gene expression by targeting the 3′-UTR binding site of ATF1 in vitro, suggesting a direct interaction between miR-34c and 3′-UTR of ATF1. [score:6]
In this study, we find that inhibition of miR-34c prevents murine male germ cell apoptosis through targeting ATF1. [score:5]
The real-time PCR results showed that testis miR-34c was expressed at very low levels from E13.5 to 12 dpp, after which testis miR-34c expression levels sharply increased and persisted until the adult mouse (Fig. 1A). [score:5]
Similar to the in vivo experiment results, miR-34c over -expression promoted cell apoptosis (Fig. 4D–E), whereas miR-34c inhibition resulted in the resistance to cell apoptosis. [score:5]
The efficiencies of miR-34c over -expression and inhibition were 30∼80 fold and 25%∼40% respectively, for different doses of transfection as analyzed by real-time PCR (Fig. 4A). [score:5]
Moreover, ectopic expression of the miR-34c in GC-2 cell trigger the cell apoptosis with a decreased Bcl-2/Bax ratio and miR-34c inhibition lead to a low spontaneous apoptotic ratio and an increased Bcl-2/Bax ratio. [score:5]
These suggest that miR-34c directly regulates ATF1 protein expression through its binding to the ATF1-3′UTR region. [score:5]
In order to identify the function of miR-34c in germ cells, we initially inhibited miR-34c by transfecting a miR-34c inhibitor, which was injected into the seminiferous tubule of 14 dpp testis. [score:5]
The effects of miR-34c inhibition on Fas, Bcl-2, Bax mRNA expressions and Bcl-2/Bax ratio. [score:5]
Most miRNAs exhibit a tissue-specific expression pattern, and recent studies have reported that miR-34c is preferentially expressed in the mouse testis [18], [19], [20], [21]. [score:5]
The following oligos were used to cell transfection: inhibitor NC (in-NC) (5′CAGUACUUUUGUGUAGUACAA3′); miR-34c inhibitor (5′GCAAUCAGCUAACUACACUGCCU3′); miR-34c mimics (Forward: 5′AGGCAGUGUAGUUAGCUGAUUGC3′ Reverse: 5′AAUCAGCUAACUACACUGCCUUU3′); stable negative control (s-NC) (Forward: 5′UUCUCCGAACGUGUCACGUTT3′ Reverse: 5′ACGUGACACGUUCGGAGAATT3′); ATF1 siRNA (Forward: 5′GACCUCUCUUCUGAAGAUAdTdT3′ Reverse: 5′UAUCUUCAGAAGAGAGGUCdTdT3′) For TUNEL analysis, the testes were fixed in 10% formaldehyde and paraffin embedded. [score:5]
However, miR-34c does not affect the expression of Fas in both in vivo and in vitro studies, which indicates that miR-34c may regulate germ cell apoptosis through the intrinsic pathway. [score:4]
In conclusion, the present study suggests that miR-34c regulates germ cell viability in mouse testis through targeting ATF1. [score:4]
MiR-34c began to be expressed from 14 dpp, in which germ cells have just developed to the pachytene stage [35], [36], and it was continuously expressed during the entire germline differentiation. [score:4]
Our study shows for the first time that miR-34c functions, at least partially, by targeting the ATF1 gene in germ cell apoptosis, providing a novel mechanism with involvement of miRNA in the regulation of germ cell apoptosis. [score:4]
Inhibition of miR-34c does not decrease the GC-2 cell apoptosis ratio in ATF1 knockdown cells. [score:4]
These results indicate that ATF1 may be key in regulating miR-34c's effect on the expressions of Bcl-2 and Bax. [score:4]
After 24 h treatment with 10 mg/kg, flutamide, the miR-34c knockdown was carried out by injecting the miR-34c inhibitor. [score:4]
Here we demonstrated that ATF1 is a direct target gene of miR-34c. [score:4]
It is well documented that in many cancer cells miR-34c is a pro-apoptotic gene that is regulated by the tumor suppressor protein p53 and is frequently observed to be epigenetically silenced in cancers [11], [37], [38]. [score:4]
We conducted a detailed study of miR-34c expression in the course of testicular development using real-time PCR and in situ hybridization. [score:4]
ATF1 is a direct target of miR-34c. [score:4]
We have for the first time demonstrated that miR-34c mediates posttranscriptional regulation of ATF1 expression to control germ cell viability through an intrinsic pathway of apoptosis. [score:4]
MiR-34c regulates Bcl-2/Bax ratio and germ cell apoptosis by targeting ATF1. [score:3]
We thus measured the effects of miR-34c inhibition on these apoptosis related genes expression. [score:3]
To further confirm the pro-apoptotic effect of miR-34c on spermatocytes apoptosis, we transfected miR-34c mimics and inhibitors into the GC-2 cell line. [score:3]
2′-Ome-miR-34c-5p inhibitor or control 2′-Ome-NC oligo (GenePharma Co. [score:3]
Bcl-2/Bax ratio decreased after treatment with miR-34c mimics, whereas the Bcl-2/Bax ratio increased once miR-34c was inhibited (Fig. 4C). [score:3]
The high expression of miR-34c in pachytene spermatocytes and round spermatids may be responsible for the determination of hormone -dependent survival of germ cells in testis. [score:3]
In the present study, we have also developed an effective method to transfect the miR-34c inhibitor to spermatocytes in pubescent mouse testis. [score:3]
In the present study, we show that miR-34c is detected in mouse pachytene spermatocytes and continues to be highly expressed in spermatids. [score:3]
In order to identify the functions of miR-34c in the mouse testis, we initially examined miR-34c expression in the developing testis by real-time PCR and in situ hybridization (ISH). [score:3]
MiR-34c binds to ATF1-3′UTR which regulates its protein expression. [score:3]
The fact that miR-34c is not expressed in Sertoli cells and Leydig cells, indicates that miR-34c may play an important role in male spermatogenesis. [score:3]
Further, ATF1 mRNA and protein levels were analyzed by real-time PCR and after miR-34c inhibition in vivo. [score:3]
ATF1 protein level was significantly increased after miR-34c inhibition (Fig. 5E). [score:3]
It is worth mentioning that transfecting double stranded small RNAs such as siRNA or miR-34c mimics, which exhibit a higher toxicity, lead to germ cell apoptosis in vivo 24 hours later than single-stranded small RNAs, such as the miR-34c inhibitors, when using the same amount of substance (50 pmol/µl). [score:3]
Moreover, we obtained similar results when we transfected miR-34c mimics or inhibitors to GC-2 cells in vitro. [score:3]
Due to the relatively high toxicity of the short double-stranded siRNAs in the preliminary experiment in vivo, we did not analyze the ectopic expression of miR-34c and ATF1 siRNA in the testis mo del. [score:3]
We then localized miR-34c expression in the developing testis by using a digoxingenin-labeled locked nucleic acid (LNA) probe during 12 dpp, 14 dpp, 16 dpp and in the adult mouse testis. [score:3]
We choose mouse testis of 14 dpp when miR-34c's expression begin to rise as the injection time of transfection in vivo. [score:3]
In order to study the mechanism of miR-34c influencing spermatocytes apoptosis, we computationally predicted that ATF1 was the candidate of miR-34c targeting genes from www. [score:3]
To explore the specific functions of miR-34c, we have established an in vivo mo del by transfecting miR-34c inhibitors into primary spermatocytes to study the loss-of-function of miR-34c. [score:3]
Transfections of ATF1 siRNA and miR-34c inhibitor or mimics (Shanghai GenePharma Co. [score:3]
Here we use lipofection to deliver small molecules, such as the inhibitor of miR-34c. [score:3]
MiR-34c expression is dynamic in immature and adult mouse testes. [score:2]
These results show for the first time that the pro-apoptotic activity of miR-34c in mediating apoptosis was conducted by regulating the Bcl-2/Bax ratio in the male reproductive system. [score:2]
MiR-34c inhibitor transfection in vivo via injection into seminiferous tubules. [score:2]
The TUNEL -positive cells were observed in the seminiferous tubule (Fig. 3A), and in the flutamide treated groups, apoptotic spermatocytes in the miR-34c knockdown testis were much fewer than that in the non -transfected control or in the in-NC control group. [score:2]
MiR-34c is a highly conserved miRNA that is abundantly expressed in mature testis as compared to immature testis, in primates and rodents [19], [34]. [score:2]
MiR-34c inhibitor transfection in vivo via injection into seminiferous tubules D14 male mice were anesthetized using Sodium Pentobarbital (8 µl of 0.5% solution/g bodyweight) injected intraperitoneally, and the testis was exposed under the dissecting stereomicroscope. [score:2]
MiR-34c inhibition showed a remarkable increasing protein level of ATF1, although the ATF1 mRNA level did not change (Fig. 5F). [score:2]
These results give us important reminding that both miR-34c and ATF1 may be involved in regulating germ cell apoptosis. [score:2]
The current study reveals that miR-34c regulates germ cell apoptosis in the murine testis. [score:2]
In the flutamide treated groups, miR-34c knock-down testes had roughly two thirds less apoptotic cells than that in the controls (Fig. 3B). [score:2]
MiR-34c Expression in the developing mouse testis. [score:2]
These data indicate that the miR-34c knock-down enhances the resistance of germ cell apoptosis induced by flutamide. [score:2]
The first five pictures are 12 dpp-adult ISH of miR-34c and a scrambled probe control (sc-adult). [score:1]
, Ltd, China) with a mixture containing 200 ng/ml of the dual-luciferase reporter plasmid and 40 nM miR-34c mimics. [score:1]
However, the specific function of miR-34c in germ cell is not yet clear. [score:1]
Each reporter construct was separately co -transfected into 293T cells with the miR-34c mimicking molecules. [score:1]
In the adult mouse testis, the hybridization signal for miR-34c was detected in pachytene spermatocytes and round spermatids. [score:1]
The specific function of miR-34c in germline differentiation aroused our interest. [score:1]
MiR-34c knock-down enhances resistance to cell apoptosis in vivo. [score:1]
MiR-34c expression assay were based on the method described by Chen C. et al [55]. [score:1]
Compared to the negative control (24∼28%), silencing miR-34c reduced the GC-2 cell apoptosis ratio (∼18.3%) and the knockdown of ATF1 increased the ratio (∼44.82%) (Fig. 6D–E). [score:1]
However, in mouse testis, miR-34c is p53 independent [18]. [score:1]
A number of studies have shown that miR-34c is implicated in the control of the cell cycle, senescence, and apoptosis [8], [9], [10], [11], [12], [13], [14], [15], [16], [17]. [score:1]
The current report unveils the pro-apoptotic activity of miR-34c in male mouse reproductive system. [score:1]
ATF1 3′UTR has a miR-34c binding sequence. [score:1]
Silencing of miR-34c resulted in resistance to flutamide induced germ cell apoptosis. [score:1]
MiR-34c over -expression resulted in a sharp increasing of Bax mRNA level compared to the nonsense control. [score:1]
To confirm the pro-apoptotic effect of miR-34c in the mouse testis, we used an animal mo del as reported by Mauduit et al [31] to induce apoptosis by intraperitoneal injection of flutamide, an antagonist of androgen. [score:1]
Conversely, the silencing of miR-34c led to high levels of Bcl-2 (Fig. 4B). [score:1]
The miR-34c ISH signal was not detected from E13.5 to 12 dpp (data not shown). [score:1]
To measure the inhibiting efficiency, the testes (n≥6) were collected and miR-34c levels were detected by real-time PCR at 48 hours (16 dpp) after transfection. [score:1]
The ATF1-3′UTR sequences containing the miR-34c binding site were constructed into a psi-CHECK 2 vector. [score:1]
0033861.g001 Figure 1(A) Real-time PCR for miR-34c. [score:1]
These findings suggest that miR-34c could enhance germ cell apoptosis via the intrinsic pathway of cell apoptosis. [score:1]
0033861.g005 Figure 5(A) The predicted miR-34c binding site in ATF1-3′UTR from www. [score:1]
We labeled the LNA probes with digoxingenin using a DIG oligonucleotide tailing kit (Roche) following the manufacturer's instructions, and the testis miR-34c ISH was performed as described by Song R. et al [54]. [score:1]
Hsa-miR-34c-5p miRCURY LNA microRNA detection probes and scrambled probes were purchased from Exiqon (Prod. [score:1]
The ISH signal for miR-34c initially appeared in pachytene spermatocytes at 14 dpp (Fig. 1B). [score:1]
The PCR product was confirmed to be miR-34c by sequencing. [score:1]
The results show that silencing of miR-34c significantly increases the Bcl-2/Bax ratio and prevents germ cell from apoptosis induced by deprivation of testosterone. [score:1]
These findings specifically show the pro-apoptotic activity of miR-34c in mouse testis. [score:1]
The miR-34c-ATF1 pathway is critical to the apoptosis of spermatocytes. [score:1]
Effects of miR-34c on GC-2 cell apoptosis. [score:1]
In addition, ATF1 siRNA and miR-34c were co -transfected into GC-2 cells. [score:1]
However, Fas, acting as a signing molecule related to apoptosis, did not change after silencing miR-34c. [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 310
The full-length blot images are presented in Supplementary Figure  3. Reciprocal regulation between Notch1 and miR-34cAs overexpressing N1ICD decreases miR-34c expression during PSCs development (Fig.   1) and miR-34c mimics decreases Notch1 gene expression in the proliferation period (Fig.   2), differentiation day 1and differentiation day 7 (Fig.   4), these results suggest a regulatory feedback may exist between Notch1 and miR-34c. [score:10]
The full-length blot images are presented in Supplementary Figure  3. As overexpressing N1ICD decreases miR-34c expression during PSCs development (Fig.   1) and miR-34c mimics decreases Notch1 gene expression in the proliferation period (Fig.   2), differentiation day 1and differentiation day 7 (Fig.   4), these results suggest a regulatory feedback may exist between Notch1 and miR-34c. [score:9]
Since our in vitro study has shown that overexpressing miR-34 inhibits muscle development, we believe the miR-34c overexpression experiment alone would be sufficient to demonstrate the role of miR-34c in vivo. [score:8]
Overexpressing N1ICD decreases miR-34c expression in vitroTo explore the regulations of Notch1 signaling in PSCs development, we constructed the constitutively activated N1ICD PSCs. [score:7]
Our study ascertains that miR-34c inhibits PSCs proliferation by inhibiting Notch1 expression. [score:7]
These results demonstrate we have successfully overexpressed N1ICD in PSCs and N1ICD decreased miR-34c expression in all three periods of PSCs development. [score:6]
Figure 1Overexpressing N1ICD decreases miR-34c expression during PSCs development. [score:6]
But miR-34c inhibitor had no effect on Myod gene expression on differentiation day 7 (Fig.   5D and E). [score:5]
Figure 2Overexpressing miR-34c mimics inhibits PSCs proliferation. [score:5]
The full-length blot images are presented in Supplementary Figure  3. Next, miR-34c inhibitor or Control (miR-34c inhibitor and Control are both synthetic oligonucleotide sequences; see Table  S1 for details) was transfected into PSCs, and the cells were induced to differentiation for 1 day and 7 days. [score:5]
Overexpressing miR-34c inhibits PSCs proliferation in vitro. [score:5]
Our results not only established Notch1 is the target gene of miR-34c but also discovered that Notch1, in turn, directly regulates miR-34c in PSCs. [score:5]
Figure 3Overexpressing miR-34c inhibitor increase PSCs proliferation. [score:5]
But miR-34c inhibited the skeletal muscle satellite cell proliferation by targeting Notch1, and miR-34c reduced the number of satellite cells to be fused to existing myofibers, resulting in smaller muscle fiber diameter after miR-34c injection. [score:5]
In this study, we used miR-34c mimics and inhibitor to manipulate the miR-34c level in transfected PSCs and that elevated miR-34c not only inhibits PSCs proliferation but also promotes PSCs differentiation. [score:5]
The full-length blot images are presented in Supplementary Figure  3. Next, miR-34c inhibitor or Control (miR-34c inhibitor and Control are both synthetic oligonucleotide sequences; see Table  S1 for details) was transfected into PSCs, and the cells were induced to differentiation for 1 day and 7 days. [score:5]
Figure 5Overexpressing miR-34c inhibitor reduces PSCs differentiation. [score:5]
The expression of miR-34c was decreased in the N1ICD overexpressed cells (p < 0.01; Fig.   1C). [score:5]
From the RNA-seq data, we discovered that many miRNAs were differently expressed in the N1ICD overexpressing PSCs, including miR-34c [29]. [score:5]
Since N1ICD expression was decreased after PSCs transfected with miR-34c mimics (Figs  2 C and 4B), Notch1 may be a potential target gene of miR-34c. [score:5]
Overexpressing N1ICD decreases miR-34c expression in vitro. [score:5]
For all the experimental data in this study, including miR-34c inhibiting PSCs proliferation, miR-34c promoting PSCs differentiation and miR-34c repressing mice muscle development, we are comparing only the control group to the treatment group; thus we used the student’s t-test for the statistical analyses (SPSS 18.0, Chicago, IL, USA). [score:4]
In conclusion, our research demonstrates that miR-34c inhibits PSCs proliferation but promotes PSCs differentiation in vitro, and miR-34c represses pig muscle development in vivo. [score:4]
These results suggest that Notch1 is the direct target gene of miR-34c. [score:4]
However, there is no report regarding the role of miR-34c on PSCs development; therefore, the objective of this study was to define the role of miR-34c on PSCs development and ascertain whether there is a regulatory relationship between miR-34c and N1ICD. [score:4]
This reciprocal regulatory loop formed by miR-34c and Notch1 that controls skeletal muscle development is novel, and this information expands our understanding of the mechanisms involved in muscle development. [score:4]
To establish N1ICD regulates miR-34c expression, N1ICD was transfected into PSCs in primary culture. [score:4]
Furthermore, the objective of this particular experiment was to ascertain whether the miR-34c inhibits muscle development in vivo. [score:4]
Taken together, these results demonstrate miR-34c inhibits PSCs proliferation in vitro. [score:3]
Another miR-34 family member miR-34c also has been shown to inhibit rat vascular smooth muscle cell proliferation [27]. [score:3]
This study would be better to have the miR-34c inhibitor group in the in vivo study. [score:3]
PSCs transfected with pCDNA3.1- N1ICD, miR-34c inhibitor, miR-34c mimics or Control by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. [score:3]
We have also established Notch1 is a direct target gene of miR-34c using a dual-luciferase reporter assay. [score:3]
These results demonstrate there exists a regulatory loop between Notch1 and miR-34c in PSCs development. [score:3]
However, after considerable deliberations, we decided to forgo the miR-34c inhibitor group for the following reason: the mice used in this study are 4-week-old. [score:3]
Representative images of immunofluorescent staining of PSCs transfected with miR-34c inhibitor. [score:3]
The mRNA level of myogenin, myosin, and MyHC was elevated by the miR-34c overexpression on differentiation day 7 (p < 0.01, Fig.   4C), and protein level of myogenin and myosin follows the same pattern as the mRNA (p < 0.05, Fig.   4D). [score:3]
PSCs transfected with miR-34c mimics, miR-34c inhibitor or Control and maintained in growth medium. [score:3]
However, on differentiation day 7, overexpression of miR-34c showed no significant influence on MyoD mRNA and protein levels (Fig.   4C and D). [score:3]
Figure 4Overexpressing miR-34c mimics promotes PSCs differentiation. [score:3]
The full-length blot images are presented in Supplementary Figure  2. Next, we used miR-34c inhibitor to further ascertain the role of miR-34c on PSCs proliferation. [score:3]
Therefore, injection of LV-miR-34c inhibitor may not obtain additional muscle growth; thus, the value of using more mice may be questionable following the principle of a minimal number of animals to be used in any experiments. [score:3]
Overexpressing miR-34c reduced the percentage of Edu positive cells (p < 0.05, Fig.   2A). [score:3]
The full-length blot images are presented in Supplementary Figure  2. Next, we used miR-34c inhibitor to further ascertain the role of miR-34c on PSCs proliferation. [score:3]
MiR-34c inhibitor reduced the endogenous miR-34c level (Fig.   3B). [score:3]
But miR-34c inhibitor had no effect (p > 0.05) on myogenin and MyHC mRNA level on differentiation day 1 (Fig.   5A). [score:3]
Overexpression of miR-34c reduced Notch1 mRNA, and elevated MyoD mRNA and myosin mRNA on differentiation day 1 (p < 0.05, Fig.   4A). [score:3]
PSCs transfected with miR-34c inhibitor increased the mRNA and protein levels of N1ICD on both differentiation day 1 and day 7 (Fig.   5). [score:3]
On differentiation day 7, western blot result shown miR-34c inhibitor decreased (p < 0.05) myogenin and myosin protein levels. [score:3]
The full-length blot images are presented in Supplementary Figure  1. Overexpressing miR-34c inhibits PSCs proliferation in vitroFirst, we investigated the role of miR-34 in PSCs proliferation. [score:3]
After transfected with miR-34c inhibitor, the mRNA level of Notch1, CCNB, CCND and CCNE and PCNA were increased and p21 was decreased (p < 0.05, Fig.   3B). [score:3]
As for protein level of these genes, western blot result showed overexpression of miR-34c reduced Notch1, and elevated MyoD and myogenin on differentiation day 1 (p < 0.05, Fig.   4B). [score:3]
On differentiation day 1, western blot result shown miR-34c inhibitor decreased (p < 0.05) MyoD and myosin protein levels, but had no effect on myogenin (Fig.   5B). [score:3]
Overexpressing miR-34c promotes PSCs differentiation. [score:3]
We injected miR-34c into the gastrocnemius muscle of the mice to establish the changes in muscle growth and gene expressions. [score:3]
We measured the expression of Notch1 and the myogenic marker genes after PSCs were transfected with miR-34c inhibitor. [score:3]
Finally, through miR-34c lentivirus injection into mice gastrocnemius muscle, we confirmed miR-34c represses mice muscle development. [score:2]
Using, we showed that CSL-N1ICD complex binds directly to the −3631~−3625 sites of miR-34c. [score:2]
As the miR-34c level is reduced when N1ICD was overexpressed during PSCs development (Fig.   1A) and a CSL-N1ICD complex binding site (GTGGGAA) exists at upstream of the miR-34c genomic site (Fig.   6C), we measured the DNA fragment binding with CSL-N1ICD complex by ChIP. [score:2]
MiR-34c mimics and inhibitor were (see Table  S1) purchased from GENEWIZ (Suzhou, China). [score:2]
But, the role of miR-34 plays in pig skeletal muscle development has not been reported. [score:2]
These findings establish there exists a regulatory loop between Notch1 and miR-34c. [score:2]
These results demonstrate that injecting LV-miR-34c miR-34c represses muscle development in vivo. [score:2]
MiR-34c inhibitor decreased MyoD and myosin mRNA level on differentiation day 1 (p < 0.05, Fig.   5A). [score:2]
Through the dual-luciferase reporter assay, we found N1ICD decreased the pGL3-basic-miR-34 upstream recombinant vector relative luciferase activity, but this inhibition was abolished by the mutated CSL-N1ICD complex binding site (GTGGGAA) (Fig.   6F). [score:2]
Reciprocal regulation between Notch1 and miR-34c. [score:2]
Consistent with this result is the average area of myofibers decreased (p < 0.01, Fig.   7C), which means miR-34c repressed muscle development in vivo. [score:2]
This result indicates CSL-N1ICD complex may regulate miR-34c transcription. [score:2]
In our study, we used Edu assay to confirm miR-34c inhibits PSCs proliferation, and our qRT-PCR and western blot results show miR-34c is positively correlated with p21, and negatively correlated with CCNB, CCND, and CCNE. [score:2]
Thus the presence of virus affected muscle development, which explains the gastrocnemius muscle weight of the injected virus groups (LV-Control and LV-miR-34c) was lower than that of the Normal group. [score:2]
MiR-34c has been shown to be a new modulator of VSMC proliferation through targeting SCF [27]. [score:2]
MiR-34c inhibitor increased the percentage of Edu positive cells (p < 0.01, Fig.   3A). [score:2]
The CSL-N1ICD complex binds directly to the -3631~-3625 sites of miR-34c. [score:2]
MiR-34c represses muscle development in vivoTo evaluate the function of miR-34c in vivo, we injected lentivirus expressing miR-34c mimics or Control into mice gastrocnemius muscle. [score:2]
To our knowledge, there is no report about the miR-34c function on skeletal muscle development. [score:2]
MiR-34c inhibitor decreased (p < 0.05) myogenin, myosin and MyHC genes mRNA level on differentiation day 7 (Fig.   5D). [score:2]
In human, three miR-34 precursors are produced from two transcriptional units, miR-34a precursor is transcribed from chromosome 1, and miR-34b and miR-34c precursors are co-transcribed from a region on chromosome 11 [23]. [score:1]
The miR-34 family members (miR-34a, miR-34b, and miR-34c) were discovered computationally [20] and later verified by experiment 21, 22. [score:1]
Either pGL3-basic-miR-34c upstream-mut or pGL3-control was used as a control for pGL3-basic-miR-34c upstream. [score:1]
But only miR-34a and miR-34c are found in pig 24, 25. [score:1]
Thus, to ascertain the miR-34c function observed in our cell culture studies, we conducted the in vivo study in mice. [score:1]
To evaluate the function of miR-34c in vivo, we injected lentivirus expressing miR-34c mimics or Control into mice gastrocnemius muscle. [score:1]
We found relative luciferase activity was decreased (p < 0.01; Fig.   6B) when HEK-293T cells were co -transfected with miR-34c mimics and pmirGLO- Notch1-3′UTR. [score:1]
Mice were purchased from Guangdong Medical Lab Animal Center, and lentivirus containing miR-34c mimics or Control were purchased from Shanghai JiKai Gene Chemical Technology Co. [score:1]
MiR-34c or microRNA-control was delivered by a lentiviral vector (LV). [score:1]
We measured the expression of Notch1 and the myogenic marker genes after PSCs were transfected with miR-34c mimics. [score:1]
As shown in Fig.   6E the miR-34 upstream of its genomic site (about 4600 bp) is inserted into the pGL3-basic vector. [score:1]
Body weights were no difference among all groups, but the weights of gastrocnemius muscle were decreased in the LV-miR-34c treatment group and Normal groups (p < 0.05, Fig.   7D). [score:1]
*Indicates a difference between Control and miR-34c mimics. [score:1]
However, miR-34c mimics had no effect on CCNB mRNA and protein levels (Fig.   2B and C). [score:1]
Western blot confirmed that miR-34c mimics reduced (p < 0.05) Notch1, CCND and CCNE protein level, and increased (p < 0.01) p21 protein level (Fig.   2C). [score:1]
So we constructed the pGL3-basic-miR-34 upstream recombinant vector (pGL3-basic-miR-34 upstream). [score:1]
The miR-34c mimics decreased Notch1, CCND, CCNE and PCNA mRNA levels and increased p21 mRNA level (p < 0.05, Fig.   2B). [score:1]
A ~4600 bp sequence upstream of miR-34c in genomic DNA was amplified and inserted into pGL3-basic Vector (Ambion, Carlsbad, CA, USA). [score:1]
qRT-PCR result showed miR-34c mimics increased (p < 0.001) cellular miR-34c level at 24 h after transfection (Fig.   2B). [score:1]
Figure 6Negative feedback between miR-34c and Notch1. [score:1]
Total fibers in one field were increased after injection with LV-miR-34c. [score:1]
CCND1 mRNA level was decreased after LV-miR-34c injection, but mRNA levels of CCNB1 and p21 were increased (p < 0.05, Fig.   7E). [score:1]
MiR-34c represses muscle development in vivo. [score:1]
After injecting LV-miR-34c, MyoD protein level was decreased (Fig.   7F) and myogenin protein level was increased (Fig.   7F), but their mRNA levels were not different (Fig.   7E). [score:1]
Mice were injected with physiological saline, LV-Control or LV-miR-34c. [score:1]
Both miR-34c mimics and Control are synthetic oligonucleotide sequences delivered by the lentiviral vector. [score:1]
N1ICD with pGL3-basic-miR-34 upstream recombinant vector relative or pGL3-basic-miR-34 upstream (mut) recombinant vector were transfected into HEK-293T cells respectively. [score:1]
Notch1 mRNA level was decreased in the LV-miR-34c injection group (p < 0.05, Fig.   7F). [score:1]
Using dual-luciferase reporter assay and Chromatin immunoprecipitation (ChIP), we demonstrated there is a regulatory loop between Notch1 and miR-34c. [score:1]
These results indicate elevated miR-34c promotes PSCs differentiation. [score:1]
A fragment about 400 bp long located at -3631 upstream of miR-34c was amplified (Fig.   6D). [score:1]
LV-miR-34c injection also increased myosin mRNA level (p < 0.05, Fig.   7E). [score:1]
Lanes 1–7 represent DL 10000, pGL3-basic, double digested pGL3-basic, double digested miR-34 upstream of its genomic site, pGL3-basic-miR-34 upstream recombinant vector, double digested pGL3-basic-miR-34 upstream recombinant vector, DL5000, respectively. [score:1]
The full-length blot images are presented in Supplementary Figure  2. The medium was changed to differentiation medium for 1 and 7 days to study the function of miR-34c on PSCs differentiation. [score:1]
In Fig.   6D *Indicates differences between Normal and LV-Control or Normal and LV-miR-34c in mice gastrocnemius muscle. [score:1]
[1 to 20 of 111 sentences]
3
[+] score: 272
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-34a, mmu-mir-541
Figure 4 miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expression(A) TGIF2 mRNA expression of tumor tissues in each group nude mice by qRT-PCR; (B) TGIF2 protein expression of tumor tissues in each group nude mice by; (C) tumor volume of nude mice in each group; (D) apoptosis of tumor tissues in each group nude mice by flow cytometry; (E) caspase-3 expression by immunohistochemistry. [score:14]
They also suggested that up-regulation of miR-34 could play an inhibitory effect on gastric tumor metastasis and invasion by targetly suppression the expression of TGIF2. [score:12]
In addition, we further observed that TGIF2 was the target gene of miR-34, and the effect of miR-34 on inhibiting growth and promoting apoptosis of osteosarcoma was through targetly regulating TGIF2 expression. [score:10]
Figure 3 miR-34 regulated TGIF2 expression targetly(A) TGIF2 protein expression of tumor tissues in each group nude mice by; (B) TGIF2 positive cells proportion of tumor tissues in each group nude mice by immunofluorescence; (C) prediction of binding sites between TGIF2 and miR-34 by TargetScan; (D) dual luciferase reporter assay. [score:9]
The results also revealed that the mechanism of miR-34 inhibiting growth and promoting apoptosis of osteosarcoma in nude mice was through targetly regulating the expression of TGIF2. [score:8]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expression. [score:8]
All the above results indicated that miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expression. [score:8]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expressionFurther studies were conducted to investigate the mechanism of miR-34 in inhibiting growth and promoting apoptosis of osteosarcoma in nude mice. [score:8]
More importantly, miR-34 inhibited growth and promoted apoptosis of osteosarcoma through targetly regulating the expression of TGIF2. [score:8]
In this research, we also found a similar mechanism that miR-34 could inhibit growth and promoting apoptosis of osteosarcoma by targetly regulating the expression of TGIF2. [score:8]
miR-34 regulated TGIF2 expression targetlyAccording to, TGIF2 protein relative expression of tumor tissues of nude mice in miR-34 mimics group was dramatically lower than that in blank group and NC group (P<0.05) (Figure 3A). [score:8]
Figure 2 miR-34 inhibited osteosarcoma growth and promoted its apoptosis in nude mice(A) miR-34 expression of tumor tissues in each group nude mice by qRT-PCR; (B) tumor volume of nude mice in each group; (C) apoptosis of tumor tissues in each group nude mice by flow cytometry; (D) caspase-3 expression by immunohistochemistry. [score:7]
Figure 1 miR-34 expression by qRT-PCR(A) miR-34 expression in tumor tissues and non-tumor tissues of patients with osteosarcoma by qRT-PCR; (B) miR-34 expression in hFOB 1.19 cells and MG-63 cells by qRT-PCR. [score:7]
Above results suggested that up-regulation of miR-34 inhibited osteosarcoma growth and promoted its apoptosis in nude mice. [score:6]
Down-regulation of miR-34 in osteosarcoma tissues and cells miR-34 expression in tumor tissues and non-tumor tissues of patients with osteosarcoma was determined by qRT-PCR. [score:6]
The results illustrated that the expression of miR-34 in osteosarcoma tumor tissues was dramatically down-regulated. [score:6]
They also found that decreased non-small-cell lung cancer cell migration and invasion could be achieved by miR-34 overexpression or by down-regulation of PDGFR-α/β. [score:6]
Based on this, their further research identified the relationship between miR-34 and PDGFR-α/β that PDGFR-α/β was targetly regulated by miR-34, which provided a therapeutic target for the treatment of non-small-cell lung cancer. [score:6]
Up-regulation of miR-34 expression was successfully achieved by transfection. [score:6]
miR-34 regulated TGIF2 expression targetly. [score:6]
Tang et al. [10] revealed that miR-34 was a tumor suppressor gene, which could inhibit the development of human pancreatic cancer. [score:6]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude miceAmongst blank group, NC group, and miR-34 mimics group, miR-34 relative expression in miR-34 mimics group was obviously higher than that in the other two groups (P<0.05). [score:5]
However, dramatically lower luciferase activity was presented in WT + mimics group compared with that in WT + NC group (P<0.05) (Figure 3D), which indicated that miR-34 could targetly regulate TGIF2 expression. [score:5]
Chamani et al. [8] thought that miR-34 was one of the tumor suppressor miRNAs, which was expressed in majority of normal tissues. [score:5]
Target Scan was used to predict the targetted relationship between miR-34 and TGIF2, and 3′-UTR was the binding site of miR-34 and TGIF2. [score:5]
Down-regulation of miR-34 in osteosarcoma tissues and cells. [score:4]
Cheng et al. [11] demonstrated in their research that miR-34 could co-operate with p53 in suppression of prostate cancer by joint regulation of stem cell compartment. [score:4]
Our results were consistent with these previous studies that miR-34 was down-regulated in osteosarcoma tissues and cells. [score:4]
Garofalo et al. [26] researched that miR-34 was down-regulated in lung tumors. [score:4]
In conclusion, this article researched the effect of miR-34 on osteosarcoma and the results showed that miR-34 was down-regulated in osteosarcoma. [score:4]
They were used to transfect MG-63 cells, respectively and co-transfection was also conducted by using miR-34 mimics and TGIF2 expression vector. [score:3]
According to, TGIF2 protein relative expression of tumor tissues of nude mice in miR-34 mimics group was dramatically lower than that in blank group and NC group (P<0.05) (Figure 3A). [score:3]
miR-34 mimics (sense: CAAUCACUAACUCCACUGCCAU; antisense: GGCAGUGGAGUUAGUGAUUGUU), miR-34 negtive control (sense: UUCUCCGAACGUGUCACGUTT; antisense: ACGUGACACGUUCGGAGAATT) [14], as well as TGIF2 expression vector, were purchased from RiboBio, Guangzhou, China. [score:3]
miR-34 was reported to be declined in a variety of tumors, which was recommended as a tumor suppressor miRNA [23–25]. [score:3]
miR-34 expression in tumor tissues and non-tumor tissues of patients with osteosarcoma was determined by qRT-PCR. [score:3]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice. [score:3]
The results showed that miR-34 relative expression in tumor tissues was significantly lower than that in non-tumor tissues (P<0.05) (Figure 1A). [score:3]
In the present study, the expression level of miR-34 in osteosarcoma tumor tissues and cells was explored. [score:3]
Their results revealed that significant down-regulation of miR-34 occurred in tumor tissues compared with that in adjacent normal tissues. [score:3]
We further researched the above speculation with TargetScan, and found that 3′-UTR region was the binding site of TGIF2 to miR-34 (Figure 3C). [score:3]
Amongst blank group, NC group, and miR-34 mimics group, miR-34 relative expression in miR-34 mimics group was obviously higher than that in the other two groups (P<0.05). [score:3]
Kasinski and Slack [9] found that miR-34 could inhibit cancer initiation and progression in mouse mo dels of lung adenocarcinoma. [score:3]
These results illustrated that miR-34 had an impact on the expression of TGIF2. [score:3]
miR-34 expression by qRT-PCR. [score:3]
Several studies also explored the relationship between miR-34 and TGIF2 in regulating tumor development. [score:3]
miR-34 inhibited osteosarcoma growth and promoted its apoptosis in nude mice. [score:3]
To our knowledge, researches about the effects as well as mechanism of miR-34 on osteosarcoma development were very limited. [score:2]
In addition, miR-34 relative expression, prominently decreased, was also found in MG-63 cells compared with that in hFOB 1.19 cells (P<0.05) (Figure 1B). [score:2]
Many other similar studies have researched the impact of miR-34 on tumors development. [score:2]
also showed that the proportion of TGIF2 positive cells of tumor tissues of nude mice in miR-34 mimics group was significantly lower than that in blank group and NC group (P<0.05) (Figure 3B). [score:1]
Our study suggested that miR-34 might be used as a potential biomarker for osteosarcoma, which provided an important guiding significance for the treatment of osteosarcoma at the molecular level. [score:1]
Further studies were conducted to investigate the mechanism of miR-34 in inhibiting growth and promoting apoptosis of osteosarcoma in nude mice. [score:1]
They recommended miR-34 to be used as a prognostic marker for patients with gastric cancer. [score:1]
These transfected MG-63 cells were set as miR-34 mimics group, NC group, TGIF2 group and TGIF2 + mimics group, respectively based on different transfection types. [score:1]
The exact mechanism of miR-34 on osteosarcoma growth and apoptosis in vivo by nude mice was also researched. [score:1]
A major breakthrough in the treatment of osteosarcoma will be achieved if the mechanism of miR-34 on osteosarcoma could be identified. [score:1]
Zhang et al. [27] explored the effect of miR-34 on the prognosis of patients with gastric cancer. [score:1]
Amongst these wide varieties of miRNA, miR-34 was reported to be associated with several tumors progress. [score:1]
Nude mice in vivo transplantation experiment results showed that, during 4–6 weeks, the tumor volume of miR-34 mimics group was significantly lower than that of blank group and NC group (P<0.05). [score:1]
In this paper, in vivo studies in nude mice were performed to research the effect of miR-34 on osteosarcoma growth and apoptosis, and related mechanism was also further studied. [score:1]
Flow cytometry showed that the percentage of apoptotic cells in miR-34 mimics group was much higher than that in blank group and NC group (P<0.05) (Figure 2C). [score:1]
These nude mice were also divided into blank group, miR-34 mimics group, NC group, TGIF2 group, and TGIF2 + mimics group based on the difference of injected cell suspension. [score:1]
Then the psiCHECK2 firefly luciferase reporter plasmids as well as miR-34 mimics or miR-34 negative control were used to transfect the MG-63 cells by Lipofectamine 2000 (Invitrogen, U. S. A. ). [score:1]
This result was also confirmed by immunohistochemistry that caspase-3 positive cells proportion of miR-34 mimics group was markedly higher than that of blank group and NC group (P<0.05) (Figure 2D). [score:1]
[1 to 20 of 64 sentences]
4
[+] score: 252
We detected modest upregulation of cMyc, E2f3, Met and Sirt1 in miR-34 -deficient MEFs, while Bcl2 was expressed at similar levels in wild-type and mutant cells (Figure 3K). [score:6]
Expression of members of the miR-34 family was similarly upregulated in response to p53 stabilization (Figure 3G). [score:6]
In addition, miR-449 expression is not substantially increased in miR-34 -null mice, and activation of the p53 pathway does not lead to significant upregulation of miR-449 (Figure S8). [score:6]
We also examined the consequences of miR-34 loss in MEFs on the expression of a subset of its previously reported direct targets [17], [20], [23], [25]. [score:6]
Thus, although a longer follow-up of miR-34 [T KO/T KO] mice may be needed to uncover very subtle defects in tumor suppression, we conclude that loss of miR-34 expression does not lead to a substantial increase in spontaneous tumorigenesis. [score:5]
Because previous work has relied on the use of miRNA antagonists to inhibit miR-34 function, it is possible that some of the previous observations reflected miR-34-independent off-target effects. [score:5]
With respect to the potential tumor suppressive role of miR-34, our experiments indicate that loss of miR-34 expression does not lead to an obvious increase in tumor incidence in mice and does not cooperate with Myc in the context of B cell lymphomagenesis. [score:5]
Importantly, in these three tissues, miR-34 expression is almost entirely p53-independent (Figure 1B–1D and [58]), a finding that suggests that additional transcription factors control the expression of this family of miRNAs in the absence of genotoxic or oncogenic stresses. [score:5]
Consistent with a possible tumor-suppressor role, loss of expression of members of the miR-34 family has been reported in human cancers. [score:5]
Here, we probe the tumor suppressive functions of the miR-34 family in vivo by generating mice carrying targeted deletion of the entire miR-34 family. [score:5]
The upregulation of Myc and E2f3 might contribute to the increased proliferation rate we have observed in miR-34 deficient MEFs. [score:4]
Consistent with previous reports indicating that miR-34a expression is under the direct control of p53 [13], [17], [18], we detected reduced levels of this miRNA in a subset of p53 -deficient tissues (heart, small and large intestine, liver and kidney), but the levels of both miR-34a and miR-34b∼c remained high in the brains, testes and lungs (Figure 1B–1D) of p53 [−/−] mice, a finding that suggests that p53-independent mechanisms determine basal miR-34 transcription in these tissues. [score:4]
Many of the predicted miR-34 target genes encode for proteins that are involved in cell cycle regulation, apoptosis, and growth factor signaling. [score:4]
Our results show that complete loss of miR-34 expression is compatible with normal development and that the p53 pathway is apparently intact in miR-34 -deficient mice. [score:4]
miR-34 and tumor suppression in vivo To extend our analysis to an in vivo setting, we next examined whether miR-34 inactivation is sufficient to accelerate spontaneous and oncogene -induced transformation in mice. [score:3]
Although our observation that single KO and miR-34 [T KO/T KO] mice produce viable offspring argues against an essential role for miR-34 in these processes, members of the related miR-449 family, that are particularly highly expressed in the testis (Figure S8), could partially compensate for miR-34 loss in this context. [score:3]
Despite the growing body of evidence supporting this hypothesis, previous studies on miR-34 have been done in vitro or using non-physiologic expression levels of miR-34. [score:3]
p53 -dependent and p53-independent miR-34 expression in vivo. [score:3]
Consistent with these results, doxorubicin treatment caused similar activation of p53 and of its downstream targets in wild-type and miR-34 [T KO/T KO] MEFs (Figure 3E and 3F). [score:3]
To test whether miR-34 plays a role in this context, we ectopically expressed oncogenic K-Ras in wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs. [score:3]
Next, we sought to determine whether loss of miR-34 expression affects the p53 response in vitro. [score:3]
Complete loss of miR-34 expression in miR-34 [T KO/T KO] animals was confirmed by Northern blot and qPCR (Figure 2D). [score:3]
Figure S1 Relative miR-34 expression in mouse tissues upon irradiation. [score:3]
We have reported the generation of mice carrying targeted deletion of miR-34a, miR-34b and miR-34c, and we have investigated the consequences of loss of miR-34 expression on p53 -dependent responses in vitro and in vivo. [score:3]
Although these observations point towards an important role for miR-34 members as critical downstream effectors of p53 and potential tumor suppressors, these hypotheses have not been formally tested using miR-34 -deficient animals and cells. [score:3]
Our results show that the miR-34 family is not required for tumor suppression in vivo, and they suggest p53-independent functions for this family of miRNAs. [score:3]
In humans, for example, loss of miR-34 expression has been reported in a large fraction of primary melanomas, prostatic adenocarcinomas and small cell lung cancers [27], [28], among others. [score:3]
However, the tumor suppressive function of miR-34 might be restricted to specific tissues and loss of miR-34 might cooperate with specific oncogenic lesions. [score:3]
Ectopic expression of members of the miR-34 family is sufficient to induce cell cycle arrest or apoptosis, depending on the cellular context [14], [17]– [21]. [score:3]
Members of the miR-34 family (miR-34a, miR-34b, and miR-34c) have been wi dely speculated to be important tumor suppressors and mediators of p53 function. [score:3]
To determine whether loss of miR-34 expression leads to increased spontaneous tumorigenesis, we aged a cohort of 14 miR-34 [T KO/T KO] and 12 wild-type mice. [score:3]
miR-34 and tumor suppression in vitro. [score:3]
We show that under basal conditions the expression of both miR-34 loci is particularly elevated in the testes and, to a lesser extent, in the brains and lungs of mice. [score:3]
miR-34 and tumor suppression in vitro The p53 pathway provides a crucial barrier against the neoplastic transformation of primary cells [40]. [score:3]
In addition, inactivation of miR-34 expression has been recently shown to lead to accelerated neurodegeneration and ageing in Drosophila melanogaster [64]. [score:3]
miR-34 and tumor suppression in vivo. [score:3]
Introducing the miR-34 -null alleles we have generated into mouse mo dels of these types of human cancers will be important to fully explore the tumor suppressive potential of this family of miRNAs. [score:3]
These results show that while miR-34 alone is not required for p53 -mediated tumor suppression in MEFs, its loss might cooperate with inactivation of the Rb pathway in promoting cellular transformation. [score:3]
P53 -dependent cell cycle arrest in miR-34 [T KO/T KO] MEFsNext, we sought to determine whether loss of miR-34 expression affects the p53 response in vitro. [score:3]
Complete loss of miR-34a and miR-34c expression was further confirmed in MEFs by qPCR (lower panel). [score:3]
p53 -dependent and p53-independent miR-34 expression in vivo To investigate the biological functions of miR-34, we first examined the expression of this family of miRNAs under basal conditions and in response to p53 activation in vivo. [score:3]
However, even in this context complete loss of miR-34 expression was not sufficient to accelerate tumor formation. [score:3]
Consistent with this mo del is our observation that while loss of miR-34 expression alone does not allow the transformation of primary cells by oncogenic K-Ras, it slightly increases the efficiency of transformation when combined with inactivation of the Rb pathway by E1A (Figure 5A, 5B). [score:3]
Recent reports have also implicated miR-34 in neuronal development and behavior [60], [61] and a role for miR-34c in learning and memory [62], as well as in stress -induced anxiety [63], has been reported. [score:2]
First, in the tissues and cells used in our experiments, the expression of miR-449 members is much lower compared to miR-34a and miR-34c, as judged by multiple independent methods including qPCR, Northern blotting and high throughput sequencing (Figure S8 and data not shown). [score:2]
It is also possible that other miRNAs sharing sequence similarities with miR-34 may compensate for miR-34 loss in the knock-out animals. [score:2]
However, when MEFs were co-transduced with oncogenic K-Ras and E1A, which binds to and inhibits the retinoblastoma protein (pRb) [42], we observed a slight increase in the number of foci formed in miR-34 [T KO/T KO] MEFs compared to wild-type cells (Figure 5A, 5B). [score:2]
MiR-34 expression in wild-type and p53 [−/−] mouse tissues. [score:2]
Although we detected a remarkable induction of miR-34a and miR-34c expression in late-passage wild-type MEFs compared to early-passage MEFs (Figure 3A), miR-34 -deficient MEFs became senescent with a kinetic identical to wild-type MEFs (Figure 3B). [score:2]
To exclude the possibility that tissue culture conditions may have masked a physiologic role of miR-34 in modulating the p53 response, we next examined the consequences of p53 activation in miR-34 -deficient tissues directly in vivo. [score:2]
In particular, three highly related miRNAs—miR-34a, miR-34b, and miR-34c (Figure 1A)—are directly induced upon p53 activation in multiple cell types and have been proposed to modulate p53 function [13]– [20]. [score:2]
Generation of miR-34 constitutive and conditional knockout mice. [score:2]
Age range of the cohorts is 359–521 days (mean: 464 days) for wild-type and 359–521 days (mean: 445 days) for miR-34 [T KO/T KO]. [score:1]
Although it will be important to follow a larger cohort of animals over a more prolonged period, these results suggest that miR-34 does not provide a potent barrier to tumorigenesis in response to genotoxic stress in vivo. [score:1]
Although as predicted, p53 -null cells failed to arrest in G1 in response to doxorubicin treatment, the response of miR-34 [T KO/T KO] MEFs was indistinguishable from that of wild-type cells (Figure 3H–3I). [score:1]
Thymocytes were isolated from sex-matched, age-matched wild-type, miR-34 [T KO/T KO], and p53 [−/−] mice and seeded at a density of 1×10 [6] cells/ml in MEF medium. [score:1]
For example, p53 has been proposed to modulate autophagy [55] and stem cell quiescence [56], [57] and we cannot exclude that miR-34 plays an important role in these contexts. [score:1]
1002797.g005 Figure 5Oncogene -induced transformation in miR-34 [T KO/T KO] fibroblasts and mice. [score:1]
Age- and sex-matched wild-type, miR-34 [T KO/T KO] and p53 [−/−] mice were exposed to 10 Gy of ionizing radiation and euthanized 6 hours later. [score:1]
P53 -dependent cell cycle arrest in miR-34 [T KO/T KO] MEFs. [score:1]
Both wild-type and miR-34 -deficient mice appeared healthy throughout the follow-up period (Figure S7), in striking contrast with the ∼15 weeks reported median tumor-free survival of irradiated p53 [−/−] mice [52]. [score:1]
To extend our analysis to an in vivo setting, we next examined whether miR-34 inactivation is sufficient to accelerate spontaneous and oncogene -induced transformation in mice. [score:1]
Furthermore, loss-of-function studies using miR-34 antagonists have provided some evidence that this miRNA family is required for p53 function [13], [18], [22]– [24]. [score:1]
The incidence and latency of B cell lymphomas was virtually identical in Eμ-Myc;miR-34 [T KO/T KO] and Eμ-Myc;miR-34 [+/+] mice (Figure 5C) and the resulting tumors displayed similar histopathological features and extent of spontaneous apoptosis (Figure 5D–5E). [score:1]
As expected, p53 [−/−] thymocytes were almost entirely resistant to irradiation -induced apoptosis; however, wild-type and miR-34 -deficient cells were equally sensitive to DNA damage -induced apoptosis, as judged by dose-response and time-course experiments (Figure 4A, 4B). [score:1]
We also observed modest but significant miR-34c induction in the thymus, small and large intestine of irradiated mice, but not in the other tissues examined. [score:1]
Representative pictures of miR-34a [−/−] (E), miR-34b∼c [−/−] (F), and miR-34 [T KO/T KO] (G) males at 4 weeks of age. [score:1]
Samples obtained from sex- and age-matched adult (age range 3–16 months) wild-type and miR-34 [T KO/T KO] mice were subjected to a standard panel of serum chemistry tests to determine liver and kidney function (n≥5 per genotype). [score:1]
More difficult, however, is to reconcile our findings with previous reports of impaired p53-function in cells treated with miR-34 antagonists. [score:1]
To generate mice carrying deletion of the miR-34b∼c bicistronic cluster, we used recombineering to replace a 1.3 kbp DNA region in BAC RP-23-281F13 containing pre-miR-34b and pre-miR-34c with a frt-Neo-frt cassette. [score:1]
Figure S5Serum chemistry of age- and sex-matched wild-type and miR-34 -deficient mice. [score:1]
Wild-type, miR-34 [T KO/T KO], p53 [−/−] MEFs were seeded at 70% confluence and infected with virus. [score:1]
For the irradiation experiments, 150,000 wild-type, miR-34 [T KO/T KO] and p53 [−/−] MEFs were seeded into each well of a 6-well culture plate and starved for 72 hours. [score:1]
For the miR-34 [T KO] allele (G), double heterozygous mice were inter-crossed. [score:1]
We next sought to determine whether loss of miR-34 might accelerate tumor formation in response to genotoxic stress. [score:1]
Based on these results we conclude that miR-34 function is not required for p53 -induced cell-cycle arrest and apoptosis in response to genotoxic stresses. [score:1]
Age range of the cohorts is 298–425 days (mean: 333 days) for wild-type and 387–425 days (mean: 401 days) for miR-34 [T KO/T KO]. [score:1]
An additional issue raised by the results presented in this manuscript relates to possible p53-independent functions of miR-34. [score:1]
Future studies using the miR-34 -deficient animals we have generated will be needed to test these possibilities. [score:1]
These findings highlight likely redundancies among p53's downstream effectors, show that the miR-34 family is largely dispensable for p53 function in vivo, and suggest possible p53-independent functions. [score:1]
The animals were monitored for at least 12 months (wild-type = 359 days; miR-34 [T KO/T KO] = 359 days) and up to 17.3 months (wild-type = 521 days; miR-34 [T KO/T KO] = 521 days). [score:1]
Wild-type and miR-34 [T KO/T KO] MEFs were seeded into a 6-well plate (40,000 cells/well) and counted every day for the growth curves. [score:1]
Here we report the generation of mice carrying targeted deletion of all three members of the miR-34 family and systematically investigate the impact of miR-34 loss on the p53 pathway. [score:1]
To examine the consequences of complete loss of miR-34 function, we crossed miR-34a [−/−] and miR-34b∼c [−/−] mice to generate compound mutant animals carrying homozygous deletion of all three family members (miR-34 [T KO/T KO]). [score:1]
One notable exception is a recent elegant paper by Choi and colleagues demonstrating that miR-34 -deficient MEFs are more susceptible to reprogramming [30]. [score:1]
The results presented in this paper do not necessarily conflict with previous experiments showing that ectopic expression of miR-34 can induce many of the most characteristic consequences of p53 activation; here we have tested whether miR-34 is necessary for p53 function and not whether it is sufficient. [score:1]
Epigenetic silencing of miR-34 members has also been reported in human cancers. [score:1]
We next examined the role of miR-34 in the response to the DNA damaging agent doxorubicin. [score:1]
Peripheral blood samples obtained from sex- and age-matched adult (age range 3–16 months) wild-type (WT) and miR-34 -null (T KO) mice were subjected to complete blood cell count (n≥5 per genotype). [score:1]
For BrdU cell cycle analysis, wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs were plated in complete medium at 70% confluence, treated with varying doses of doxorubicin for 16 hours or treated at different time points, and pulsed with 10 µM BrdU for one hour. [score:1]
Finally, we sought to determine whether genetic ablation of miR-34 could contribute to tumor formation in cooperation with a defined oncogenic lesion. [score:1]
Response to p53 activation in miR-34 [T KO/T KO] mouse embryonic fibroblasts (MEFs). [score:1]
In particular, members of the miR-449 family (miR-449a, b and c) have the same “seed” sequence as miR-34, and miR-34 antagonists could in principle impair their function as well. [score:1]
The experiments described above were performed on asynchronously growing early-passage MEFs and as such may not be sensitive enough to detect a modest effect of miR-34 loss on the S-phase checkpoint. [score:1]
Oncogene -induced transformation in miR-34 [T KO/T KO] fibroblasts and mice. [score:1]
Probes specific for miR-34a and miR-34c were used. [score:1]
This interpretation is also consistent with the faster proliferation rate displayed by miR-34 -deficient MEFs (Figure 3B, 3C) and with the observation by Lal and colleagues that miR-34a is involved in modulating the cellular response to growth factors [38]. [score:1]
RNAs from miR-34 [T KO/T KO] tissues were included to control for cross-hybridization. [score:1]
Five Eμ-Myc;miR-34 [+/+] tumors and and four Eμ-Myc;miR-34 [T KO/T KO] tumors were analyzed. [score:1]
The most logical interpretation of these results is that miR-34 -deficient MEFs, rather than being more resistant to irradiation -induced cell cycle arrest, possess a slightly faster basal proliferation or more rapid re-entry into the cell cycle following serum starvation. [score:1]
P53 -dependent apoptosis in miR-34 [T KO/T KO] cells and mice Having established that miR-34 is not required for cell cycle arrest in response to genotoxic stress in MEFs, we next sought to determine whether this miRNA family might contribute to p53 -induced apoptosis. [score:1]
Ionizing radiation induced similar activation of the p53 pathway and of its downstream effectors in wild-type and miR-34 [T KO/T KO] mice (Figure 4C). [score:1]
The standard 3T3 protocol was followed to determine the cumulative population doublings of wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs. [score:1]
To investigate the biological functions of miR-34, we first examined the expression of this family of miRNAs under basal conditions and in response to p53 activation in vivo. [score:1]
1002797.g003 Figure 3Response to p53 activation in miR-34 [T KO/T KO] mouse embryonic fibroblasts (MEFs). [score:1]
A role for miR-34c in spermatogenesis and in controlling the first zygotic cleavage has been recently proposed [58], [59]. [score:1]
The sequence similarity between the three miR-34 family members (Figure 1A), which share the same “seed”, suggests that they may be functionally redundant. [score:1]
MiR-34 wild-type and miR-34 [T KO/T KO] MEF lines were also verified by qPCR. [score:1]
The blots were then hybridized with [32]P-labeled probes specific for miR-34a, miR-34c, and U6. [score:1]
However, the consequences of miR-34 loss on p53 function were not examined in detail. [score:1]
Our observation that inactivation of miR-34 does not impair p53 -mediated responses in vitro and in vivo is particularly relevant because a key role for miR-34 in the p53 pathway had been previously proposed by a number of independent groups. [score:1]
Having established that miR-34 is not required for cell cycle arrest in response to genotoxic stress in MEFs, we next sought to determine whether this miRNA family might contribute to p53 -induced apoptosis. [score:1]
Figure S4 Complete blood cell count of age- and sex-matched wild-type and miR-34 -deficient mice. [score:1]
The results are representatitve of two independent experiments performed on a total of four wild-type and four miR-34 [T KO/T KO] MEF lines. [score:1]
Experiments were performed on three independent wild-type and three independent miR-34 [T KO/T KO] MEF lines. [score:1]
To investigate the physiologic functions of the miR-34 family and to determine the extent to which its induction is required for p53 function, we generated mice carrying targeted deletion of both miR-34a and miR-34b∼c loci (Figure 2A–2C). [score:1]
Figure S7Overall survival of wild-type and miR-34 [T KO/T KO] cohorts. [score:1]
An analysis of the major myeloid and lymphoid populations of the bone marrow, spleen and thymus also did not reveal any statistically significant difference between wild-type and miR-34 [T KO/T KO] mice (Figure S6). [score:1]
Representative images of hematoxylin and eosin staining of heart, kidney, liver, lung, small intestine, ovary, testis, and spleen (black scale bar, 200 µm), brain (green scale bar, 2000 µm), and colon (red scale bar, 100 µm) from wild-type and miR-34 [T KO/T KO] mice. [score:1]
Analogous to what we observed in thymocytes in vitro, the apoptotic response was equally dramatic in wild-type and in miR-34 -deficient mice, while it was virtually absent in p53 [−/−] animals (Figure 4D–4G). [score:1]
P53 -dependent apoptosis in miR-34 [T KO/T KO] cells and mice. [score:1]
We therefore exposed a cohort of 14 miR-34 [T KO/T KO] and 11 wild-type mice to 1 Gy of ionizing radiation soon after birth and monitored them for 42–60 weeks. [score:1]
Notice the loss of signal for miR-449b in the miR-34 [T KO/T KO] lung and testis samples, which likely reflects cross-hybridization of the miR-449b probe to miR-34. [score:1]
Generation of miR-34 -deficient mice. [score:1]
miR-34 [T KO/T KO] embryos were obtained by intercrossing miR-34 mutant mice. [score:1]
We therefore examined the effects of DNA damage on thymocytes from wild-type, p53 [−/−], and miR-34 [T KO/T KO] mice. [score:1]
Figure S6Bone marrow, spleen and thymus analysis of age- and sex-matched wild-type and miR-34 [T KO/T KO] mice. [score:1]
A conclusive test for this hypothesis will require the generation of compound miR-34 and miR-449 mutant animals, but several lines of evidence suggest that this explanation is not particularly likely. [score:1]
A full histological examination (Figure S3), complete blood cell count (Figure S4), and serum chemistry analysis (Figure S5) did not detect any statistically significant defects in adult miR-34 [T KO/T KO] mice of both sexes. [score:1]
[1 to 20 of 129 sentences]
5
[+] score: 197
From this analysis, three differentially expressed microRNAs were revealed, namely, miR-214 (permutation p value 3.7×10 [−3]), expressed specifically in human PBMCs exposed to either HMGB1 [+/+] or HMGB1 [−/−] lysates, and miR-34c (permutation p value 6×10 [−4]), expressed in PBMCs exposed to HMGB1 [+/+] lysates alone (Table 1). [score:9]
There was an increase in fold expression from 2.1±1.97 to 15.9±1.85 (log2-transformed fold expression values) in cells pre -transfected with pre-miR-34c and exposed to HMGB1 [−/−] lysates (Fig. 4B), suggesting targeting of the seed sequence, preventing miR-34c -mediated degradation of IKK mRNA. [score:7]
In our study, miR-34a was significantly down-regulated in human PBMCs exposed to damaged lysates, in contrast to miR-34c upregulation. [score:7]
Levels of miR-34c Expression (and Pro-inflammatory Cytokines) Decreased After Pre-incubation with the Inflammasome Inhibitor, Glybenclamide. [score:5]
We hypothesize that hsa-miR-34c may be required for fine-tuning expression of IKKγ, a key signal transduction intermediate in the expression of multiple immunity or inflammation associated genes. [score:5]
Together these data suggest that hsa-miR-214 expression is a general “DAMPmiR” expressed in human PBMCs exposed to damaged cells, while hsa-miR-34c is a miRNA that is sensitive to the presence of HMGB1 in damaged cells. [score:5]
Levels of hsa-miR-34 expression in pre-miR-34c transfected PBMCs were confirmed by the increase in fold expression of this miR using TaqMan microRNA real-time RT-PCR. [score:5]
C: Decreased protein expression of IKKγ after transfection with pre-miR-34c (lane 3) or increased protein expression of IKKγ after transfection with anti-miR-34c (lane 2) and exposure to damaged HMGB1 [+/+] cell lysates for 24 hrs. [score:5]
These results support the observation that both hsa-miR-34c and hsa-miR-214 are upregulated when human PBMCs are exposed to damaged or necrotic cells, where hsa-miR34c appears to be responsive to the presence of HMGB1. [score:4]
Differential expression of TNFα and hsa-miR-34c in human donor PBMCs following exposure to wild-type (wt) HCT116 or HMGB1 stable knock-down (kd) lysates. [score:4]
uk/cgi-bin/targets/) for hsa-miR-34c is the regulatory non- enzymatic scaffold protein NEMO (NF-kappa B essential modulator also known as IKKγ (or Ik Kinase gamma). [score:4]
Hierarchical clustering analysis of microRNA profiling confirmed that hsa-miR-34c is preferentially upregulated in PBMCs exposed to HMGB1-containing lysates but not HMGB1 [−/−] lysates (Figure 1A, upper panel). [score:4]
These findings support the notion that IKKγ may be a direct target of hsa-miR-34c. [score:4]
Here, we report that when human PBMCs are exposed to damaged HMGB1 [+/+] cell lysates, or conditioned media from serum-starved and glucose-deprived cells, both hsa-miR-34c and hsa-miR-214 are upregulated. [score:4]
Figure 1C shows the fold expression changes (as log 2-transformed values) for hsa-miR-34a, miR-34b, miR-34c, miR-214 and miR-155 under these conditions. [score:3]
Our findings clearly indicate that miR-34c and miR-214 are specifically expressed in human PBMCs following exposure to sterile cell lysates or conditioned media from stressed cells, but not when exposed to PAMPs as TLR ligands. [score:3]
Expression of Hsa-miR-34c and Hsa-miR-214 does not Increase in Human PBMCs Stimulated with Specific Pathogen-activated Molecular Pattern Molecules (PAMPs) or TLR Ligands. [score:3]
The computational binding energy level of hsa-miR-34c to IKKγ 3′ untranslated region (3′-UTR) is extremely low, about −22 kcal/mol (see Table S1), indicating the binding potential between the two sequences is very high. [score:3]
We also demonstrate that one of the functional targets for miR-34c could be IKKγ an essential signaling intermediate of the NFκB inflammatory pathway. [score:3]
Fig. 4C shows a significant reduction in the amount of IKKγ protein expressed in PBMCs pre -transfected with pre-miR-34c and exposed to HMGB1-containing lysates for 24 hrs. [score:3]
miR-34c and miR-214 are Differentially Expressed in Human PBMCs Following Exposure to Damaged/necrotic Cell Lysates. [score:3]
Expression levels of miR-34c and miR-214 were assessed in conditioned media from stressed (hypoxia, serum starvation) cells. [score:3]
Levels of miR-34c and miR-214 Expression (and Pro-inflammatory Cytokine Release) Increased After Exposure of Donor PBMCs to Conditioned Media from Serum-starved and Glucose-deprived Cells. [score:3]
Our findings indicate that miR-34c expression is due to the inflammatory response in human PBMCs and partly dependent on the presence of HMGB1 in cells from which damaged lysates or conditioned media were obtained. [score:3]
Changes in miR-34c, miR-214 and miR-155 expression in PMBCs pre-incubated with 50 µM glybenclamide (Glyb) for 30 minutes before being exposed to conditioned media (MEF CM) for 48 hrs were used to assess the inflammasome pathway. [score:3]
B: Changes in miR-34c, miR-214 and miR-155 expression in PBMCs from another donor exposed to conditioned media. [score:3]
When PBMC cultures were pre-incubated with 50 µM glybenclamide for 30 minutes, and exposed to conditioned media from serum-starved and glucose-deprived cells with heat shock, levels of miR-34c expression decreased significantly in both donor PBMC cultures (Fig. 5). [score:3]
Increased expression of miR-34c has been reported in Duchenne Muscular Dystrophy, where muscle damage occurs at large scales [18], indicating that miR-34c may be a diagnostic biomarker of internal tissue damage. [score:3]
C: Fold changes in expression (as log-2-transformed RQ values) of hsa-miR-34c and hsa-miR-214 in donor PBMCs exposed to the indicated HCT116 necrotic lysates for 48 hrs. [score:3]
Both TNFα release and hsa-miR-34c expression increased significantly following exposure to HMGB1 [+/+] lysates with respect to HMGB1 [−/−] lysates (Figure 2). [score:3]
To determine whether any PAMPs or TLR ligands are associated with miR-34c or miR-214 expression changes in donor PBMCs, we stimulated the cells with various PAMPS or known TLR ligands. [score:3]
Differential Expression of miR-34c in Donor PBMCs Exposed to a Necrotic Human Carcinoma Cell Lysate. [score:3]
Changes in IKKγ mRNA and protein expression levels in human PBMCs pre -transfected with pre-miR-34c or anti-miR-34c and exposed to HMGB1 [+/+] or HMGB1. [score:3]
C: Differential expression of hsa-miR-34a, miR-34b, miR-34c and other miRs when donor PBMCs are exposed to HMGB1 [+/+] or HMGB1 [−/−] lysates for 8 hrs. [score:3]
The fold expression changes for hsa-miR-34c in donor PBMCs exposed to HMGB1 [−/−] lysates varied from 0.1 to 0.78 fold, and 2.0 to 4.5 fold following exposure to HMGB1 [+/+] lysates. [score:3]
A: Changes in fold expression (as log 2-transformed RQ values) of IKKγ mRNA levels in human PBMCs transfected with pre-miR-34c-5p or anti-miR-34c-5p and exposed to damaged HMGB1 [+/+] or HMGB1− /− lysates for 8 hrs. [score:3]
Expression of hsa-miR-34c and hsa-miR-214 is a hallmark of human PBMCs exposed to necrotic cell lysates. [score:3]
IKKγ is a Potential Functional Target of Hsa-miR-34c. [score:3]
Fig. 3 shows the fold expression changes (as log2-transformed values) of miR-34a, miR-34c, miR-214, and miR-155 after stimulation of donor PBMCs with various concentrations of TLR ligands. [score:3]
Table S1 Some computational targets of hsa-miR-34c with very low binding energies. [score:3]
Expression of miR-34c and miR-214 was negligible in all samples stimulated with the various TLR ligands. [score:3]
hsa-miR-34c and hsa-miR-214 are expressed at negligible levels in human PBMCs stimulated with various PAMPS or TLR ligands. [score:3]
Expression levels of miR-34c and miR-214 are changed when donor PBMCs are exposed to conditioned media from dying cells. [score:3]
0038899.g005 Figure 5 A: Changes in miR-34c, miR-214 and miR-155 expression in PMBCs (from one donor) exposed to conditioned media from HMGB1 [+/+] and HMGB1 [−/−] MEF cells. [score:3]
However, in PBMCs exposed to HMGB1 [−/−] cell lysates, the levelsof hsa-miR-34c expressed are significantly less. [score:3]
Donor PBMCs seeded at 15×106 cells/2 mls/well in 6-well plates were transfected with 5 nM (final concentration) of pre-miR negative control oligos (AM17110), miR-34c-5p precursor (PM11039), or anti-miR inhibitor oligos (AM11039), (Applied Biosystems, Foster City, CA), using siPORT Lipid transfection reagent (Applied Biosystems/Ambion, Austin, TX). [score:3]
Here, we demonstrate that NEMO is a functional target of an inflammation -associated miR, miR-34c. [score:3]
A: Changes in miR-34c, miR-214 and miR-155 expression in PMBCs (from one donor) exposed to conditioned media from HMGB1 [+/+] and HMGB1 [−/−] MEF cells. [score:3]
0038899.g004 Figure 4Changes in IKKγ mRNA and protein expression levels in human PBMCs pre -transfected with pre-miR-34c or anti-miR-34c and exposed to HMGB1 [+/+] or HMGB1 − /− lysates. [score:3]
We show that miR-34c expression in human PBMCs is dependent on the presence of HMGB1 within cells serving as a source of lysates or conditioned media from stressed cells. [score:3]
For quantification of IKKγ mRNA or hsa-miR-34c expression after 48 hrs of transfection, total RNA (with microRNA) was isolated using the miRNeasy mini kit (Qiagen) after exposure to damaged HMGB1 [+/+] or HMGB1 [−/−] lysates for 8 hrs. [score:3]
The fold increase in hsa-miR-34c expression was from an average of 3.4 fold (in donors exposed to HMGB1 [−/−] lysates), compared to an average of 5.7 fold (in donors exposed to HMGB1 [+/+] lysates). [score:2]
As shown in Fig. 5, both miR-34c and miR-214 were significantly expressed in cultures exposed to the conditioned media, compared to untreated cultures. [score:2]
Total mRNA was isolated from donor PBMCs and Taqman miR PCR was carried out for miR-34c, mir-214, miR-155 and the endogenous nucleolar control RNA, RNU48. [score:1]
d., of two independent experiments and normalized to the untreated (UT) samples transfected either with control miR, pre-miR-34c or anti-miR-34c, where ***indicates p<0.001, by paired Student’s t test. [score:1]
Changes in IKKγ mRNA and protein expression levels in human PBMCs pre- transfected with pre-miR-34c or anti-miR-34c and exposed to HMGB1 [+/+] or HMGB1 [−/−] lysates were evaluated. [score:1]
Transfection of Human PBMCs with Pre-miR-34c or Anti-miR-34c Oligos. [score:1]
From the microRNA profiling data, fold expression values (as log 2–transformed RQ values) for the statistically significant microRNAs (hsa-miR-34a, miR-34c, miR-214, and miR-155) were calculated for each donor after exposure to lysates or LPS (Figure 1B). [score:1]
Interestingly, miR34c seed region sequence is highly conserved in humans and chimpanzees, as shown in Fig. S4, suggesting a possible major alteration in relatively recent evolutionary time. [score:1]
B: Data shown are 48 hrs after transfection of pre- miR-34c and negative control precursor oligos into donor PBMCs. [score:1]
Using a Taqman microRNA profiling low-density PCR array we identified several microRNA genes, including miR-34c, miR-214, miR-210, miR-125b and miR-10b in human PBMCs, which are involved in the inflammatory response to damaged cells. [score:1]
Figure S4 Sequence alignment of miR-34c seed region in various species. [score:1]
This indicates that the inflammasome, shown to be activated when immune cells are exposed to necrotic/damaged cells [14], is important for the activation of miR-34c. [score:1]
[1 to 20 of 63 sentences]
6
[+] score: 171
We recently found that over -expression of miR-34c induced apoptosis and inhibited proliferation and invasion in CRC cells by silencing its target, stem cell factor (SCF, also known as KITLG) [16], suggesting miR-34c as a promising target for the treatment of CRC patients. [score:9]
Besides, it has been recently raised that Res inhibited human CRC cell growth and induced apoptosis through up -regulating miR-34a, a homologue of miR-34c, implying a possible similar modulation of Res on miR-34c expression [17]. [score:6]
The most interesting result was that the anti-CRC effect of Res was partially through up -regulating the tumor suppressing microRNA, miR-34c, which silenced its target KITLG. [score:6]
Expression of miR-34 is lost in colon cancer which can be re-expressed by a novel agent CDF. [score:5]
The anti-CRC effect of Res was partially but specifically through up -regulating miR-34c which further knocked down its target KITLG; and the effect was enhanced in the presence of p53 probably through inactivating PI3K/Akt pathway. [score:5]
The inhibitory effect of Res on KITLG expression was abolished when silencing the endogenous miR-34c (P < 0.05, Fig.   2d). [score:5]
Res increased miR-34c expression both in p53 [+] and p53 [−] CRC cells, suggesting the effect of Res on miR-34c expression was p53 independent. [score:5]
Arrows denotes the time when miR-34c inhibitor or inhibitor-NC was added into the medium. [score:5]
MiR-34c knockdownFor knockdown of miR-34c, the specific miR-34c inhibitor was purchased from Ribobio (Guangzhou, China). [score:5]
The Res -suppressed cell proliferation, migration and invasion were recovered by 14.6% (P < 0.05), 11.9% (P < 0.05) and 49.3% (P < 0.01) respectively in HCT-116 cells in the presence of miR-34c inhibitor (Fig.   2e). [score:5]
For knockdown of miR-34c, the specific miR-34c inhibitor was purchased from Ribobio (Guangzhou, China). [score:4]
Unfortunately, we did not find apparent demethylation upon the treatment of Res for 24 h, 48 h or 72 h, indicating the upregulation of miR-34c by Res was not through inducing demethylation of the miR-34c promoter (Fig.   3a). [score:4]
Since Res markedly increased miR-34c in CRC cells, we presumed that the up-regulated miR-34c could be a potential contributor. [score:4]
Silence of the tumor suppressor miR-34c is implicated in the development of colorectal cancer (CRC). [score:4]
To evaluate the role of miR-34c in anti-CRC effect by Res alone or with Oxa, m iR-34c was up or down-regulated by lentiviral mediation or specific inhibitor, respectively. [score:4]
c Res inhibited phosphorylation of Akt in p53 [+] HT-29 cells MiR-34c transcription is under the control of p53 which is hypoexpressed in CRC tissues and cell lines [27]. [score:4]
In addition, the up-regulated miR-34c by Res sensitized chemosensitivity to Oxa treatment in CRC cells. [score:4]
Upregulation of miR-34c by Res is not through demethylation but p53 related. [score:4]
To consolidate the role of miR-34c in the Res -mediated anti-CRC activity, we knocked down miR-34c in HCT-116 cells by its specific inhibitor (Fig.   2c). [score:4]
c Res inhibited phosphorylation of Akt in p53 [+] HT-29 cells MiR-34c transcription is under the control of p53 which is hypoexpressed in CRC tissues and cell lines [27]. [score:4]
In summary, the present study revealed that Res inhibited CRC by activating miR-34c-KITLG in vitro and in vivo; and the effect was strengthened in the presence of p53. [score:3]
Res raised the miR-34c expression in tumors but not in serum, giving a clue that the miR-34c-inducing effect of Res was tissue specific instead of systemic. [score:3]
showed that despite Res induced miR-28 and miR-34a (P < 0.01, Fig.   2g), their respective targets HoxB3 and KIT were not decreased during Res treatment (Fig.   2g), suggesting that Res probably had a specific effect on miR-34c-KITLG axis in CRC cells. [score:3]
Over -expression of miR-34c by lentiviral mediation. [score:3]
Besides miR-34c, previous studies showed that Res could increase some tumor suppressing microRNAs in CRC. [score:3]
Res suppressed CRC by specifically activating miR-34c-KITLG in vitro and in vivo; and the effect was strengthened in the presence of p53. [score:3]
e Res-refrained proliferation, migration and invasion were reversed in HCT-116 cells in the presence of miR-34c inhibitor. [score:3]
Could p53 conduced to the Res-stimulated miR-34c expression in CRC cells? [score:3]
However, it was worth noting that p53 was elevated after treated with Res in HT-29 cells and, simultaneously, the inducement of miR-34c by Res was more prominent in HT-29 cells, indicating p53 facilitated the effect of Res on miR-34c expression. [score:3]
We further detected microRNA profile in xenograft tumors and/or serum; and the results showed only miR-34c was clearly elevated in tumors but not in serum after exposure to Res for 2 weeks, indicating that Res had a relatively specific effect on miR-34c expression in vivo (P < 0.01, Fig.   5b). [score:3]
Therefore, we over-expressed miR-34c in HCT-116 cells by lentivirus. [score:3]
After exposure to Res for 24 h, miR-34c was strikingly increased 5.4 folds (P < 0.01) in HCT-116 cells and 19.2 folds (P < 0.01) in HT-29 cells (Fig.   2a), while KITLG, a target of miR-34c [16], was evidently decreased in these CRC cells (P < 0.05, Fig.   2b). [score:3]
Over -expression of miR-34c by lentiviral mediationThe full length of pre-miR-34c was chemically synthesized and introduced into GV217 lentiviral vector (GeneChem, Shanghai, China) in the unique EcoRI site to construct a lentivirus encoding miR-34c (Lv- miR-34c). [score:3]
P53 is a tumor suppressor and drives miR-34c transcript [27]. [score:3]
We used p53 [+] and p53 [−] CRC cells and found elevated miR-34c in both CRC cell lines, indicating that Res regulated miR-34c in a p53 independent way. [score:2]
MiR-34c is suggested to be a candidate of tumor suppressing gene and epigenetically silenced in CRC [14, 15]. [score:2]
Res sensitizes CRC cells to Oxa by up -regulating miR-34c. [score:2]
Upon the treatment with Oxa for 48 h, the viability of HCT-116 cells overexpressing miR-34c was significantly decreased compared with controls (P < 0.05, Fig.   4c). [score:2]
The result provided evidence that Res sensitized the CRC cells to Oxa chemotherapy probably through up -regulating miR-34c. [score:2]
MiR-34c knockdown. [score:1]
Fig. 3 a The methylation state in the miR-34c promoter of CRC cell was not altered in the presence or absence of Res. [score:1]
Besides, Res sensitized CRC cells to Oxa in a miR-34c dependent manner. [score:1]
Here, we hypothesized that the IL-6-triggered CRC progression could be interfered by the Res-increased miR-34c. [score:1]
Collectively, these results demonstrated that the anti-CRC effect of Res could be partially through activating the miR-34c-KITLG axis. [score:1]
In the present study, we provided evidence that Res itself could not only exert significant anti-CRC effect, but also showed a synergistic effect with Oxa in a miR-34c dependent manner. [score:1]
Anti-CRC effect of Res is partially through activating miR-34c-KITLG axis. [score:1]
In this study, Res was introduced to facilitate the chemosensitivity to Oxa in CRC cells, which was probably relied on the elevated miR-34c. [score:1]
The full length of pre-miR-34c was chemically synthesized and introduced into GV217 lentiviral vector (GeneChem, Shanghai, China) in the unique EcoRI site to construct a lentivirus encoding miR-34c (Lv- miR-34c). [score:1]
We also suggested that Res-increased miR-34c could interfere IL-6-triggered CRC progression. [score:1]
Interestingly, accompanied with the reduced miR-34c the anti-CRC effect of Res were attenuated. [score:1]
Taken together, we proposed that Res had a robust positive effect on miR-34c-KITLG axis in CRC cells and the effect was, to some extent, specific. [score:1]
Fig. 2 a Res increased miR-34c in CRC cells, which was more prominent in p53 [+] HT-29 cells than in p53 [−] HCT-116 cells. [score:1]
However, Res increased p53 protein in p53 [+] HT-29 cells (Fig.   3b), and the inducement of miR-34c by Res was more prominent in HT-29 cells than that in p53 [−] HCT-116 cells (Fig.   2a), suggesting an involvement of p53 in the Res -induced miR-34c in CRC cells. [score:1]
Could p53 be involved in the Res -induced miR-34c in CRC cells? [score:1]
It’s acknowledged that the promoter of miR-34c is hypermethylated in CRC tissues and cell lines which lead to silencing of miR-34c [27]. [score:1]
Besides, Res exerted a synergistic effect with Oxa in a miR-34c dependent manner. [score:1]
b Res increased miR-34c in tumors but not in serum. [score:1]
However, we did not observe any demethylated bands by MSP method upon the treatment of Res, indicating demethylation did not account for the Res -induced miR-34c. [score:1]
We selected tumor suppressing microRNA, miR-34c which we have previously reported [16], to investigate the potential anti-CRC mechanism of Res. [score:1]
Likewise, miR-34c level was elevated in xenografts of Res -treated mice while the KITLG was decreased. [score:1]
The Lv- miR-34c or its control, Lv-NC, was transfected into CRC cells seeded in 6-well plates when reaching 30 % confluence. [score:1]
However, whether miR-34c is implicated in the Res -mediated anti-CRC effect has not yet been fully elucidated. [score:1]
[1 to 20 of 62 sentences]
7
[+] score: 139
Number of embryos analyzed: miR-34c inhibitor: 5, miR-34c mimic: 5, miR-204 inhibitor: 6, miR-204 mimic: 7, control inhibitor: 9, control mimic: 8. Small RNA sequencing of embryonic porcine cortex across fetal development revealed a remarkable shift in expression levels of a distinct set of miRNAs from embryonic day 60–80 (E60–E80), which is the period of cortical folding in the pig brain (manuscript in preparation). [score:10]
Although we have shown that DCX is a target for both miR-34c and miR-204, and that over -expression of these miRNAs in IUE experiments significantly inhibit neuron migration in the mouse embryo, we cannot conclude that this migration effect is directly caused by inhibition of DCX. [score:10]
Number of embryos analyzed: miR-34c inhibitor: 5, miR-34c mimic: 5, miR-204 inhibitor: 6, miR-204 mimic: 7, control inhibitor: 9, control mimic: 8. Cortical folding is a complex process orchestrated by spatially controlled gene expression in subsections of the brain, and miRNA is likely to play key roles in the process. [score:9]
miR-34c and miR-204 mimics are shown to reduce DCX 3′UTR luciferase reporter expression, and miR-34c inhibitor increases DCX 3′UTR luciferase reporter expression. [score:7]
In accordance with being cognate targets, mimics of both miR-204 and mir-34c were able to significantly reduce luciferase expression, whereas miR-34c inhibitor increased the production from the DCX 3′UTR reporter. [score:7]
Both miR-34c and miR-204 are predicted by TargetScan to target DCX mRNA through 1 and 2 target sites, respectively (Table 1). [score:7]
The most strongly upregulated miRNAs, miR-34c, and miR-204, were shown to alter the extent of neuronal migration in embryonic mouse brain, and their large expression increase during cortical folding in pig, suggests a pivotal role in mediating correct cortical morphogenesis of gyrencephalic animals. [score:6]
MiR-204 and miR-34c are particularly notable upregulated miRNAs, due their almost exclusive expression in E80 cortex tissue (Figure 1B). [score:6]
Our finding, that increased miR-34c and miR-204 expression reduces neuronal migration, implies that suppression of EMT related factors could be a contributing mechanism controlling neuronal migration. [score:5]
Both the miR-34 family and miR-204 miRNAs are well known tumor suppressors in several cancers (He et al., 2007; Li et al., 2016) and have been linked to suppression of epithelial to mesenchymal transition (EMT; Hahn et al., 2013; Morizane et al., 2014; Li et al., 2016; Liu et al., 2016). [score:5]
To confirm that the predicted target sites are indeed functional targets of miR-34c and miR-204, the DCX 3′UTR was cloned downstream of a luciferase reporter and analyzed in HEK293-H cells. [score:5]
This suggests that controlled upregulation of miR-34 family miRNAs is important, both in embryonic and adult animals. [score:4]
The authors also find DCX to be a direct target of the miR-34-5p/449-5p family. [score:4]
Our finding of tightly controlled expression of miR-34c and miR-204 in brain development seems to extrapolate into neuroprotective effects in the aging animal. [score:4]
GFP signal indicates neurons transfected with miR-34c inhibitor (A) or mimic (B). [score:3]
Detection of miR-204 and miR-34c by in situ hybridization (ISH) at E60 and E80 in the porcine cortex showed clearly increased expression at E80 for both miRNAs (Figure 2A). [score:3]
Table 1 supports the shared function of miR-34a and miR-34c, given that both miRNAs show large expression increases from E60 to E80 of 50 and 180-fold, respectively. [score:3]
Analysis of migration of GFP -positive neurons in the motor cortex revealed that inhibition of miR-34c induced a robust increase in the percentage of GFP -positive cells in the cortical plate (CP; P = 0.006) and a reduction in both the intermediate zone (IZ; P = 0.007) and the subventricular zone (SVZ; P = 0.042) (Figures 3A,C). [score:3]
The striking finding that miR-204 and miR-34c exhibit specific expression increases in excess of 100 fold at the time of porcine gyration implies that they have key roles in the timing of the process. [score:3]
The authors found that miR-34 over -expression ameliorated age-related neurodegeneration and increased median lifespan. [score:3]
In a study by Liu et al. (2012), Drosophila miR-34 was found to display increased brain expression, specifically in old animals. [score:3]
Three psicheck2 vectors with inserted fragment were made from WT sequences originating from: DcxUp-3′UTR_WT: chrX:110543495-110543999       505 bp (The miR-34c target site). [score:3]
Three psicheck2 vectors with inserted fragment were made from WT sequences originating from: DcxUp-3′UTR_WT: chrX:110543495-110543999       505 bp (The miR-34c target site). [score:3]
Together, these data strongly suggest that miR-34c and miR-204 regulate neuronal migration in the embryonic cortex, in line with our expression and reporter assay experiments. [score:3]
MiR-204 and miR-34c sequences and their predicted targets in DCX 3′UTR are conserved, implying that the effects of miR-34c and miR-204 on the migration of neurons in the mouse is most likely conserved in higher mammals, such as pigs and humans. [score:3]
Mutating the predicted miR-34c, miR-204 and miR-15a target sites individually in the luciferase reporters abolished the observed effects (Figure 2C). [score:3]
Figure 3 miR-34c and miR-204 regulate cortical neuron migration. [score:2]
Altogether, every member of the miR-34-5p/449-5p family of miRNAs, all sharing identical seed sequences, have been found to affect brain development. [score:2]
miR-34c attenuates epithelial-mesenchymal transition and kidney fibrosis with ureteral obstruction. [score:1]
Of the 6 miRNAs in this miRNA seed family (miR-34a,b,c, and miR-449a,b,c) only miR-34a and miR-34c are annotated in pig, in agreement with the detected miRNAs in our profiling experiment. [score:1]
Thus, embryonic functions of miRNAs, such as miR-34c and miR-204, which affect cortical morphogenesis, are also likely to affect epilepsy susceptibility later in life. [score:1]
The microRNA miR-34 modulates ageing and neurodegeneration in Drosophila. [score:1]
Although miR-34a and miR-34c have identical seed sequences, they have a substantial 5 nt sequence dissimilarity outside the seed, ensuring that miR-34a and miR-34c can readily be distinguished in ISH experiments via specific LNA probes. [score:1]
Here we unveil a functional role for two of these miRNAs in neuronal migration, miR-34c and miR-204. [score:1]
Both miR-34c and miR-204 are conserved between mouse and pig and despite the fact that mice have a non-gyrated brain, the underlying process of neuronal migration is conserved between lissencephalic and gyrencephalic species (Kerjan and Gleeson, 2007). [score:1]
Mir-34a, a close relative of miR-34c, was recently found to play an active role in neural cell differentiation and was shown to affect migration of neuroblasts. [score:1]
The alkaline phosphatase-labeled probes used for miRNAs were 22 nts and 23 nts in length for miR-204 and miR-34c, respectively. [score:1]
miR-34c and miR-204 affect neuronal migration. [score:1]
[1 to 20 of 38 sentences]
8
[+] score: 138
About half the mRNAs down-regulated by miR-34b or miR-34c were also down-regulated by miR-34a, but less than a fifth (91 of 482) of the genes down-regulated after miR-34a overexpression were down-regulated by miR-34b or miR-34c (Fig 2A), suggesting that individual miR-34 miRNAs regulate unique targets. [score:18]
Activation of p53 by cellular stress leads to transcription of miR-34 miRNAs, which in turn can enhance p53 function by: (1) miR-34a -mediated inhibition of multiple negative regulators of p53 to further increase p53 transcriptional activity; and (2) miR-34a -mediated increase of p53 protein stability (miR-34a feed-forward loops); or inhibit p53 function by: (3) direct miR-34a -mediated inhibition of TP53; and (4) direct miR-34 inhibition of many p53-activated genes (negative feedback loops). [score:12]
Although mature miR-34b and miR-34c have sequences almost identical to miR-34a even outside the seed, over -expression of miR-34b or miR-34c, unlike over -expression of miR-34a, had little effect on p53 promoter activity and only weakly up-regulated the mRNA levels of p53 transcriptional targets. [score:10]
Consistent with this result, induction of 6 p53 transcriptional targets in HCT116 cells was significantly less after miR-34b or miR-34c overexpression than after miR-34a overexpression (Fig 1D), despite highly elevated miRNA overexpression (S1A Fig). [score:9]
Functional Annotation Analysis of downregulated genes in HCT116 cells overexpressing miR-34 using DAVID Bioinformatics tool. [score:6]
Genes down-regulated by miR-34 over -expression in HCT116 cells. [score:6]
482, 163 and 29 mRNAs were significantly down-regulated (fold decrease ≥ 1.5 fold relative to miRNA control) after miR-34a, miR-34b or miR-34c overexpression, respectively (Fig 2A and S1 Table). [score:6]
miR-34b-5p (hereafter designated miR-34b) overexpression had a modest, but significant, effect on 2 of the 4 promoters, while miR-34c did not significantly increase activity of any (Fig 1C), even though it was over-expressed more than a hundred fold above its endogenous level after genotoxic stress (data not shown). [score:5]
As expected, miR-34 overexpression decreased the miR-34a target gene CDK6 and increased the p53-activated gene CDKN1A, assessed as controls. [score:5]
We set out to study how the different miR-34 miRNAs contribute to p53 function, analyze whether they regulate overlapping sets of targets and determine if miR-34 is essential for p53 -mediated function in human cells. [score:4]
To determine whether the miR-34 family might regulate non-overlapping mRNAs, we performed gene microarray analysis of HCT116 cells overexpressing each family member (S1B Fig). [score:4]
In addition, the lack of a strong effect of genetic deletion of miR-34a could also be secondary to functional redundancy provided by the other miR-34 members or other p53-regulated tumor suppressor miRNAs [45– 49] or by the p53-independent miR-449 family, which shares a seed sequence with miR-34 [50]. [score:4]
These data are consistent with a previous report showing differing proteomics profiles in HeLa cells over -expressing miR-34a or miR-34c [41]. [score:3]
A better knowledge of the mutual functional dependence between miR-34 and p53 will help to understand miR-34 tumor suppressor function. [score:3]
We next used luciferase reporter promoter assays, in p53-sufficient HCT116 cells, to assess whether miR-34 overexpression enhanced promoter activities of a sequence of 13 tandem repeats of the p53 binding site (pG13-luc) [16] or the promoters of p53-regulated genes, PUMA, CDKN1A (the gene encoding p21/WAF1) and BAX. [score:3]
Our observation that only miR-34a overexpression enhances p53 -mediated transcription was surprising since the miR-34 family active strands are highly homologous—the seed (residues 2–9) and residues 11–17 and 19–21 are identical (Fig 1C). [score:3]
Analysis of miR-34 levels in miR-34 over -expressing samples. [score:3]
Of note, for both experiments, miR-34c expression is ~ 9 fold less than in miR-34b transfected samples. [score:3]
0132767.g002 Fig 2 (A) Overlap of genes down-regulated ≥ 1.5 fold in miR-34 OE HCT116 cells compared to control -transfected cells. [score:3]
An unexpected finding of this study was the weak effect of miR-34b or miR-34c over -expression on p53 function. [score:3]
Single colonies were tested for miR-34 expression by qRT-PCR and negative colonies were verified by sequencing. [score:3]
Since their initial identification as p53 transcriptional targets, the three members of the miR-34 family have been considered crucial mediators of the p53 response [39]. [score:2]
However, miR-34c is still highly expressed, even compared to DOX -treated HCT116-WT cells. [score:2]
Multiple miRNAs, including the miR-34 family, are transcriptionally activated by p53. [score:1]
miR-34c is increased in miR-34c transfected samples by 100X and 285X, relative to DOX treated HCT116-WT cells, respectively (compare S1A and S1B Fig to Fig 6C). [score:1]
Our results showing that miR-34a is not essential for the p53 mediated response to stress are in agreement with data published by Concepcion et al reporting intact p53 function in miR-34 deficient mice [12]. [score:1]
Genome-wide transcriptome analysis of miR-34 OE HCT116 cells. [score:1]
Thus sequence determinants outside the seed might profoundly affect miR-34 family function by an unknown mechanism that is worth exploring. [score:1]
Future experiments with miR-34 -deficient human cells should address the contribution of miR-34 in these other scenarios. [score:1]
Mean +/- SD of three independent experiments is shown in cells transfected with miR-34 family or cel-miR-67 (M-control) mimics. [score:1]
WT cells have <1 copy/cell of miR-34b and miR-34c, which only increases to 5 and 10 copies/cell, respectively, after DOX (Fig 6C). [score:1]
Thus miR-34 -mediated increased p53 transcription is largely limited to miR-34a. [score:1]
miR-34—a microRNA replacement therapy is headed to the clinic. [score:1]
Normalized Firefly luciferase activity, relative to Renilla luciferase activity, after miR-34 transfection is plotted as fold change relative to control miRNA -transfected sample. [score:1]
Alignment of the miR-34 family with the seed sequence highlighted in red is shown at top. [score:1]
miR-34 levels in transfected samples from Fig 1D (A) and Fig 2 (B), analyzed by qRT-PCR. [score:1]
In this regard, it has been shown recently that somatic cells from miR-34 deficient mice can be reprogrammed more efficiently [51]. [score:1]
Three chromosome 5q11.2 miRNAs (miR-449a/b/c) share a seed sequence with miR-34, and have a tissue distribution similar to that of miR-34b/c [6, 7]. [score:1]
Here, we investigated in detail how the different miR-34 family members contribute to p53 function, the miR-34a targets that are relevant for its contribution and how much p53 relies on miR-34a. [score:1]
Although antagonizing miR-34a in human cells impairs p53 function in a few studies [4, 10, 11], mice genetically deficient in all miR-34 family genes have unimpaired stress responses [12]. [score:1]
The miR-34 family consists of 3 miRNAs—miR-34a on human chromosome 1p36 and miR-34b/c, co-transcribed on human chromosome 11q23. [score:1]
[1 to 20 of 41 sentences]
9
[+] score: 131
Inhibition of the entire miR-34 family improved cardiac function, and this was associated with reduced fibrosis, decreased Anp expression, increased angiogenesis, maintenance of Serca2a expression, and up-regulation of several direct targets, including VEGFs, Pofut1, Notch1 and Sema4b [10]. [score:13]
In recognition that cardiovascular disease and cardiac remo deling is associated with simultaneous dysregulation of several miRNAs (e. g. miR-1, miR-34a, miR-133, miR-199b, miR-320 [11], [15], [36]– [38]) or miRNA families (e. g. miR-34 family [10], miR-208 family [39]), tiny 8-mer seed -targeting LNA-antimiRs could provide an advantage by simultaneous inhibition of entire miRNA seed families [10], [27]. [score:8]
Since the miR-34 family has approximately 31–55% more targets in humans (which is dependent on the particular target prediction algorithm used) than miR-34a alone, interventions that modulate the entire miRNA family have greater theoretical potential to generate off-target effects. [score:7]
Whilst inhibition of miR-34a and the miR-34 family is protective in the hearts of mice [10], [11], the effect of prolonged/chronic inhibition of miR-34a and its family members may not be ideal because of its ability to drive tumorigenesis [40], [41], although a recent study has shown that the miR-34 family is not required for tumor suppression in mice [42]. [score:7]
In addition to the tumor suppressive role of miR-34a, miR-34 expression is important for long-term maintenance of the brain, healthy aging and modulation of protein homeostasis with age in Drosophila [47], and miR-34b and miR-34c are key regulators of skeletogenesis [48]. [score:6]
Given the current enthusiasm and anticipation regarding therapeutic development of miR-34a and miR-34 family -targeted antimiRs [11], [21]– [23], and the differences in cardiac protection in acute versus chronic settings [10], [11], it is important to assess the therapeutic potential of inhibiting miR-34a in more sustained pathological settings. [score:6]
Greater therapeutic benefit of inhibiting the entire miR-34 family may be related to the regulation of more target genes. [score:6]
Thus, drugs that target the entire miR-34 family are likely to have greater therapeutic benefit in settings of sustained cardiac stress and severe pathology than inhibition of miR-34a alone. [score:5]
Bar graphs showing the number of predicted targets of miR-34a versus the miR-34 family using three target prediction algorithms in mice and humans (MiRanda 4.0, PicTar, DIANA microT v5.0). [score:5]
All miR-34a targets are also predicted targets of miR-34 family. [score:5]
Furthermore, expression of miR-34 family members was found to be elevated in cardiac tissue from patients with heart disease [19], [20]. [score:5]
Inhibition of the miR-34 family also improved cardiac function and attenuated LV remo deling in a mouse mo del with pre-existing pathological cardiac remo deling and dysfunction due to pressure overload by transverse aortic constriction (TAC) [10], however the therapeutic impact of inhibiting miR-34a alone was not assessed in that study. [score:5]
Identified targets of miR-34a and the miR-34 family which have been associated with improved cardiac outcomes due to their roles related to cell survival, proliferation, cardiac repair and regeneration, maintenance of cardiac function, and angiogenesis include vinculin (Vcl), phosphatase 1 nuclear targeting subunit (also known as PNUTS), vascular endothelial growth factor–A and B (Vegfa, Vegfb), Cyclin D1, Sirt1, Notch1, protein O-fucosyltransferase 1 (Pofut1) and semaphorin 4b (Sema4b) [10], [11]. [score:5]
A possible explanation for the reduced capacity of LNA-antimiR-34a to provide protection in chronic or severe settings of cardiac pathology may be due to increased expression of two other miR-34 -family members, miR-34b and miR-34c (ranging from a ∼1.7 to 4-fold increase in MI or TAC [10]). [score:3]
In a previous study, we reported that inhibition of the miR-34 family attenuated LV remo deling and atrial enlargement in mouse mo dels with established cardiac dysfunction due to MI or pressure overload [10]. [score:3]
This is in contrast to the more favorable effect of inhibiting the entire miR-34 family in the pressure overload mouse mo del in our previous report [10]. [score:3]
We have previously shown that LNA-antimiR-34a does not inhibit miR-34b and miR-34c [10], which were both elevated in the TAC severe mo del in this study. [score:3]
Thus, this could explain why pharmacologic inhibition was not effective in the TAC severe mo del, and only partially protective in the TAC moderate mo del of pressure overload, which had increased levels of all miR-34 family members (i. e. miR-34a, miR-34b and miR-34c). [score:3]
Expression of miR-34a, miR-34b and miR-34c in control and TAC mice. [score:3]
We have previously shown that expression of other miR-34 family members, miR-34b and miR-34c, are elevated in settings of cardiac stress [10], [18]. [score:3]
The current study and our previous work [10] highlight a different therapeutic benefit of inhibiting a single miRNA (miR-34a) or a miRNA family (miR-34 family) in moderate and severe mo dels of sustained cardiac stress. [score:3]
Expression of miR-34 family members, miR-34b and miR-34c, is elevated in moderate and severe mo dels of pressure overload. [score:3]
We recently found that inhibition of the miR-34 family, but not miR-34a alone, displayed a therapeutic benefit in a chronic mo del of myocardial infarction (MI, with pre-existing cardiac dysfunction and significant left ventricular (LV) remo deling; antimiR delivered 2 days after MI) [10]. [score:3]
Therefore, while miR-34 has marked therapeutic potential in conditions of heart stress, it will be critical to assess the impact of miR-34 in brain, bone and other organs during its development as a therapeutic agent, or may require the development of cardiac-specific approaches [27, 32, 45,] [49]. [score:3]
Figure S3 Number of predicted targets of miR-34a versus the miR-34 family. [score:3]
We and others have previously shown that expression of miR-34a is elevated in settings of cardiac stress [10], [18] and ageing [11], and that miR-34 family members, 34b and 34c, are also elevated in the mouse heart following a cardiac insult [10], [18]. [score:3]
Since we identified only modest protection in the moderate mo del of TAC, and no protection in the severe mo del of TAC with LNA-antimiR-34a administration in the present study, we analyzed the expression of the other miR-34 family members (i. e. miR-34b and -34c) in control mice, TAC moderate LNA-control and TAC severe LNA-control mice. [score:3]
As shown by miRNA target prediction databases based on different algorithms (MiRanda, DIANA, PicTar), the miR-34 family is predicted to repress 24–40% (mouse) or 31–55% (human) more mRNAs than miR-34a alone (Figure S3). [score:3]
qPCR of miR-34a, miR-b and miR-34c in hearts of control, TAC moderate and TAC severe mice. [score:1]
0090337.g006 Figure 6 qPCR of miR-34a, miR-b and miR-34c in hearts of control, TAC moderate and TAC severe mice. [score:1]
We have previously shown that LNA-antimiR-34a does not significantly silence miR-34b and miR-34c in the heart [10]. [score:1]
[1 to 20 of 31 sentences]
10
[+] score: 121
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34b, mmu-mir-34a, hsa-mir-34b, hsa-mir-34c
The relative intensity was normalized to the expression of the control sample Fig. 6 a Western blot analysis after Ant34 treatment (50 nM for 7 days as described above), b miR34 transduction and c p63 expression after Numb overexpression. [score:7]
In an opposite way as the inhibition, miR34 overexpression induces a downmodulation of cKit, Notch, and hey-1 expression (Fig.   5b). [score:7]
The mRNA expression on different LNA34 -treated CDCs showed that miR34 inhibition causes an increase of cKit, Notch-1 and hey-1 expression (Fig.   5a). [score:7]
Protein expression analysis after mir34 inhibition, overexpression or Numb transduction. [score:7]
The relative intensity was normalized to the expression of the control sample a Western blot analysis after Ant34 treatment (50 nM for 7 days as described above), b miR34 transduction and c p63 expression after Numb overexpression. [score:7]
It has been demonstrated in mouse mo del that miR34 inhibition reduces cardiac dysfunction 6, 7. Boon and coworkers [7] found that miR34 is implicated in cardiac aging and its downmodulation through LNA inhibition supports cardiac repair in mice after AMI. [score:5]
We observed an increased Numb expression by miR34 inhibition (Fig.   6a). [score:5]
It is worthy to note that LNA34 treatment enhances not only Notch mRNA, but also hey-1 expression, indicating that the Notch pathway is activated after miR34 inhibition. [score:5]
Gene expression analysis after mir34 inhibition or transduction. [score:5]
MiR34 expression directly correlates with age in human biopsies (r = 0.125037328, p = 0.010672365) On the basis of this evidence, we silenced miR34 using an LNA 8mer (Ant34). [score:4]
This indicates an indirect correlation between miR34 expression and proliferation in these cell populations. [score:4]
Our data demonstrate not only that Numb is regulated by miR34 in cardiac stem cells, but also that Numb overexpression itself induces an increase in cardiac progenitors growth (revised by Wu and Li [19] in other mo dels as mouse and drosophila). [score:4]
To confirm the regulative activity of miR34, we overexpressed in CDCs mature miR34 with lentiviral vector. [score:4]
It is possible to assess that in the dividing population miR34 is less expressed compared with the quiescent population (result of three independent experiments on five different CDCs populations p ≤ 0.05) We tested in our specimens the relation between age and miR34 relative expression [7]. [score:4]
Our study represents the first evidence that miR34 inhibition in human cardiac progenitor/stem cells could be proficiently employed in new therapeutic interventions for human cardiac pathologies. [score:3]
It is possible to observe a clear incorporation of Numb after overexpression, Rab5 was used as exosomal protein normalizer A recent report has demonstrated that the miR34 downmodulation after MI induces a functional recovery and an increase in the scar reduction in mice [7]. [score:3]
The two separated populations were examined for the ability to form spheres in culture (Fig.   1b) and for miR34 relative expression (Fig.   1c). [score:3]
Growth rate after mir34 inhibition. [score:3]
Moreover, by overexpressing miR34 we observed that Numb was also specifically downmodulated (Fig.   6b). [score:3]
Boon et al. [7] have shown that miR34 is involved in cardiac aging and its downmodulation through LNA inhibition supports cardiac repair in mice after AMI (acute myocardial infarction). [score:3]
The indication of this downmodulation by miR34 prompted us to test if the role of miR34 can be due to the Numb overexpression after Ant34 treatment. [score:3]
The ability of miR34 to downmodulate c-Kit has been demonstrated in colon cancer cells [16], where it has been linked to p53 expression. [score:3]
It is possible to assess that in the dividing population miR34 is less expressed compared with the quiescent population (result of three independent experiments on five different CDCs populations p ≤ 0.05) Real-time PCR of total RNA from 32 biopsies. [score:2]
Mir34 expression in cardiac human specimens vs age. [score:2]
MiR34 has been reported to target different genes in various cellular system that can account its function. [score:2]
In these cells, miR34 modulates, in vitro, various genes that are clearly involved in cardiac development and/or repair. [score:2]
As already found in cancer stem cells [17], miR34 plays an apparent bimodal role, regulating as Notch as Numb pairwise. [score:2]
MiR34 expression in Cardiac stem cells subpopulation. [score:2]
We observed that the less proliferating (CSFE++) cells had a higher expression of miR34 compared with the more proliferating cells (CSFE--). [score:2]
Our results show that miR34 has a complex role in human cardiac progenitor cells, where its downmodulation induces a cascade essential for cardiac repair, as assessed in mouse mo dels [7]. [score:1]
First, we tried to evaluate the miR34 expression in proliferating CSs cells. [score:1]
MiR34 expression directly correlates with age in human biopsies (r = 0.125037328, p = 0.010672365) a FACS analysis to evaluate Ant34a 5' FITC-LNA’s ability to enter into human CDCs/CSs by gymnosis after treatment (50 nM for 24 h). [score:1]
One of the most promising miRNAs in this regard is miR34 (reviewed by Li et al. [4]), which acts as a controller in reprogramming efficiency, while miR34 ablation shows a higher susceptibility to induced progenitor stem cells (iPSC) generation without compromising self-renewal and differentiation [5]. [score:1]
We observed, after miR34 downmodulation, an increase of Notch and its downstream-activated gene hey-1. In cardiac progenitor cells Notch-1 activation, with the nuclear translocation of Notch-1 intracellular domain (N1ICD), stimulates proliferative signaling such as G1/S cyclins and p38 (revised by Li and coworkers [24]) in vitro, induces myocytes differentiation [25], MAPK activity and promotes immature cardiomyocytes expansion. [score:1]
In particular, our results indicate that miR34 downmodulation plays a role in human cardiac progenitor proliferation. [score:1]
The authors deduced that the repair activity could be also due to the increased vascularization in the infarcted zone in in vivo mouse mo del, where LNA34 antisense (Ant34) treatment induces angiogenesis and promotes proliferation in endothelial progenitor cells and Human Umbilical Vein Endothelial Cells (HUVECs) 7, 8. The aim of this work was to establish whether the cardiac repair activity of miR34 inhibition could be used for human heart treatment, evaluating in vitro the influences of Ant34 in human heart cardiac stem cells. [score:1]
Our study indicates, for the first time, to the best of our knowledge, that the role of miR34 downmodulation in cardiac repair can also be held by Numb, which has been found to be important in cardiac morphogenesis [19]. [score:1]
[1 to 20 of 37 sentences]
11
[+] score: 106
Recently, a number of studies have provided compelling evidence that members of the miRNA-34 family (hereafter abbreviated as miRNA-34) such as miRNA-34a, miRNA-34b and miRNA-34c are direct transcription targets of the tumor suppressor protein p53, having the potential to regulate both apoptosis and cell proliferation [12]. [score:7]
A recent study reinforces this proposition: cells exposed to a DNA double-strand break agent (doxorubicin: DOX) demonstrated that only simultaneous inhibition or forced expression of miRNA-34a and miRNA-34c resulted in the inhibition or induction of DOX -mediated apoptosis [39]. [score:7]
A further increase in miRNA-34a expression and an elevated expression of miRNA-34b and miRNA-34c were detected in p53 [+/+ ]embryos exposed to 20 mg/kg, a dose, to which a part of embryos are still able to resist. [score:5]
It also suggests for the first time that in some embryonic tissues p53-independent mechanisms may exist, contributing to teratogen -induced activation of miRNA-34a and miRNA-34c, whereas teratogen -induced suppression of miRNA-125b and miRNA-155 expression may be p53 dependent. [score:5]
Therefore, our question was whether miRNA-34 may be among targets engaged by p53 to regulate teratologic susceptibility of embryos. [score:4]
Given the potential involvement of miRNA-34, miRNA-125b and miRNA-155 in the mechanisms regulating teratologic susceptibility of embryos, we chose to explore whether CP alters the expression of the miRNAs in the embryonic limbs and how the alterations correlate with the embryonic p53 genotype and CP -induced limb phenotypes. [score:4]
We observed that the expression of all tested miRNA-34 family members was elevated in the limbs of CP -treated p53 [+/+]embryos. [score:3]
Yet, in the studies cited above and studies addressing the expression of miRNA-34a only [32], DNA-damaging stress -induced activation of the miRNA-34 family was found to be highly p53 dependent. [score:3]
When females were treated with 20 mg/kg CP, the level of miRNA-34b and miRNA-34c expression in the limbs of p53 [+/+ ]embryos were statistically significantly higher than that in the limbs of controls but obviously lower than miRNA-34a levels. [score:3]
No differences in the levels of miRNA-34b and miRNA-34c expression were observed in fore- and hindlimbs of control p53 [+/+ ]and p53 [-/- ]embryos (data not presented). [score:3]
The objectives of this study were formulated as follows: 1) to evaluate whether CP -induced teratogenic insult alters the expression of several miRNAs (miRNA-34, miRNA-125b and miRNA-155) in mouse embryonic limbs and to what extent these alterations are mediated by p53; and 2) to estimate how CP -induced alterations in the expression of the miRNAs correlates with CP -induced limb phenotypes. [score:3]
On the other hand, unlike miRNA-34 ability to act in concert with p53, miRNA-125b and miRNA-155 seem to have the potential to function as inhibitors of CP -induced p53 -mediated apoptosis. [score:3]
At the same time, the expression pattern of the miRNA-34 did not change in embryos exposed to a dose of 40 mg/kg severely affecting all embryos. [score:3]
In addition, an elevated expression of miRNA-34a and miRNA-34c was detected only in less teratologically sensitive forelimbs of p53 negative embryos. [score:3]
This study demonstrates that teratogen -induced limb dysmorphogenesis may be associated with alterations in miRNA-34, miRNA-125b and miRNA-155 expression. [score:3]
Influence of CP on miRNA-34b and miRNA-34c expression. [score:3]
Besides, this dose of CP resulted in a statistically significant increase in miRNA-34c expression in the forelimbs of p53 [-/- ]embryos. [score:3]
In the light of the above data, the activation of miRNA-34 and suppression of miRNA-125b and miRNA-155 in the limbs of CP -treated embryos may be suggested as pathogenetic events in CP -induced apoptosis and, hence, CP -induced limb dysmorphogenesis. [score:3]
Interestingly, however, miRNA-34c expression was practically identical in the limbs of CP -treated p53 [+/+ ]and p53 [-/- ]embryos. [score:3]
The expression of miRNA-34b and miRNA-34c was not altered in the limbs of embryos exposed to 12.5 mg/kg CP (Figure 1). [score:3]
Yet, the levels of miRNA-34, miRNA-125b and miRNA-155 expression were found to be practically identical in the hindlimbs and the forelimbs of p53 -positive embryos. [score:3]
It also supposes that miRNA-34a may act in cooperation with miRNA-34c, which is predicted to have the same seed regions and mRNA targets [31]. [score:3]
Increased miRNA-34b and miRNA-34c expression was also observed. [score:3]
These data are in agreement with those obtained in earlier studies that addressed the effect of p53 on miRNA-34 expression in mice exposed to ionizing radiation [29, 30]. [score:3]
Figure 1Expression of miRNA-34, miRNA-125b and miRNA-155 in the forelimbs (FL) and hindlimbs (HL) of p53 [+/+ ]and p53 [+/+ ]embryos of mice exposed to different doses of CP. [score:3]
By contrast, in our work, miRNA-34a and miRNA-34c were found to be activated not only in the limbs of CP -treated p53 [+/+ ]embryos but also in the forelimbs of CP -treated p53 knockout embryos. [score:2]
Interestingly, miRNA-34a was identified as being strongly regulated by p53 regardless of cell type or stress [31], and in our study, the magnitude of CP -induced activation of miRNA-34a in the limbs of p53 [+/+ ]embryos was also significantly higher than that of miRNA-34b and miRNA-34c. [score:2]
Finally, we observed miRNA-34a and miRNA-34c activation in the forelimbs of CP -treated p53 knockout embryos. [score:2]
In a large number of studies, members of the microRNA (miRNA)-34 family such as miRNA-34a, miRNA-34b, miRNA-34c, as well as miRNA-125b and miRNA-155, have been shown to be regulators of apoptosis. [score:2]
Altogether, our data demonstrate for the first time that in some embryonic tissues p53-independent mechanisms may exist, contributing to teratogen -induced activation of miRNA-34a and miRNA-34c. [score:1]
These observations seemingly suggest the possibility of miRNA-34a and miRNA-34c mediating CP -induced apoptosis in the forelimbs of p53 [-/- ]embryos. [score:1]
The analysis of studies addressing the biological activities of miRNA-34, miRNA-125b and miRNA-155 strongly suggests that all tested miRNAs may be involved in the mechanism of determining the response of the embryo to CP -induced teratogenic stimuli. [score:1]
It also suggests for the first time that p53-independent mechanisms exist contributing to teratogen -induced activation of miRNA-34a and miRNA-34c. [score:1]
Of note, this dose activated miRNA-34a and miRNA-34c in the forelimbs of p53 [-/- ]embryos. [score:1]
Whereas the levels of miRNA-34 increased in CP -treated embryos, miRNA-125b and miRNA-155 levels clearly tended to decrease in the limbs of p53 [+/+]embryos exposed to 40 mg/kg CP. [score:1]
Evaluation of the expression of miRNA-34, miRNA-125b and miRNA-155 was performed in the fore- and hindlimbs of p53 [+/+ ]and p53 [-/- ]embryos collected 24 hours after CP injection. [score:1]
The miRNA-34 is activated by p53 being able to mediate p53 -induced proapoptotic and antiproliferative effects. [score:1]
Of note, this miRNA is suggested to be the most stress-sensitive member of the miRNA-34 family [31], whereas the dose of 12.5 mg/kg is a threshold teratogenic dose for these embryos. [score:1]
[1 to 20 of 38 sentences]
12
[+] score: 90
miR-449 and miR-34 have the same inhibitory seed sequence and function together in mouse development, such that knockout of either miR-449 or miR-34 paralogs alone does not yield a detectable developmental phenotypes, whereas knockout of both sets of miRNAs mice show defects in brain development and spermatogenesis caused, at least in part, by defective microtubule and associated cilia function [22]. [score:8]
Each point represents an individual sample a– b qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in all samples, normalized to the overall average expression to generate a relative expression value. [score:5]
Among hundreds of miRNAs detected, multiple members of the miRNA family miR-34/449, which all code for the same mRNA inhibitory seed sequence, had the most significant differences in expression between the ACE groups. [score:5]
Thus, the severe decrease in expression of both miR-449a and miR-34c we detect in early embryos from stressed male mice could alter brain development and the process of spermatogenesis in subtler ways than knockout mice. [score:5]
Here, we find that severe early life stress is associated with a reduction in sperm of both mice and men of the levels of multiple members of 34/449 miRNA family that all have the same seed sequence and function together to influence brain development and spermatogenesis 22, 23. miR-34 expression has also been implicated in stress regulation in the adult brain 24– 26. [score:5]
c Correlation plot comparing miR-449a expression to miR-34c expression in individual samples fitted with single-variable linear regression. [score:5]
Fig. 2 a– b qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in all samples, normalized to the overall average expression to generate a relative expression value. [score:5]
miR-449a and miR-34c are downregulated in sperm across generations and in early embryos derived from them in a mouse mo del of early life stress. [score:4]
The levels of the miR-449a and miR-34c are coordinately expressed in each sample (r = 0.913, P = 0.001), implying that stress regulates their levels in sperm by the same mechanism (Fig. 2c). [score:4]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, bSperm miRNA content has been shown to be influenced by smoking 29, 30 and obesity 31, 32; however, in univariate regression analysis neither BMI nor smoking status were significantly associated with expression of sperm miR-449a or miR-34c (Extended Data, Table 1). [score:3]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b Sperm miRNA content has been shown to be influenced by smoking 29, 30 and obesity 31, 32; however, in univariate regression analysis neither BMI nor smoking status were significantly associated with expression of sperm miR-449a or miR-34c (Extended Data, Table 1). [score:3]
b– c Correlation plot comparing relative expression of miR-449a to miR-449b (b) and miR-34b to miR-34c (c) for individual samples fitted with single-variable linear regression. [score:3]
ACE score negatively correlates with expression of miR-449a and miR-34c in 28 human sperm samples. [score:3]
The fact that we detect reduction in expression of paralogs of both miR-34 and miR-449 genes in sperm of men with high ACE scores, as well as in sperm of mice exposed to sociability stress and in embryos derived from them, adds to the potential functional significance of these findings. [score:3]
Consistent with this hypothesis, we discovered large decreases in the expression of both miR-449a and miR-34c in embryos isolated at the 2-cell, 4-cell, 8-cell, and morula stages (~two–tenfold) from the mating of stressed males to control females, compared to those from the mating of control males (Fig. 3b, c). [score:2]
Interestingly, miR-34 paralogs have also been implicated in regulating the stress response in adult mice, although the findings are somewhat contradictory 24– 26. [score:2]
To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Second, complete knockout of all miR-34 paralogs has no effect on basal anxiety, only changes induced by acute stress [22]. [score:2]
a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
a qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in pooled mature motile sperm isolated from stressed or control mice, n = 4–6 males per pool, 1 pool per group. [score:1]
Because the relative levels of miR-449a and miR-449b, as well as miR-34b and miR-34c, were similar to each other in almost every sample (Fig. 1b, c) miR-449a and miR-34c were used as representatives of each family. [score:1]
One set includes two of the three paralogs of miR-449, miR-449a, and miR-449b, and the other set, two of the three paralogs of miR-34, miR-34b, and miR-34c. [score:1]
Levels of miR-449a and miR-34c are decreased in sperm of male mice exposed to chronic social instability stress, early embryos derived from them, and sperm from adult mice derived from these embryos. [score:1]
b– c qPCR analysis of miR-449a (b), miR-34c-5p (c) in pooled F1 embryos derived from mating control females with stressed or unstressed males. [score:1]
Fig. 1 a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
Finally, we have observed severe decreases in miR-34c levels in early embryos derived from stressed males. [score:1]
However, a significant association was observed between sperm morphology score and levels of miR-449a, but not miR-34c. [score:1]
We found a statistically significant inverse correlation between ACE score and levels of both miRNAs (miR-449a r = −0.4357, P = 0.0205; miR-34c-5p r = −0.397, P = 0.0376), where many of the highest ACE score samples had miR-449a and miR-34c levels as much as ~300-fold lower than many of the low ACE score samples (Fig. 2a, b). [score:1]
Fig. 3 a qPCR analysis of miR-449a, miR-34c-5p, miR-152-3p, and miR-375-3p in pooled mature motile sperm isolated from stressed or control mice, n = 4–6 males per pool, 1 pool per group. [score:1]
If a similar phenomenon occurs in humans, we predict that reductions in the levels of sperm miR-449a and miR-34c we detect in men with high ACE scores could be transmitted to their sons. [score:1]
However, to date we have not been able to detect significant changes in its levels in brain regions of adult females derived from these embryos, where these studies have documented the consequences of altering all three paralogs of miR-34. [score:1]
Interestingly, both sharply reduced levels of sperm miR-449 and miR-34 family members and severe stress have been found to be associated with reduced sperm quality and fertility in men 32, 36. [score:1]
When male embryos from stressed fathers reached adulthood, levels of their sperm miR-449a and miR-34c were assayed, and found to also be severely suppressed (~tenfold) compared to those from control males (Fig. 3d), consistent with our previous finding that these mice transmit stress phenotypes to their F2 offspring [15]. [score:1]
The discovery that low levels of multiple members of the miR-34/449 gene family are associated with men’s high ACE scores also has potential implications for the next generation. [score:1]
In mice, the effect of stress on these sperm miRNAs crosses generations, as reductions in miR-449a and miR-34c are found in both early embryos derived from stressed fathers and in sperm of males derived from these embryos. [score:1]
If so, this process could yield another explanation for why some men in our survey display low miR-449a and miR-34c levels despite reporting low ACE scores. [score:1]
Both miR-449a and miR-34c are sharply reduced in sperm of these stressed males when they are adults (~fivefold) (Fig. 3a). [score:1]
[1 to 20 of 38 sentences]
13
[+] score: 81
Moreover, by carefully examining the negatively correlated expression of the individual miRNAs and target genes, we found that PLCXD3, a phospholipase that hydrolyzes phospholipids into fatty acids, may be a novel target of miR-34c-3p. [score:7]
The cells (GC-1, TM4 and NCM460 cells) were transfected with the indicated miRNA mimics and inhibitors (hsa-miR-34c-3p mimic: 5′-aaucacuaaccacacggccagg-3′, hsa-miR-34c-3p mimic inhibitor: 5′-ccuggccgugugguuagugauu-3′; negative control mimic: 5′-uuuguacuacacaaaaguacug-3′; negative control inhibitor: 5′-caguacuuuuguguaguacaaa-3′). [score:7]
The downregulation of miR-34c in our microarray results may affect germinal lineage differentiation, which closely correlates with the low sperm concentration in SO disease. [score:6]
This downregulation was efficiently prevented by the miR-34c-3p inhibitor. [score:6]
miR-34c-3p downregulates PLCXD3 expression. [score:6]
The pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, USA) was used to confirm the function of the putative miR-34c-3p binding site in the 3′-UTR of PLCXD3. [score:5]
Recently, miR-34c was reported to regulate a number of targets, including Nanos2 [20], p53 [21] and RARg [22], which are mostly involved in the biological process of male germ cell differentiation. [score:4]
Subsequently, we discovered and constructed a post-transcriptional regulatory network with the miRNA-target gene pair miR-34c-3p and PLCXD3 (Phosphatidylinositol-Specific Phospholipase C, X Domain Containing 3) to shed light on the interplay between mRNAs and miRNAs. [score:4]
These results supported the hypothesis that miR-34c-3p directly targeted the PLCXD3 3′-UTR. [score:4]
Furthermore, the luciferase activity and the level of the PLCXD3 protein were downregulated by the miR-34c-3p mimic. [score:4]
The correlation between the expression levels of miR-34c-3p and PLCXD3 provides valuable data for the analysis of spermatogenic dysfunction in male infertility. [score:3]
Confirmation of PLCXD3 as the target gene of miR-34c-3p. [score:3]
This finding suggests that PLCXD3 is a target of miR-34c-3p. [score:3]
Based on the miRNA-mRNA interaction analysis and the results of the PIAT, RNAhybrid, and DIANA predictions, PLCXD3 was a potential target gene of miR-34c-3p (Table 2). [score:3]
Moreover, the western blots suggested that miR-34c-3p repressed the expression of PLCXD3 at the protein level (Figure 8). [score:3]
In this study, we observed an inverse relationship between the expression of miR-34c-3p and PLCXD3 in SO patients. [score:3]
Mouse spermatogonia GC-1 (A), Mouse Sertoli TM4 cells (B), and human colonic epithelial NCM460 cells (C) were transfected with miR-34c-3p mimic/inhibitor (50 nM, 100 nM, respectively), or negative control mimic/inibitor (50 nM, 100 nM, respectively) and PLCXD3 protein levels assayed 48 h post-transfection by Western blot (two technical replicates). [score:2]
Our results are the first to indicate that PLCXD3 was regulated by miR-34c-3p and played an important role in testicular failure. [score:2]
Figure 8Mouse spermatogonia GC-1 (A), Mouse Sertoli TM4 cells (B), and human colonic epithelial NCM460 cells (C) were transfected with miR-34c-3p mimic/inhibitor (50 nM, 100 nM, respectively), or negative control mimic/inibitor (50 nM, 100 nM, respectively) and PLCXD3 protein levels assayed 48 h post-transfection by Western blot (two technical replicates). [score:2]
We also found that the 3′-UTR region of the PLCXD3 region contains one highly conserved miR-34c-3p -binding site (Figure 7A). [score:1]
The blank vector (pmirGLO-Control) has no seed -binding site, and thus firefly luciferase activity was not affected by miR-34c-3p. [score:1]
miR-34c was observed in the late stages of meiosis (pachytene spermatocytes and round spermatids) and is likely to influence the germinal phenotype [19, 20]. [score:1]
Verification of posttranscriptional repression of PLCXD3 by miR-34c-3p in multiple cell types. [score:1]
[1 to 20 of 23 sentences]
14
[+] score: 66
To study miRNA-34c-5p, which we found to be upregulated by sevenfold in the DRGs at PID-8 following tumour induction, we designed an inhibitor of 14 nucleotides long to target miR-34c-5p specifically, i. e. without affecting other miR-34c family members, and a corresponding mismatch control inhibitor (Supporting Information Table S1). [score:10]
Moreover, functionality of intrathecally delivered inhibitors or mimics was validated via qRT-PCR -based expression analysis on lumbar L3, L4 and L5 DRGs 24 h after injection (examples with knockdown of miR-1a-3p and miR-34c-3p with their respective inhibitors in comparison with respective mismatch inhibitors is shown in Fig 2, panel C; p < 0.05 two tailed t-test). [score:10]
Our results indicate that reversing cancer -mediated overexpression of miR-1a-3p or miR-34c-5p or reversing tumour -mediated downregulation of miR-483-3p in the sensory neurons reduces tumour -associated pain. [score:6]
Our behavioural analysis in the bone-metastases mo del indicated that inhibiting the tumour -induced upregulation of miR-1a-3p or miR-34c-5p, but not of miRNA-544-3p, in sensory neurons markedly attenuated tumour -mediated hyperalgesia. [score:6]
* denotes p = 0.0003 on PID-7 & 9, < 0.0001 on PID-11 & 14 in the mismatch -inhibitor group; 0.0018 on PID-5 and < 0.0001 on PID-14 in the miR-34c-5p -inhibitor group and 0.0001 on PID-5 through 15 in the vehicle group; † denotes p < 0.0001 on PID-7, 0.0009 on PID-9, 0.05 on PID-11 as compared to corresponding data point in the mismatch inhibitor group; and ‡ denotes p < 0.0001 on PID-7 & 9, 0.0518 on PID-11 as compared to corresponding data point in the vehicle group. [score:5]
Change in frequency of paw withdrawal to plantar application of a von Frey filament force of 0.07 g following induction of tumor growth in the calcaneous bone of the heel in mice receiving intrathecally delivered miR-34c-5p inhibitor (red symbols) or the corresponding mismatch inhibitor (green symbols) or vehicle (grey symbols). [score:5]
* denotes p < 0.0001 on PID-5 through 14 in the vehicle and mismatch inhibitor groups, 0.006 on PID-5 and < 0.0001 on PID-14 for miR-34c-5p- inhibitor group as compared to basal; † denotes p < 0.0001 on PID-7, 9 & 11 as compared to corresponding data point in the mismatch inhibitor group; ‡ denotes p < 0.0001 on PID-7, 9 & 11 as compared to corresponding data point in the vehicle group. [score:4]
Mechanical response thresholds calculated as von Frey filament strength required to achieve 50% withdrawal frequency following induction of tumor growth in the calcaneous bone of the heel in mice receiving intrathecally delivered miR-34c-5p inhibitor (red bars) or the corresponding mismatch inhibitors (green bars) or vehicle (grey bars). [score:3]
In panel (C), * denotes p = 0.02 for miR-1a-3p, 0.04 for miR-34c-3p as compared to corresponding mismatch inhibitor and in panel (D), * denotes p = 0.001 for miR-370-3p and <0.0001 for miR-291b-5p as compared to non -targeting mimic, ANOVA followed by post hoc Fischer's test, n = 3 per group. [score:3]
Several notable pain modulatory genes are to be found amongst the in silico prediction list of miR-34c-5p target genes, including Cacnb3 (the gene encoding calcium channel, voltage -dependent, beta 3 subunit), Gabra3 and Gabra1 (encoding GABA-A receptor, subunits alpha 3 and 1, respectively), Scn2b (sodium channel, voltage-gated, type II, beta), Bdnf (encoding brain derived neurotrophic factor), Calca (encoding calcitonin/calcitonin-related polypeptide, alpha), Il6st (encoding interleukin 6 signal transducer), Ednrb (endothelin receptor type B), amongst many others, which are known to significantly impact on pain (De Jongh et al, 2003; Enna & McCarson, 2006; Griswold et al, 1999; Knabl et al, 2008; Li et al, 2012; Murakami et al, 2007; Obata & Noguchi, 2006; Pedersen et al, 2007; Quarta et al, 2011; Waxman, 2010). [score:3]
When the data were analysed as response thresholds (Fig 3, panel D) or AUC (Supporting Information Fig 2, panel B) of stimulus–response frequency curves for von Frey strength ranging from 0.02 to 1.0 g, treatment with the miR-34c-5p inhibitor was found to impart a significant level of protection against tumour -associated mechanical hypersensitivity. [score:3]
Further detailed analyses will reveal which of these putative targets mediate the pronociceptive functions of miR-34c-5p and miR-370-3p in the context of cancer pain. [score:3]
In contrast, mice, which received miR-34c-5p inhibitor from PID-4 to PID-9 did not show significant tumour -associated mechanical hypersensitivity to 0.07 g force on days PID-7, PID-9 and PID-11 (Fig 3, panel C). [score:3]
Here, miR-34c-5p emerged as another key pronociceptive miRNA, which is induced in sensory neurons of the DRG in bone metastatic pain. [score:1]
Following our protocol, we identified three miRNAs namely miR-1a-3p, miR-34c-5p and miR-370-3p to be enhancing tumour-pain and miR-483-3p to counteract it. [score:1]
[1 to 20 of 15 sentences]
15
[+] score: 54
Strikingly, 13 of the 22 upregulated genes contained 3′UTR miR-34 ‘seed’ matches and were predicted targets of the miR-34 family (Fig. 5 A–B). [score:6]
We performed a microRNA -expression screening and identified 5 members of the miR-34 family (miR-34bc and miR-449abc) as highly expressed from late meiosis to the sperm stage. [score:5]
The same onset of expression in the adult was observed with sustained miR-34c expression detected throughout meiosis and spermiogenesis (Fig. 2F). [score:5]
From the 9 validated miR-34 target genes identified, the forkhead transcription factor FoxJ2 merits special interest as it contains two highly conserved miR-34 binding sites and has been shown that transgenic levels of FoxJ2 overexpression are incompatible with male fertility [40]. [score:5]
The word corresponding to seed matching miR-34 family (Red) is enriched in the up-regulated genes. [score:4]
The expression of the miR-34 family members is summarized from the array data. [score:3]
The spatial expression of miR-34c (Green) is shown by in situ hybridization on sections of 14 dpp mouse testis, the section were counterstained with anti-γH2AX (Red) antibodies to precisely identify the meiotic stage. [score:3]
For the miR-34bc loss of function allele, the targeting strategy allows for Cre -mediated deletion of the hairpins that encode both miR-34b and miR-34c. [score:3]
Representative data is shown from two independent experiments in panel C and D. (E) The onset of miR-34c expression in early pachytene spermatocytes during the first wave of spermatogenesis. [score:3]
miRNA in situ coupled with immunostaining of γH2AX as a meiotic marker revealed the onset of miR-34c expression in early pachytene spermatocytes within the first wave (Fig. 2E). [score:3]
Thus in combination with the histological analysis we can conclude that the miR-34 family has multiple functions during spermatogenesis both in regulating meiosis as well as the later stages of spermiogenesis (Fig. 4F). [score:2]
This unbiased approach revealed a highly significant enrichment (p = 2.44×10 [−9]) for the complementary seed match of miR-34 family (CACTGCC) in the cohort of most unregulated genes (Fig. 5D). [score:2]
Representative images from one of three independent experiments are shown for panel E and F. The miR-34 family genes are proven important regulators of cell fate and physiology. [score:2]
The miR34a locus also regulates cardiac function upon aging, however none of the individual miR-34 family gene disruptions affects fertility in mice (Fig. S2) [32], [34]– [36]. [score:2]
The miR-34b and miR-34c miRNAs are derived from a single non-coding transcriptional unit. [score:1]
The miR-34b/c miRNAs are part of a miR-34 family encompassing six miRNAs (miR-34a, b, c and 449a, b, c) encoded by three distinct loci (miR-34a, miR-34b/c and miR-449) (Fig. 2B). [score:1]
Position of the DNA encoding the pre-miR-34b and pre-miR-34c are indicated. [score:1]
Also indicated is the gene function as well as number of miR-34 binding sites. [score:1]
Representative images from one of three independent experiments are shown for panel E and F. (A) qRT-PCR of miR-34a, miR-34b, miR-34c and miR-449a from control (Ctl) and miR-34bc [−/−];449 [−/−] adult testis. [score:1]
In situ hybridization was performed using LNA-probes with 3′-DIG label (Exiqon) for mir-34c. [score:1]
[1 to 20 of 20 sentences]
16
[+] score: 47
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-10b, mmu-mir-34b, mmu-mir-34a
The miR-34 family targets MCM5 directly, and overexpression of these miRNAs causes downregulation of other MCMs and DNA replication genes to negatively regulation cell cycle progression [25, 33, 47, 48]. [score:10]
Furthermore, overexpression of the miR-34 miRNAs, but not other miRNAs, significantly inhibited DNA replication (Fig 7A). [score:5]
Although miR-34 mainly repressed MCM5 as indicated by the luciferase assay (Fig 6B), supporting the finding that it is a direct target of miR-34a in the context of the RISC [47], overexpression of the miR-34s individually diminished MCM2-7 mRNA and protein (Fig 6D and 6E). [score:5]
Among the miRNAs that are significantly upregulated by endogenous and exogenous RS, we found miR-10b, 27b, 181a and all the members of the miR-34 family miRNAs. [score:4]
Trp53 -dependent microRNAs represses MCM2-7 expression in response to RSWe previously reported that MCM2-7 repression in Chaos3 cells occurs at the post-transcriptional level, is dependent upon Drosha and Dicer, and is paralleled by an increased levels of the miR-34 family of microRNAs [33]. [score:3]
Numerous reports demonstrated that miR-34 miRNAs impact cell cycle progression partly by targeting DNA replication genes, including MCMs [25, 47, 48]. [score:3]
miR-34 deletion partially rescued MCM2-7 pan-reduction in HU -treated primary WT MEFs (Fig 7B), complementing the previous experiments in which overexpression of miR-34s decreased MCM levels. [score:3]
Among the RS responsive miRNAs we studied, only the miR-34 family miRNAs caused MCM2-7 pan-reduction upon ectopic expression (Fig 6D and 6E), a scenario similar to MCM2-7 repression after RS induction. [score:3]
We also found potential targeting of the Mcm7 3’UTR by miR-34, despite the lack of in silico-predicted binding sites (Fig 6B). [score:3]
These results indicate that miR-34 expression contributes to both endogenous and exogenous RS -induced MCM2-7 repression in vivo and in vitro. [score:3]
Primary WT MEFs transfected with miR-34 miRNA mimics for 48h significantly inhibit DNA replication (two sided t-test, *, p<0.05, **, p<0.005), but not miR-10b, 27b or 181a mimics. [score:3]
We previously reported that MCM2-7 repression in Chaos3 cells occurs at the post-transcriptional level, is dependent upon Drosha and Dicer, and is paralleled by an increased levels of the miR-34 family of microRNAs [33]. [score:1]
The 34T KO reduced MN levels in Chaos3 mice by ~20% (Fig 7D), and this reduction in MN was sensitive to miR-34 genetic dosage (S6 Fig). [score:1]
[1 to 20 of 13 sentences]
17
[+] score: 43
Kumamoto K Nutlin-3a activates p53 to both down-regulate inhibitor of growth 2 and up-regulate mir-34a, mir-34b, and mir-34c expression, and induce senescenceCancer Res. [score:11]
Recent reports demonstrate that inhibition of the miR-34 family does not promote tumorigenesis, supporting the potential for therapeutic suppression of this family as a treatment for BPD [56]. [score:5]
To address whether miR-34 expression was required and sufficient for the hyperoxia -induced lung injury and inflammation leading to the BPD pulmonary phenotype, we next asked whether only miR-34a overexpression itself was sufficient, in the absence of hyperoxia i. e., in RA. [score:5]
Given that the miR-34 family has been implicated in the p53 tumor suppressor network, and that p53 pathway defects are common features of human cancer [25], miR-34 inhibition therapy is considered a promising therapeutic approach [26]. [score:4]
Of note, miR-34 family members also have been recognized as tumor suppressor miRNAs. [score:3]
miR-34 overexpression in RA restores the BPD phenotype. [score:3]
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
a Representative graphs showing miR-34 expression in WT NB mice exposed to hyperoxia for 2, 4, and 7 days after birth and in the BPD mo del. [score:3]
In addition, in the PN7 HALI mo del, Ang1 treatment showed improved Ki67 staining levels similar to that of the miR-34 (−/−) mice lungs (Supplementary Fig.   7). [score:1]
b The wild-type Ang1 3′ UTR reporter vector was co -transfected into the MLE12 cells with either the N. C. mimic or miR-34a mimic c The WT Tie2 3′ UTR reporter vector was co -transfected into the MLE12 cells with either the N. C. mimic or miR-34-a mimic. [score:1]
Choi YJ miR-34 miRNAs provide a barrier for somatic cell reprogrammingNat. [score:1]
Concepcion CP Intact p53 -dependent responses in miR-34 -deficient micePLoS Genet. [score:1]
In addition, miR34a−/− mice [71] and conditional miR-34 [fl/fl] [72] (JAX laboratory) and SPC-CreER (gift from Brigid Hogan, PhD, Duke University, USA) were housed in the Yale and Drexel Universities Animal Care Facilities (New Haven, CT and Phila delphia, PA, respectively). [score:1]
Representative bar graph showing tamoxifen deletion of miR-34a in Spc CRE positive miR-34 KO lungs (T2-miR34a [−/−]). [score:1]
[1 to 20 of 14 sentences]
18
[+] score: 42
Of the five MYCN -targeting miRNAs with positive correlation to MYCN expression or activity (Fig. 2A), three miRNAs, miR-19b-3p, miR-19a-3p and miR-34c-5p, showed induction of expression (Fig. 5), supporting the assumption that MYCN induces the expression of these miRNAs. [score:9]
The MYCN mo del systems, however, cannot confirm the positive correlation between miR-34c-5p and miR-449a and MYCN expression or activity observed in primary neuroblastoma tumors: miR-34c-5p is consistently downregulated in the murine mo dels, whereas the expression of miR-449a is not altered. [score:8]
The 2 remaining positively correlated miRNAs, miR-34c-5p and miR-449a, are, respectively, significantly downregulated and not regulated during tumor development (Fig. 4B). [score:6]
Considering the 5 MYCN -induced miRNAs, the data in the LSL- MYCN;Dbh-iCre tumors again fully recapitulated the findings from the TH-MYCN progression mo del: miR-19a-3p, miR-19b-3p and miR-494-3p showed increased expression in tumors compared to wild-type control tissue (Fig. 4D), whereas miR-34c-5p and miR-449a are respectively significantly downregulated and not regulated in LSL- MYCN;Dbh-iCre tumors. [score:6]
Nevertheless, the different relation between MYCN and miR-34c-5p expression in MYCN non-amplified versus amplified environment should not be surprising: activation of miR-34c-5p, either direct or indirect, could be one of the mechanisms through which normal physiological levels of MYCN affect apoptosis. [score:5]
In cases where MYCN exceeds its physiological levels and oncogene -induced apoptosis is triggered, a transforming cell will need to circumvent MYCN -mediated apoptosis, for instance via downregulation of miR-34c-5p, which seems to occur in TH-MYCN and LSL- MYCN;Dbh-iCre tumors. [score:4]
Although the expression of miR-34c-5p increases upon MYCN activation in the in vitro, the upstream region of miR-34c-5p does not contain E-box sequences (data not shown), and miR-449a, residing in the second intron of CDC20B, was not identified by Shohet and colleagues [24] in their screen for intronic miRNAs regulated by MYCN. [score:4]
[1 to 20 of 7 sentences]
19
[+] score: 41
In order to determine if the number of significant correlations within a behavioural category was overrepresented, we conducted Fishers Exact Tests which showed that behaviour traits in general were overrepresented with miR-31 expression (p < 0.05) and cocaine related traits were overrepresented with both miR-34c expression (p < 0.05) and miR-212 expression (p < 0.1) (see Table  5). [score:7]
More specifically, this gene was upregulated following acute and chronic stress, and lenti-virus mediated overexpression of miR-34c in the amygdala induced anxiolytic behaviour after challenge. [score:6]
This gene has also been shown to be elevated in the hippocampus of Alzheimer’s disease patients and the corresponding mouse mo dels, and overexpressing miR-34c leads to memory impairment [48]. [score:5]
More specifically, miR-34c is thought to act as a tumor suppressor as part of a negative feedback loop including Myc and Mapkapk5, part of the MAPK signalling pathway [52]. [score:3]
We found significant correlations between both miR-34c and miR-212 expression and cocaine-related behaviours. [score:3]
We found that the MAPK signalling pathway is enhanced for miR-34c, and while miR-34c was not significantly associated with Mapkapk5 expression (r = -0.24, p = 0.27), it was with Mapkapk3 (r = 0.55, p = 0.009). [score:3]
The η [2] values for miRNA gene expression by strain are 0.21, 0.33, 0.28, 0.27 and 0.37 for miR-15b, miR-31, miR-34c, miR-212 and miR-301a, respectively. [score:3]
Additionally, miR-34c has been shown to reduce the cellular response to corticotrophin releasing factor receptor type 1 (CRFR1), possibly acting via a miR-34c target site on the CRFR1 mRNA [47]. [score:3]
Together these findings suggest a role for miR-34c in regulating the central stress response. [score:2]
The mature miRNA expression for the five miRNAs miR-15b, miR-31, miR-34c, miR-212, and miR-301a were quantified in the individual BXD animals using Taqman RT-PCR assays (Applied Biosystems, Life Technologies, Foster City, CA, USA). [score:2]
A number of miRNAs have previously been shown to be altered in the brain of alcoholics, including miR-15b, miR-34c and miR-301a [39]. [score:1]
QTL analysis was conducted for miRNA expression for those miRNAs investigated in the BXD RI strains (miR-15b, miR-31, miR-34c, miR-212, and miR- 301a). [score:1]
A recent study has shown that miR-34c plays a role in anxiety at the level of the amygdala [47]. [score:1]
We found the miR-34c expression was positively correlated with open arm duration (r = 0.43, p = 0.03), a measure of anxiety. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 40
The most significantly downregulated (mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, mmu-miR-190, mmu-miR-194) and upregulated miRNAs (mmu-miR-34c, mmu-miR-124, mmu-miR-142–3p, mmu-miR-706, mmu-miR-29c) were analyzed. [score:7]
Mmu-miR-695, mmu-miR-31, mmu-miR-190, mmu-miR-183, mmu-miR-182, and mmu-miR-194 were the most significantly downregulated miRNAs, whereas mmu-miR-34c and mmu-miR-124 were the most significantly upregulated miRNAs. [score:7]
The results of the miRNA– messenger RNA regulatory networks indicated that the common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1); that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box -binding protein–associated factor (TAF4A); that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4); that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF); that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10); and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:5]
Meanwhile, the expression of mmu-miR-34c and mmu-miR-124 markedly upregulated in the corneal endothelium of old mice compared to young mice. [score:5]
The common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1), that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box binding protein (TBP) -associated factor (TAF4A), that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4), that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF), that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10), and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:4]
The qRT-PCR results demonstrated a decrease in the expression of mmu-miR-31(34.2±13.4-fold), mmu-miR-695 (19.8±4.79-fold), mmu-miR-183 (26.6±2.53-fold), mmu-miR-182 (55.2±15.3-fold), mmu-miR-194 (42.6±10.2-fold) and mmu-miR-190 (37.1±2.78-fold) in the corneal endothelium of old mice compared to young mice, whereas the expression of mmu-miR-34c and mmu-miR-124 increased 26.4±5.28-fold and 62.7±2.54-fold, respectively (Figure 2). [score:4]
Therefore, in this study, the differential expression of miR-34c suggested that p53 plays a pivotal role in cellular senescence of corneal endothelium. [score:3]
It was reported that miR-34b and miR-34c are targets of p53 and cooperate in the control of cell proliferation and adhesion-independent growth [33]. [score:3]
To validate the reproducibility of the results from the miRNA microarray, qRT-PCR analysis of (microRNAs come from mice) mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, mmu-miR-34c, mmu-miR-31, mmu-miR-190, and mmu-miR-124 was performed using the same extracted total RNA as the microarray analysis. [score:1]
These miRNAs include miR-29c, miR-34c, miR-124, miR-695, and miR-32. [score:1]
[1 to 20 of 10 sentences]
21
[+] score: 40
Given that the LNA -based miRNA inhibitors are usually designed to block the seed sequences of miRNAs, it is possible that the “miR-34c inhibitor” used in the previous report (Liu et al., 2012) might have inhibited all members of this miRNA family, thus leading to the phenotype reported. [score:7]
The “miR-34c inhibitor” used in the previous study were LNA -based RNA oligos, designed to complimentarily anneal to the target miRNAs, thereby eliciting an effect through competitive inhibition (Liu et al., 2012). [score:7]
The earlier study claiming that miR-34c, as a paternal miRNA, is essential for the first cleavage division utilized a “miR-34c inhibitor” to suppress miR-34c function by injecting the inhibitor into zygotes (Liu et al., 2012). [score:7]
If the inhibitor used did in fact block the seed sequence of miR-34c, then all five miRNAs would have been suppressed as they all share this seed sequence. [score:5]
While physiological evidence supporting essential roles of specific sperm DNA methylation and histone retention patterns in preimplantation development remains lacking, a recent study reports that injection of a “miR-34c inhibitor” into zygotes attenuated the first cleavage division after fertilization, and based on this finding, it was concluded that a single sperm-borne miRNA, miR-34c, has an essential role in the first cleavage division (Liu et al., 2012). [score:4]
Normal fertility of miR-34c or miR-449 KO males suggests that sperm-borne miR-34c or miR-449 alone is dispensable for fertilization and early development. [score:2]
Two miRNA clusters consisting of five miRNAs (miR-34b/c and miR-449a/b/c) are present in sperm, but absent in oocytes, and miR-34c has been reported to be essential for the first cleavage division in vitro. [score:1]
Since the five miRNAs (miR-34b, miR-34c, miR-449a, miR-449b and miR-449c) share the same seed sequence of “GGCAGUG”, we analyzed two possible 6nt seed sequence combinations, including one with the 1 [st]–6 [th] nt and the other with the 2 [nd]–7 [th] nt (“selected words”). [score:1]
Sperm-borne microRNA-34c is required for the first cleavage division in mouse. [score:1]
To evaluate whether miR-34c and the other 4 members of the miRNA family have an essential role in the first cleavage division both in vivo and in vitro, we analyzed miR-34b/c (Choi et al., 2011) and miR-449 (Bao et al., 2012) knockout mice, and also generated miR-34b/c; miR-449 double knockout (herein called miR-d KO) mice. [score:1]
miR-34 miRNAs provide a barrier for somatic cell reprogramming. [score:1]
However, those in vitro findings were not validated using in vivo mouse mo dels, e. g. using miR-34c -null spermatozoa for natural mating, IVF, and ICSI. [score:1]
However, the validity of this in vitro finding needs to be confirmed using in vivo mouse mo dels in which sperm are devoid of miR-34c. [score:1]
Moreover, miR-34c belongs to a family of five miRNAs including miR-34b, miR-34c, miR-449a, miR-449b, and miR-449c, which are encoded by two miRNA gene clusters: miR-34b/c and miR-449. [score:1]
[1 to 20 of 14 sentences]
22
[+] score: 39
At 30 weeks of age, the expression of miR-216 (p-value = 0.016), miR-217 (p-value = 0.0078), miR-150 (p-value =0.023), Let-7b (p-value = 0.031,) and miR-96 were significantly downregulated, whereas the expression of miR-146b (p-value = 0.0078), miR-205, (p-value - 0.0078), miR-21, miR-195 (p-value = 0.031), and miR-34c (p-value = 0.063) were significantly upregulated in KC animals compared to control animals (Figure 2B). [score:10]
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
Notably, the expression of miR-34c is activated by p53 following DNA damage and serves as an important regulator of c-Myc expression, acting downstream to the p38 MAPK/MK2 pathway [70]. [score:6]
The expressions of miR-216 and miR-217 were also progressively reduced in KC mice, but the expressions of miR-21, miR-205, miR-146b, miR-34c, and miR-223 progressively increased (Figure 1A, 2A– 2D). [score:5]
We observed downregulation of miR-146b, miR-34c, and miR-223 at 10 weeks of age; however, their expression increased with the progression of PC in KC animals compared to control animals (Figure 2A– 2D). [score:5]
On the other hand, miR-146b, miR-34c, miR-223, miR-195 (p-value = 0.031) and miR-216 (p-value = 0.063) were downregulated in KC mice compared to control littermates. [score:3]
[1 to 20 of 6 sentences]
23
[+] score: 39
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34b, mmu-mir-34a, hsa-mir-34b, hsa-mir-34c
A key regulator of tumor suppression, miR-34 is a direct transcriptional target of the tumor suppressor p53, given that the miR-34a promoter region contains a p53 -binding site [17]. [score:9]
Given that miR-34 was a candidate regulator, we determined PRKD1 mRNA expression and protein translation levels following ectopic expression of miR-34a, miR-34b, and miR-34c. [score:8]
Different miRNAs are involved in the formation and regulation of human BCSCs [7], with previous studies reporting that ectopic expression of miR-34c suppressed epithelial–mesenchymal transition and reduced self-renewal capacity in BCSCs [8]. [score:6]
Expression levels of miR-34b and miR-34c were also detected, however, no significant downregulation of either variant in MCF-7-ADR cells was observed (Supplementary Figure 1A, 1B). [score:6]
Although miR-34a, miR-34b, and miR-34c have the same seed sequence, the results indicated that PKD/PKCμ was downregulated only by miR-34a (Figure 1B). [score:4]
β-actin was used as the loading control and qRT-PCR was performed to validate PRKD1 mRNA and miR-34 variant expression. [score:3]
HEK293T cells were transiently transfected with 3′-UTR reporter constructs (1.5 μg/well in 6-well plates) and 15 nM of miR-34 family precursors (Ambion), using Lipofectamine 2000 (Invitrogen). [score:1]
The seed sequences of miR-34 from PRKD1 were mutated using PCR -based methods and the reporter constructs were verified by sequencing. [score:1]
B. Proteins, mRNAs and totalRNAs were obtained after 48-h transfection of miRNA-34 variants. [score:1]
[1 to 20 of 9 sentences]
24
[+] score: 37
Therefore, different sensitivity of these two groups of target genes, one regulating cilia assembly and the other regulating cell cycle and DNA damage response, to miR-34 suppression underlies the different phenotypic consequences brought about by overexpression and deletion of this family of miRNAs. [score:9]
Our study suggests that different functions of miR-34 family miRNAs in these overexpression and deletion studies can be explained by different sensitivity of target genes to miR-34 suppression. [score:7]
When miR-34 family miRNAs are overexpressed at levels much higher than WT levels, another group of target genes, which are less sensitive and only respond to higher than WT levels of miR-34, are suppressed. [score:7]
As a representative example, early studies have shown that overexpression of members of the miR-34 family miRNAs has potent tumor suppressor function downstream of p53 [121]. [score:5]
This group contains positive regulators of cell cycle and DNA-damage responses (i. e. Cdk4, Ccne2, and Met), whose suppression bestows anti-tumor functions to miR-34 family miRNAs [121]. [score:4]
However, mice carrying target deletion of all miR-34 genes display normal p53 responses to a variety of cellular insults, including ionizing radiation and oncogenic stress [123]. [score:3]
Deletion of all miR-34/449 family genes results in de-repression of these genes and impaired cilia assembly [122]. [score:1]
Another study reported that mice deficient of all the six miRNAs in the miR-34/449 family exhibited postnatal mortality, infertility and strong respiratory dysfunction caused by defective mucociliary clearance, resulting from a significant decrease in cilia length and number [122]. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 37
The miR-34 family is worth special attention because two of its members, mmu-miR-34a and mmu-miR-34b-5p, were significantly up-regulated one day after ENU exposure and maintained increased expression at the 5 subsequent time points up to PTD 30, while another family member, mmu-miR-34c, displayed significant over -expression at multiple time points from PTD 3 to 30. [score:8]
The miR34 family genes are the direct transcription targets of tumor suppressor p53 [32, 38]. [score:6]
Their expressions were enhanced by 3.21-fold (miR-34a), 3.11-fold (miR-34b) and 2.37-fold (miR-34c) on PTD 1 and the fold changes continued to increase and peaked at PTDs 7 or 15. [score:3]
TaqMan qPCR confirmation of the temporal expression changes of miR-34 family miRNAs. [score:3]
Confirmation of the temporal expression changes of three miR-34 family miRNAs and one miR-762 family miRNA by individual TaqMan assays. [score:2]
Figure 3 The temporal expression changes of three miR-34 family members and one miR-762 family member as determined by PCR arrays and individual TaqMan assays. [score:2]
TaqMan MicroRNA Assays were used to confirm the temporal expression changes of 3 miR-34 family members, mmu-miR-34a, mmu-miR-34b-5p, and mmu-miR-34c, as well as a miR-762 family member, mmu-miR-762. [score:2]
A comparison of miR-34 family miRNA expression measured by the two different platforms is shown in Figure 3. The results from the two real-time PCR assay platforms are very consistent and show similar temporal kinetics of miRNA expression for miR-34 family miRNAs, rising from day 1 or 3, reaching peaks at day 15, and decreasing until the end of observation, day 120. [score:2]
Among these miRNAs, the miR-34 family is worth special attention. [score:1]
miR-34b and miR-34c are encoded by the same primary transcript from chromosome 11 in human or chromosome 9 in mouse while miR-34a is located in a different chromosome [35]. [score:1]
Interestingly, our results found that miR-34b and miR-34c changed in correlated manner at all the sampling time points (Figure 3). [score:1]
miR-34c + + + + + +Induction of cell cycle arrest by joining p53 network [35]. [score:1]
Our results indicate that the miR-34 family of miRNAs seems to have the potential to be valuable biomarkers for toxicological application. [score:1]
These biological processes controlled by miRNAs in the miR-34 family are related to ENU cytotoxicity, genotoxicity, and carcinogenicity. [score:1]
Moreover, miRNAs in the miR-34 family worth further study to explore their potential as biomarkers for exposure of genotoxic carcinogens. [score:1]
miRNAs in miR-34 family play important roles in various p53-initiated biological processes. [score:1]
Another miRNA, mmu-miR-762 that is not similar with miR-34 family miRNAs in sequence, were also examined to confirm the array data. [score:1]
[1 to 20 of 17 sentences]
26
[+] score: 34
In particular, we identified significant indirect negative correlations between the glutamate receptor signalling and neurogenesis modules with expression indices of miR-193, miR-200, and the miR-34 families (Pearson’s correlation) (Supplementary Fig.   5 and Supplementary Table  3). [score:4]
We found no significant correlation (Pearson’s correlation) between expression patterns of miR-34 family members and age (r < 0.41, p-value > 0.05) (Supplementary Fig.   4). [score:3]
Members of the miR-34 family have also been shown to regulate key pathways in neurodevelopment and cortical neurogenesis, such as the Notch 67– 69 and the Wnt signaling pathway 70, 71. [score:3]
No overlap was found between the putative miR-34 family targets in the modules neurogenesis and glutamate receptor signalling and any cell-specific genes. [score:3]
Highly expressed miRNAs in TSC subjects included, miR-34a (3.1-fold), miR-34b (2.6-fold), miR-34c (2.5-fold), miR-302a (2.2-fold), miR-577 (4-fold) and miR-21 (2.9-fold) (Fig.   2c), all members of the miR-34 family were validated using RT-qPCR (Supplementary Fig.   3). [score:3]
Considering our analysis was centered upon complex brain tissue, which encompasses multiple cell-types, we here sought to gain insight into the cell-specific patterns of selected miRNA expression in TSC and control brain tissue, that is, the miR-34 family members, miR-34a and miR-34b. [score:3]
Previously reports of age dependent miRNA expression patterns in the brain and cardiac tissue 24, 25, notably of miR-34a [26], coupled with the variability of age in our study cohort motivated us to evaluate the association of age to expression patterns of miR34a and the other members of the miR-34 family members. [score:3]
Using the miR-Walk 2.0 database [29] we identified multiple genes in the neurogenesis and glutamate receptor signalling modules that are predicted targets of miR-34a, miR-34b and/or miR-34c (Fig.   3d, Supplementary Table  4). [score:3]
miRNAs (miR-34a-5p, miR-34b-5p, miR-34c-5p, miR-302a-3p, miR-21-5p and the reference small nuclear RNAs, Rnu6B and Rnu44) expression was analyzed using Taqman micro RNA assays (Applied Biosystems, Foster City, CA). [score:2]
In this particular study epileptogenic tubers were compared to adjacent non-tuber tissue indicating that elevated expression of miR-34 members may indeed represent an important feature of tuber physiology rather than an effect of AED treatment. [score:2]
Kim, N. H. et al. p53 and MicroRNA-34 Are Suppressors of Canonical Wnt Signaling. [score:2]
In so doing, we uncovered the miR-34 family (miR-34a, miR-34b and miR-34c) as predicted modifiers of neurogenesis and glutamate receptor signalling transcriptional output. [score:1]
Moreover, our study predicts an important role for the miR-34 family (miR-34a, miR-34b and miR-34c) as modifiers of neurogenesis and glutamate receptor signaling in TSC, which may potentially provide an epigenetic -driven therapeutic tool for epilepsy and cognitive disabilities in TSC. [score:1]
Based on these predictions miR-34 family members, notably miR-34b, were assessed by functional in vitro studies and shown to possess a capacity to modulate neurite outgrowth and to activate an inflammatory response in astrocytes. [score:1]
[1 to 20 of 14 sentences]
27
[+] score: 32
Furthermore, seven miRNAs were expressed more highly in C57BL/6J mice and were mainly downregulated across the time course (miR-92b-3p, miR-34b-5p, miR-672-5p, miR-31-5p, miR-34c-5p, miR-34b-3p, and miR-182-5p; listed in descending order according to the heat map in Figure 5). [score:6]
Five of these [miR-34b-3p, miR-34c-5p, miR-34b-5p, miR-92b-3p, and miR-182-5p; as well as miR-31-5p, which was identified through literature search (41)] belonged to the aforementioned seven miRNAs which were expressed more highly in the C57BL/6J mice and downregulated throughout the time course. [score:6]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
These 20 miRNAs (which included miR34 families, which are strongly associated with regulation of apoptosis and the PI3k-Akt pathway [e. g., Figure 6]) thus constituted part of a highly regulated response that can predominate in either strain, depending on the time after infection, and is likely to play a role in host susceptibility. [score:3]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
Higher abundance of antiapoptotic (e. g., miR-467 family) and lower abundance of proapoptotic miRNAs (e. g., miR-34 family) and those regulating the PI3K-Akt pathway (e. g., miR-31-5p) were associated with the more susceptible DBA/2J strain. [score:2]
The miR-34 and miR-449 families control epithelial barrier repair (65) and regulate multiciliogenesis via the Delta/Notch pathway (66, 67), which might help transport virions out of the respiratory tract (68) and reduce end-organ damage. [score:2]
Of note, miR-31-5p, miR-379-5p, miR-7a-5p, as well as some members of the miR-449 (-5p) and miR-34 (-5p) families were moderately to highly abundant (>10 CPM), making it more likely that they would bind to a biologically relevant number of viral RNAs. [score:1]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 31
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Regarding miRNA targeting of these hub genes (Figure  7B), miR-34c-5p and let-7g-5p are main regulatory candidates based on significant expression pattern correlations (FDR < 0.10) with Syt11, Snx-7, Tom1 (both let-7g-5p and miR-34c-5p), and Bim1 (miR-34c-5p). [score:6]
The central role of miR-34c-5p while targeting additional genes in the brown module is again evident in the expression correlation network shown in Additional file 1: Figure S5B (note the higher connectivity of this particular miRNA). [score:5]
The central role played by miR-34c-5p and let-7g-5p while targeting additional genes in the red module is also evident in the expression correlation network shown in Additional file 1: Figure S4 and S5 (note the higher connectivity of these particular miRNAs). [score:5]
Regarding miRNA regulation of this module, the central role of miR-34c-5p and let-7g-5p is yet again evident in the expression correlation network shown in Additional file 1: Figure S6B (note the higher connectivity of these particular miRNAs). [score:4]
MicroRNA miR-34c-5p appeared again as a main modulator of hub genes in this module, namely Ppm1a and Hsp90ab1, as detected by significant correlation among respective miRNA and mRNA expression profiles. [score:3]
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
This suggests that miR-34c-5p and let-7g-5p play an important role in the attempted regulation of this module. [score:2]
MicroRNAs miR-34c-5p and let-7g-5p, in particular, appear to be central regulators of hub genes in the most significant ethanol-responsive gene modules. [score:2]
50E-0367mmu-miR-339-5pmir-3390.206.807.92E-037.53E-028mmu-miR-34c-5pmir-340.246.689.54E-066.88E-0477mmu-miR-34a-5pmir-340.179.541.17E-029.66E-0245mmu-miR-340-5pmir-3400.178.511.71E-032.45E-0217mmu-miR-361-5pmir-3610.247.887.74E-052.90E-0319mmu-miR-376b-3pmir-3680.268.451.05E-043.50E-0356mmu-miR-376a-3pmir-3680.1910.215.63E-036.40E-0223mmu-miR-434-3pmir-4340.2210.461.76E-044. [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 29
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Of the 14 downregulated miRNAs, miR-669c and miR-34c, tended to be downregulated further during the maturation of white adipocytes compared to browns. [score:6]
Of these 10 miRNAs, only mir-21, mir34c and mir-143 were differentially expressed between mature adipocytes and preadipocytes (p < 0.05), see Table 1 and Figure 2. Mir-34c upregulation during brown adipocyte maturation was in contrast to our microarray data and this result must be treated with caution. [score:6]
Two miRNA, miR-669c and miR-34c, demonstrated a trend for downregulation during the maturation of white but not brown adipocytes. [score:4]
Nevertheless, the miRNAs mir-34c, mir-143, mir-24, mir-720 and mir-21 showed robust expression in the adipocyte cultures, and these 5 miRNAs were thus profiled in subcutaneous adipose tissue from healthy humans with different BMIs to examine their regulation in adipose tissue expansion. [score:4]
Figure 2 Expression levels of mir-21, mir-34c and mir-143 in primary murine brown and white preadipocytes and mature adipocytes (n = 3+3 for each tissue). [score:3]
The miRNAs targeting Sirt1 include miR-143, miR-23b miR-34c as well as mir-34a [51, 52]. [score:3]
Five miRNAs (mir-21, mir-143, mir-34c, mir-24 and mir-720) were profiled in subcutaneous adipose tissue from healthy humans with varying degrees of obesity. [score:1]
Figure 4 Expression levels of mir-21, mir-24, mir-34c, mir-143 and mir-720 were measured in subcutaneous adipose tissue of obese (BMI >30, n = 10) and non-obese (BMI <30, n = 10) healthy persons. [score:1]
Of the 10 miRNAs that showed expression in the adipocyte cultures, we chose a subset of 5 miRNAs (mir-34c, mir-143, mir-24, mir-720 and mir-21) to measure in human adipose tissue RNA samples from obese persons (BMI >30, n = 10) and non-obese persons (BMI <30, n = 10). [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 29
Using miR-34 direct up-regulation by doxorubicin, we show here that p53 induction results in the down-regulation of Dll1 via miR-34 transcriptional control. [score:8]
For this reason, we performed additional Dll1 3’-UTR reporter activity assays using miR-34b- and miR-34c-containing expression constructs, and showed that both miR-34b and miR-34c down-regulate Dll1 3’-UTR to the same levels as those seen with miR-34a (Fig. S5D). [score:5]
An additional question was raised whether other miR-34 family members can have synergistic actions on Dll1 down-regulation. [score:4]
The MiR-34 family is directly regulated by the transcription factor p53 [9], [10], [11], and all of the members of this family (miR-34a, mi-R34b and miR-34c) share high sequence similarities [12]. [score:3]
We thus asked whether by targeting Dll1, miR-34 can impair the proliferation rate of MB cells. [score:3]
These data provide further supporting evidence that the whole miR-34 family (miR-34a, miR-34b and miR-34c) can regulate Notch signaling through Dll1 in MB. [score:2]
This activation can be explained by the relatively high expression of miR-34 in this clone, as compared to clone #2 (Fig. S1C). [score:2]
This evidence led to a mo del for the potential therapeutic use of miR-34 as a radio-sensitizing agent in p53-mutant breast cancer [14]. [score:1]
Several studies have confirmed that the miR-34 family is required for normal cell responses to DNA damage following irradiation in vivo. [score:1]
[1 to 20 of 9 sentences]
31
[+] score: 28
c-Myc overexpression partially rescued RhoA expression (Fig. 5A, compare lane 4 with 3) and miR-34 -induced suppression of invasion (Fig. 5B), suggesting that miR-34a inhibits invasion, at least partially, via RhoA reduction by targeting c-Myc. [score:11]
c-Met reversed miR-34 -induced suppression of invasion, indicating that miR-34a inhibits invasion, at least partially, by targeting c-Met (Figs. 7B and C). [score:7]
p53 has been found to target the miR-34 family [4], [5], [6] and the ectopic expression of miR-34 genes has drastic effects on cell proliferation and survival. [score:5]
miR-34c has been shown to negatively regulate c-Myc in response to DNA damage and to inhibit c-Myc -induced DNA synthesis [14]. [score:4]
The results clearly revealed that miR-34 reduced invasion of PC-3 cells to 20% of that of controls (Figs. 2A and B). [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 27
miR-34 family are reportedly as tumor-suppressor miRNAs implicated in reduced CSC properties and increased sensitivity to drug treatment by directly targeting NOTCH1 46. miR-100 is also upregulated in the TR subpopulation, and its expression levels relate to the cellular differentiation state, with lowest expression in cells displaying stem cell markers 47. [score:13]
For example, the TR subpopulation overexpresses miR-93, which inhibits cell proliferation, the capacity to form colonies 44 and promotes mesenchymal-to-epithelial transition (MET) 45. miR-34a-5p and miR-34c-5p are downregulated in TS cells and upregulated in the TR subpopulation. [score:11]
The TR [2] subpopulation showed a significant increase in the expression levels of miR-93-5p, miR-34a-5p, miR-100-5p and miR-34c-5p (Fig. 4C). [score:3]
[1 to 20 of 3 sentences]
33
[+] score: 27
Our results demonstrate that both miR-34b and miR-34c act as tumor suppressors in uveal melanoma cell proliferation and migration through the downregulation of multiple targets. [score:8]
Recently, the miR-34 family was found to be involved in the p53 tumor suppressor gene effector network, as direct targets of p53 [10- 18]. [score:6]
Figure 3Ectopic microRNA-34 b/c inhibited SP6.5 cell proliferation. [score:3]
Figure 6c-Met was a target of microRNA-34 b/c. [score:3]
As shown in Figure 5, the migration of cells transfected with miR-34b/c was significantly inhibited, as compared with negative control (208±15 for NC, 122±10 for miR-34b, 116±9 for miR-34c, n=3 each, p<0.01). [score:2]
Figure 4Transfection of microRNA-34 b/c did not induce cell apoptosis but did enhance cell sensitivity to DOX. [score:1]
A significant reduction in cell number persisted through day 5 (48.85±5.39% decrease for miR-34b and 61.72±3.6% for miR-34c, p<0.01, Figure 3A). [score:1]
In this study, we demonstrated that the other two members of the miR-34 family—miR-34b and miR-34c—play an important role in uveal melanoma cell proliferation and migration with their effects related to the c-Met signaling pathway. [score:1]
For each well, 50 nM of miR-34b, miR-34c mimic, or a negative control was cotransfected with the reporter constructs. [score:1]
Figure 5 Transfection of microRNA-34 b/c reduced uveal melanoma cell migration. [score:1]
[1 to 20 of 10 sentences]
34
[+] score: 26
For example, miR200 targets snai2, zeb1 and zeb2 mRNA [57– 59] whereas miR203 targets snai1 and zeb2 mRNA [59], and miR34 targets snai1 mRNA [60]. [score:7]
The miR200 expression can also be induced by p63 and p73 proteins, while miR34 is only induced by p73 but is down-regulated by p63 [65– 67]. [score:6]
The different isoforms of AKT seem to have opposing roles in the regulation of microRNAs: AKT1 inhibits miR34 and activates miR200 while AKT2 inhibits miR200 and activates miR34 [81]. [score:6]
To make our mo delling more insightful, we reduced the complexity by lumping variables into modules corresponding to signalling pathways: the TGF-β pathway (TGFb_pthw consisting of TGFbeta, SMAD), Notch pathway (Notch_pthw, includes activated Notch intracellular domain (NICD), the WNT pathway (WNT_pthw consisting of DKK1, CTNNB1), the p53 pathway (p53, consisting of p53), the p63-p73 proteins (p63_73 consisting of p63 and p73), the miRNA (miR34, miR200, miR203), the EMT regulators (EMT_reg including Twist1, Zeb1, Zeb2, Snai1, Snai2, Cdh2, Vim), E-cadherin (Ecadh with Cdh1), growth factors (GF), the ERK pathway (ERK_pthw: ERK), p21 is included in the CellCycleArrest phenotype, AKT1 module and AKT2 module. [score:2]
miR34 & ! [score:1]
miR203 CellCycleArrest (miR203 | miR200 | miR34 | ZEB2 | p21) & ! [score:1]
If approximately 49% of changes in the logical rules have minor or no effect onto the Metastasis phenotype probability, some modifications in some rules changed the Metastasis phenotype to zero (implicating p63, p73, AKT1 variables of the mo del and, to a lesser extent, CTNNB1, miR34, p53). [score:1]
miR34 & ECM p21 ((SMAD & NICD) | p63 | p53 | p73 | AKT2) & ! [score:1]
AKT1 Apoptosis (p53 | p63 | p73 | miR200 | miR34) & ! [score:1]
[1 to 20 of 9 sentences]
35
[+] score: 25
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34b, mmu-mir-34a, hsa-mir-34b, hsa-mir-34c
The aims of the current work were to examine whether miR-34 family members regulate MAT2A and MAT2B expression and whether SAMe and MTA target this axis in multiple human cancers where miR-34a has been reported to be down-regulated. [score:9]
All three family members are direct transcriptional targets of p53 and many of the targets of the miR-34 family members are involved in cell cycle, apoptosis, invasion and migration [2, 4]. [score:6]
MiR-34 family members are transcriptional targets of p53 and p53 was shown to inhibit CRC metastasis by inducing miR-34a [5]. [score:5]
Most of the published literature shows miR-34 family members as tumor suppressors [2, 4]. [score:3]
MiR-34a is part of a family that includes miR-34b and miR-34c, with miR-34a having its own transcript while the other two share a common primary transcript [4]. [score:1]
R KO (C) and SW620 (D) cells were treated with 250 μM SAMe or MTA, overexpression of miR-34a or miR-34b as described in Methods for 24 hours and were processed for apoptosis, growth by BrdU, miR-34 and miR-34b transfection efficiency measurements. [score:1]
[1 to 20 of 6 sentences]
36
[+] score: 25
HEK293 cells were co -transfected with the miR-34a -expressing shuttle plasmid (FIVGFP34a) and Psicheck2™-34T (with two miR-34a perfect target sites), or Psicheck2™ with the Numbl 3'UTR, or the Numbl 3'UTR mutated in the first or second miR-34 binding site, cloned 3' of the firefly luciferase coding region. [score:5]
0038562.g004 Figure 4HEK293 cells were co -transfected with the miR-34a -expressing shuttle plasmid (FIVGFP34a) and Psicheck2™-34T (with two miR-34a perfect target sites), or Psicheck2™ with the Numbl 3'UTR, or the Numbl 3'UTR mutated in the first or second miR-34 binding site, cloned 3' of the firefly luciferase coding region. [score:5]
org we noticed that several genes in the Notch pathway [32] are predicted murine targets of miR-34, including the anti-differentiation factors, Notch1, Notch2, and Cbf1(Rbpj), the pro-differentiation factors Numbl and Mash1(Ascl1), and the Notch ligands Jag1 and Dll1. [score:3]
To eliminate Numbl miR-34 target sites, 4 bases within the seeds were mutated using QuikChange mutagenesis (Agilent Technologies, Santa Clara, CA), changing 5'-ca ctgcc-3' to 5'-ca gacgc-3'. [score:3]
NPC were transduced with the indicated miR-34 -expressing lentiviral vector its control counterpart. [score:3]
The Notch1 3'UTR harbors predicted miR-34 binding sites, and recent studies in cancer cell systems show that miR-34a directly represses Notch1/2, to slow proliferation [46] or invasiveness [47]. [score:2]
MiR-34 family members have been extensively studied in cancer studies where their expression has been found to impact cell cycle and apoptotic cellular pathways [23], [24]. [score:2]
Reduction or deletion of miR-34 is associated with higher pathologic grade and worse prognosis of many cancers, including small lung cell cancer [17], pancreatic cancer [25] and neuroblastoma [26], [27]. [score:1]
In vertebrates the miR-34 family has three members, miR-34a, b, an c, arising from two distinct loci (miR-34a from one locus and miR-34b,c from a separate locus). [score:1]
[1 to 20 of 9 sentences]
37
[+] score: 24
Three members of the mir-34 family were downregulated: mmu-miR-34b-3p was down 11.5-fold and 18-fold by RMA and LVS, respectively, whereas mmu-miR-34b-5p and mmu-miR-34c-5p show relatively high expression and 7 to 9-fold downregulation during pneumonia. [score:9]
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
miR-34 has been shown previously to be suppressed by NF-κB activation and is a known inhibitor of the inflammatory response [31]. [score:5]
Others have been previously identified as prominent regulators of inflammatory pathways, including miR-34 [31],miR-3960 and miR-2861 [48], miR-126 49– 51 and let-7f [52]. [score:2]
These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p). [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 23
Although the expression levels of miR-449b, miR-449c, miR-34b and miR-34c were much lower than that of miR-449a, the expression abundance of miR-34a was comparable to that of miR-449a in developing thymus (data not shown). [score:5]
Clues from the expression profiling of miR-449/34 cluster during thymus development, miR-34 may function at early stage before E15.5 while miR-449 may regulate late differentiation of mTECs. [score:5]
We then analyzed the expression of miR-34 cluster members in TECs during thymus development at E14.5, E16.5, 3-week, 7-week and 12-week. [score:4]
Unlike miR-449a, expression of miR-34a, miR-34b and miR-34c remained unchanged or undetectable (Fig.   1B). [score:3]
Unlike miR-449 cluster, expression of miR-34 cluster was consistently decreased from the detecting point E14.5 (Fig.   2B). [score:3]
In silico analysis identified that members of the miR-449 cluster and miR-34 cluster possess similar mature sequences and seed regions (Fig.   6B). [score:1]
Mir-34b and miR-34c also showed an increase in E16.5 thymus but not in postnatal thymus (Fig.   6A). [score:1]
MiR-449 cluster members (miR-449c/449b/449a) share similar seed sequence with miR-34 cluster members (miR-34a, miR-34b/34c) and constitute a conserved miRNA family 38– 40. [score:1]
[1 to 20 of 8 sentences]
39
[+] score: 22
In contrast, miR-34c-5p had a different pattern of expression in human tissues, suggesting that the two transcripts may be independently regulated (Fig 5C). [score:4]
MiR-34b and miR-34c are transcribed from the same locus on chromosome 11 (cytogenetic band 11q23.1; Fig 5A), and their expression is regulated by epigenetics, such as CpG island methylation [29], and p53 function [32]. [score:4]
In this analysis, only four miRNAs were differentially expressed in both human prostate cancer cell lines and tumor samples from TRAMP mice, including miR-34b-3p, miR-34c-5p, miR-138, and miR-224 (Fig 2C and 2D). [score:3]
B, C) miR-34b-3p and miR-34c-5p expression in the indicated samples of normal prostate (pool of 10 specimens), benign hyperplasia (BPH), prostate cancer (PCa) or non-neoplastic (RWPE-1), hyperplastic (BPH-1) or tumor (LNCaP, DU145) prostate cell lines. [score:3]
The miR-34 family of miRNAs has been previously reported to suppress tumorigenesis by different mechanisms, including modulation of cell cycle transitions, EMT, metastasis, or cancer stemness [33]. [score:3]
Expression analysis followed by unsupervised hierarchical clustering D) of miR-224, -34b-3p, -138 and miR-34c-5p reveals that androgen-independent prostate cancer cells are more similar to TRAMP tissues than to androgen -dependent or non-tumorigenic prostate human cells. [score:3]
MicroRNA-34b and MicroRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. [score:2]
[1 to 20 of 7 sentences]
40
[+] score: 20
In addition to potential tumor/metastasis suppressor ORFs naturally expressed in neural cells, both ATF-126 and Maspin cDNA up-regulated miRNAs previously associated with tumor suppression in many types of cancers, including miR-1 [23], [24] and miR-34 [25]. [score:10]
Interestingly, both, ATF-126 and Maspin cDNA, up-regulated miRNAs with potential tumor suppressive functions, such as miR-1 [23], [24] and miR-34 [25], while down -regulating oncogenes and metastasis promoters, including miR-10b [26] (Fig. 6C ). [score:7]
Similarly, miR-34 has been shown to target Actin in mouse neuronal cells [44]. [score:3]
[1 to 20 of 3 sentences]
41
[+] score: 20
Interestingly, most of these differentially expressed miRNAs belonged to miRNA families, including miR-8 and miR-132 families overexpressed in FCx and miR-34 family overexpressed in HP, or miRNA clusters transcribed from the same locus (miR-182|miR-183|miR-96 cluster overexpressed in FCx). [score:9]
In the dopamine pathway (Figure 5) miR-34b-5p was predicted to regulate Calcyon, Ppp2r, and Ppp1, miR-34b-3p to regulate Prka, and miR-34 c to regulate Calcyon, Ppp2r and Ppp1. [score:4]
Mir-34 family transcribed from a chromosome 9 cluster and including miR-34c, miR-34c*, miR-34b-3p, and miR-34b-5p was expressed on a higher level in HP. [score:3]
Another interesting pathway we identified is the dopamine receptor 1/calcyon signaling pathway regulated by members of the miR-34 family expressed on a higher level in HP compared to FCx. [score:3]
These included miR-8, miR-132, and miR-34 families and the miR-182|miR-96|miR-183 cluster. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 20
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 To test whether inhibition/overexpression of these candidate miRNAs in the F28-7 cells modulate FUdR -induced cell death, we have done transfections of the miRNA inhibitors and/or the synthetic miRNA mimics. [score:7]
Using 1.5-fold cut-off, the analysis identified seven differentially expressed miRNAs: in F28-7-A (apoptosis-fated cell), four mature miRNAs (miR-700, miR-743a, miR-140*, miR-351) were expressed at higher levels, and three mature miRNAs (miR-222, miR-34c*, miR-132) were expressed at lower levels than in F28-7 (necrosis-fated cell). [score:7]
It was noted that the expression levels of miR-34c* were similar in these sister cells (Fig 1F). [score:3]
Expression of (A) miR-700, (B) miR-743a, (C) miR-140*, (D) miR-351, (E) miR-222, (F) miR-34c*, (G) miR-132, and RNU6B were analyzed by quantitative real-time PCR using primers for miR-700-3p, miR-743a-3p, miR-140-3p, miR-351-5p, miR-222-3p, miR-34c-3p, miR-132-3p, and RNU6B (see ). [score:2]
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 Total small RNA fractions were prepared from F28-7 and F28-7-A cells (no drug, no incubation). [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 20
miRNAs Deregulated in OS Expression Levels Compared to the Controls Overall Function miR-382 Down-regulated Poor survival outcome and metastasis marker[70, 83] miR-154 Down-regulated Poor survival outcome[70] miR-33a Up-regulated Chemoresistance[84] miR-34c Down-regulated Chemoresistance[85] Most forms of human cancer have changes in the epigenome compared to the normal cellular counterparts from which they are derived. [score:14]
One of the key miRNAs in the TP53 pathway is miR-34, which is significantly downregulated in many osteosarcoma tumors that affects the cell cycle and proliferation [77, 78, 79]. [score:4]
Xu M. Jin H. Xu C. X. Bi W. Z. Wang Y. MiR-34c inhibits osteosarcoma metastasis and chemoresistance Med. [score:2]
[1 to 20 of 3 sentences]
44
[+] score: 20
The mature miR-34 incorporates in the RISC complex and mediates the inhibition of translation or RNA degradation of their targets, such as Bcl-2 and Cyclin D1 [31]. [score:7]
The activation of the miR34 family then regulates their target proteins such as CDK4 and Rb to regulate the cell cycle. [score:5]
The activation of p53 increases the levels of the miR34 family, which are direct targets of p53. [score:4]
After exposure to gamma radiation, p53 is activated through ATM-kinase and transactivates the expression of different members of the miR34 family through consensus binding sites. [score:3]
miR34 genes are then processed by DROSHA and DICER complexes. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 19
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
MiR-15a [11], miR-21 [12, 13], miR-34 [14], members of the miR-200 family [12, 15], miR-214 [11], miR-221 [16], members of the let7 family [15], and miR-320c [17] have been reported to play roles in gemcitabine chemoresistance in pancreatic cancer. [score:1]
In contrast, the chemoresistance to gemcitabine was merely slightly repressed in human PDAC cells treated with miR-34-5p or miR-203 mimics (Supplementary Figure 2). [score:1]
[1 to 20 of 6 sentences]
46
[+] score: 18
Therefore, the p53 network suppressed tumor formation through a number of coordinated interactions and several transcriptional targets including the role played by miR-34 family members in inhibiting unregulated cell proliferation and tumor development [58, 59]. [score:9]
The authors compared microRNA expression profile of wild-type and p-53 -deficient cells and found that the expression of microRNA family members (miR-34a-c) reflected the p53 status and the genes encoding miR-34 family members were transcriptional targets of p53 in vivo and in vitro. [score:6]
The first microRNAs involved in the p-53 tumor suppressor network were reported in 2007 and they belong to the miR-34 family, these being miR-34a, miR-34b, and miR-34c [57]. [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 18
mmu-miR-142-3p mmu-miR-152 mmu-miR-135b mmu-miR-135a mmu-miR-34c mmu-miR-494 MicroCosm Bmal1 Bmal1, Rorβ - - Reverbα Bmal1, Rorβ TargetScan Bmal1 - - - - Bmal1, Clock MiRanda Bmal1 Bmal1, Rorα, Rorβ Rorα, Rorβ Rorα, Rorβ Per2 Bmal1, Per2, Rorβ Because recent findings indicate that despite their abundant expression in the cytoplasm, 18s and 28s rRNA are absent in RNA extracted from circulating exosomes [31], 18s rRNA levels were analyzed in serum and WBC fractions of blood samples collected from mice (n = 3–4) at ZT3 and ZT7 to confirm that the detected small RNAs reflect serum expression, rather than artifact associated with cellular lysis during sample preparation. [score:7]
mmu-miR-142-3p mmu-miR-152 mmu-miR-135b mmu-miR-135a mmu-miR-34c mmu-miR-494 MicroCosm Bmal1 Bmal1, Rorβ - - Reverbα Bmal1, Rorβ TargetScan Bmal1 - - - - Bmal1, Clock MiRanda Bmal1 Bmal1, Rorα, Rorβ Rorα, Rorβ Rorα, Rorβ Per2 Bmal1, Per2, Rorβ Because recent findings indicate that despite their abundant expression in the cytoplasm, 18s and 28s rRNA are absent in RNA extracted from circulating exosomes [31], 18s rRNA levels were analyzed in serum and WBC fractions of blood samples collected from mice (n = 3–4) at ZT3 and ZT7 to confirm that the detected small RNAs reflect serum expression, rather than artifact associated with cellular lysis during sample preparation. [score:7]
Bars denote real-time PCR determinations of serum miRNA levels (mean ± SEM) and the values are plotted using a logarithmic scale in comparison with the average for miR-34c expression. [score:3]
miR-142-3p, miR-152, miR-494, miR-135b, miR-135a and miR-34c were found in descending order of abundance in the serum (Fig. 1A). [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 18
In this sense, it was recently shown that in the settings of heart disease where miR-34a is elevated, targeting the entire miR-34 family (that includes miR-34a, -34b and 34-c), proved more effective than targeting miR-34a alone [38]. [score:7]
Ooi, J. Y. et al. Identification of miR-34 regulatory networks in settings of disease and antimiR-therapy: Implications for treating cardiac pathology and other diseases. [score:6]
miR-34a-5p is described in many studies pointing towards a role in cancer proliferation, and it is also found dysregulated in muscular dystrophies, neurodegenerative diseases and myocardial dysfunction 43, 44. miR-34a is known to regulate more than 30 oncogenes and, recently, a liposome encapsulated mimic of miR-34 (MRX34) has entered clinical trials, where it has demonstrated clinical proof of concept for solid tumors and hematological malignancies (clinicaltrials. [score:5]
[1 to 20 of 3 sentences]
49
[+] score: 18
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-21a, mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
Recent studies from this laboratory have also demonstrated that CDF inhibits the growth of CR colon cancer cells and also upregulates the expression of miR-34, which is downregulated in colon tumors [20]. [score:11]
Additionally, we found CDF to up regulate the expression of miR-34 [20], which is reported to be downregulated in colon cancer [21]. [score:7]
[1 to 20 of 2 sentences]
50
[+] score: 18
The aforementioned result suggested that miR-34a, miR-34b, and miR-34c not only target Myc in human derived cells as described previously [35]– [37], but also negatively regulate Myc expression in mouse species. [score:6]
The result showed that miR-34a, miR-34b, and miR-34c can repress the expression by 15%, 55%, and 25%, respectively. [score:3]
Furthermore, we also detected the repression of miR-34a, miR-34b, and miR-34c on Myc protein expression. [score:3]
Subsequently, we constructed the miRNA expression vectors of those predicted miRNAs and named those as pCDH-mir34a, pCDH-mir34b, pCDH-mir34c, pCDH-mir340, and pCDH-mir135b. [score:3]
By combining our sequencing data with the predicted result, we selected miR-34a, miR-34b, miR-34c, miR-340, and miR-135b to conduct further research. [score:1]
48 h after transfection, miR-34a, miR-34b, and miR-34c can reach a 30% to 40% reduction, and miR-340 and miR-135b also showed slight reduction on the luciferase activity of Myc reporter (Figure 4J). [score:1]
48 h after transfection, miR-34a, miR-34b, and miR-34c showed approximately 50% reduction effect, whereas miR-340 and miR-135b showed approximately 20% reduction (Figure 4M). [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 17
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-34a
Recently, Rokhin at al. reported that LNCaP cells cultured in androgen-free media and then treated with the DNA-damaging agent, doxorubicin, suppressed the expression of p53 transcription targets miR-34a and miR-34c, resulting in inhibition of apoptosis [29]. [score:9]
Androgen deprivation does not affect nutlin -induced miR-34 expression. [score:3]
It has been shown previously that nutlin activates miR-34(a-c) expression [30]. [score:3]
These experiments suggest that androgen deprivation does not affect miR-34 induction by non-genotoxic p53 activation. [score:1]
Therefore, we examined if the combination of nutlin and CSS can affect miR-34 levels. [score:1]
[1 to 20 of 5 sentences]
52
[+] score: 17
Li et al. observed that the rno-miR-34 family was significantly up-regulated in dimethylnitrosamine -induced hepatic fibrosis, and suggested that miR-34 family members may be involved in the process by targeting acyl-CoA synthetase long-chain family member 1 (ACSL1) [40]. [score:6]
MiRNAs significantly dysregulated in the mid-phase of infection (dpi 30), such as mmu-miR-146b and mmu-miR-155, may relate to the regulation of hepatic inflammatory responses, whereas miRNAs exhibiting a peak expression in the late phase of infection (dpi 45), such as mmu-miR-223, mmu-miR-146a/b, mmu-miR-155, mmu-miR-34c, mmu-miR-199, and mmu-miR-134, may represent a molecular signature of the development of schistosomal hepatopathy. [score:6]
In addition, some other miRNAs previously reported to be associated with fibrosis, such as miR-34c, miR-199, and miR-214, also exhibited a peak expression in the liver of infected mice at 45 dpi (Table 2 and Figure 3). [score:3]
Here, the expression of mmu-miR-34c was as high as 30-fold more in the late phase of infection compared to that in the early infection, suggesting its important roles in the progression of liver pathogenesis. [score:2]
[1 to 20 of 4 sentences]
53
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
Similarly, miR-34, an established p53 effector that is typically downregulated in malignant lung cancer [105], was upregulated in microadenomas but not in adenomas, as demonstrated in the present study. [score:7]
Thus, maintenance of miR-34 expression is a prerequisite to avoid the passage from benign to malignant cancer lesions in lung tissue. [score:3]
[1 to 20 of 3 sentences]
54
[+] score: 16
Two sets of NPC samples were collected for this study: Set 1, including tissue biopsies of 45 NPC and 10 non-tumor nasopharynx epithelial tissue samples to verify miR-34 and miR-449a expression with qRT-PCR; Set 2, including 20 paraffin-embedded NPC and 4 non-tumor nasopharynx epithelial tissue samples for LDHA detection with IHC. [score:3]
The miR-34 family consists of miR-34a, miR-34b and miR-34c, which are directly regulated by p53 [19– 21]. [score:3]
Figure 1(Upper line) The real time RT-PCR determination of miR-34 cluster and miR-449a expression in different development stages of NPC (n = 45) compared with the non-tumor nasopharyngeal epithelial (normal, n = 10). [score:3]
Here, we further verified the expression levels of miR-34 cluster and miR-449a by RT-PCR in another cohort of NPC samples including 45 NPC tissues of different stages and 10 non-tumor nasopharyngeal epithelial. [score:3]
From meta-analysis, miR-34a, miR-34b and miR-34c are dysregulated simultaneously in most cancers, such as non-small cell lung cancer, endometrial carcinoma, colorectal cancer, ovarian carcinoma, osteosarcoma [46]. [score:2]
MiR-449 cluster have very similar sequences and secondary structures belonging to the miR-34 family. [score:1]
In mammalians, miR-34a is located on chromosome 1p36, while miR-34b and miR-34c are located at chromosome 11q23 and have a common primary transcript [22]. [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 16
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-34a
p53 upregulates the immune checkpoint molecules programmed cell death-1 (PD-1) and its ligand PDL-1 [46] but p53 also upregulates mir-34, which binds the 3′-untranslated region of PDL-1 to downregulate expression [47]. [score:14]
Cortez, M. A. et al. PDL1 regulation by p53 via miR-34. [score:2]
[1 to 20 of 2 sentences]
56
[+] score: 15
Network of miRNA–mRNA interactions identified by IPA for (A) dystromiRs up-regulated in mdx muscle (miR-21, miR-31, miR-34c, miR-146b and miR-206), and (B) the dystromiR miR-29c, which is down-regulated in mdx muscle. [score:7]
Consistent with previous studies, we have observed up-regulation of dystromiRs (e. g. miR-31, miR-34c and miR-206) in mdx TA (36, 63). [score:4]
However, somewhat surprisingly, three of the most highly up-regulated dystromiRs, miR-31, miR-34c and miR-206, showed no significant restoration in response to exon skipping therapy (Fig. 5D). [score:4]
[1 to 20 of 3 sentences]
57
[+] score: 15
Recently, Catuogno et al. reported that miR-34c downregulated p53 expression and increased the cancer cell's sensitivity to paclitaxel by suppressing Bmf expression [30]. [score:10]
Given the transcriptional regulation ability and possible p53-modulating role of RFP, RFP might confer paclitaxel resistance to ovarian cancer cells through direct regulation of p53 function or transcriptional regulation of certain genes, such as miR-34c. [score:5]
[1 to 20 of 2 sentences]
58
[+] score: 15
However, the expression dynamics of miR-34c, let-7a, miR-7a were different; the expression level was increased with increase in size of follicles. [score:5]
a) 6d-8d, b) 8d-12d, c) 12d-15d, d) 15d-21d, e) 21d-P6, f) P48-h6 To further validate these differentially expressed miRNAs identified from the mouse ovary, the expression levels of miR-199a, miR-470, miR-871, miR-34c let-7a, miR-7a, miR-351, miR-191 were further examined in different size follicles (i. e., 100 μm −130 μm, 200 μm -280 μm, 450 μm -550 μm, 500 μm -600 μm) using qRT-PCR assay. [score:4]
F) Expression profile of mmu-mir-34c in sequencing data. [score:3]
f) Expression profile of miR-34c through qRT-PCR. [score:3]
[1 to 20 of 4 sentences]
59
[+] score: 14
Genes encoding miRNAs in the miR-34 family are direct transcriptional targets of p53, which suppresses tumor formation through integration of multiple transcriptional targets, and miR-34 may act in concert with other effectors to inhibit inappropriate cell proliferation 39. miR-885-5p leads to the accumulation of p53 protein and activates the p53 pathway, subsequently inhibiting proliferation and interfering with cell cycle progression and cell survival 40. [score:12]
By bioinformatics analysis, miR-34a, miR-34c, miR-885-3p and miR-885-5p were predicted to play roles in cell fate control and development as related to the Notch signaling pathway 36. [score:2]
[1 to 20 of 2 sentences]
60
[+] score: 14
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-34a
MiR-34c was expressed only at low levels and was not significantly differentially expressed across disease or tissue and was not further examined (Fig. 1a). [score:6]
There was no significant difference (ns) in miR-34c expression between these groups. [score:3]
TaqMan mRNA or miRNA assays (Life technologies) or miScript primer assays (Qiagen) were used for semi-quantitative determination of the expression of miR-34a (Hs000426 Life Technologies; MS00001428 Qiagen), miR-34c (Hs000428), Let7a (Hs000377, U6B snRNA (Hs001973; MS00033740), TNF Mm00443258_m1), AXL (Hs01064444_m1, Mm00437221_m1), Socs3 (Mm00545913_s1), p19 (Mm00518984_m1), IL-6 (Hs00174131_m1) and 18S (Hs03003631_g1) with miRScript SybR Green PCR kit (#218073/Qiagen) or TaQman Gene Expression master mixes (Life Technologies). [score:2]
A mo del describing miR-34/AXL function in DCs. [score:1]
OT-II T cells on a CD45.1 background (at 0.5 and 1.5 × 10 [6]) were injected into the tail vain of WT and miR-34 [−/−] mice on day 0. On day 1, mice were injected with 100 μg of OVA peptide or PBS per mouse (Cambridge Reserved Biochemical) in complete Freunds adjuvant (0.5 mg ml [−1]; Sigma) in 0.2 ml into the right leg muscle. [score:1]
For the evaluation of miR-34 and AXL mRNA expression in PB, SF and synovial tissue, samples were obtained from healthy donors, RA patients and PsA patients at Rheumatology clinics (Glasgow, UK) and from the Division of Rheumatology, Fondazione Policlinico Universitario A. Gemelli, Catholic University of the Sacred Heart (Rome, Italy). [score:1]
[1 to 20 of 6 sentences]
61
[+] score: 14
There was also no significant difference in the relative levels of these three miRNA based on AhR expression, although there was a trend towards decreased miR-34c. [score:3]
miRNA expression was assessed by two-step TaqMan [®] RT-PCR (Applied Biosystems, Carlsbad, CA) for miR-196, miR-146a, miR-135b, miR-96, miR-34c, and U6 snRNA, a small nuclear RNA (snRNA) used as an internal control for miRNA analysis. [score:3]
There was no change in the expression of (A) miR-34c, (B) miR-196a or (C) miR-146a in response to cigarette smoke. [score:3]
These analyses revealed that there were no significant change in the expression of miR-34c (Fig. 6A), miR-196a (Fig. 6B) or miR-146a (Fig. 6C) in mice exposed to cigarette smoke for 4 weeks. [score:3]
These miRNA included miR-196a, miR-96 and miR-34c (Fig. 3, green circles). [score:1]
Therefore, we next selected miR-146a and miR-135b in conjunction with miRNA exhibiting large relative differences between Ahr [−/−] and Ahr [+/−] mice; these were miR-96 and miR-34C. [score:1]
[1 to 20 of 6 sentences]
62
[+] score: 14
It was already demonstrated that p53 directly regulated the expression of tumor-suppressor miRNAs as the miR-34 family members [34], or mir-16 and mir-145, through a Drosha -mediated mechanism [35]. [score:7]
As a key transcription factor, p53 could directly regulate the expression of selected miRNAs, such as the mir-34 family (mir-34a, mir-34b, and mir-34c), which is involved in cell-cycle arrest or cell death [14, 21]. [score:5]
Cortez M. A. Ivan C. Valdecanas D. Wang X. Peltier H. J. Ye Y. Araujo L. Carbone D. P. Shilo K. Giri D. K. PDL1 regulation by p53 via mir-34 J. Natl. [score:2]
[1 to 20 of 3 sentences]
63
[+] score: 13
miRNAs that showed approximately 2-fold upregulation include members of the miR-29 family and miR-34 family, which have been demonstrated to be involved in cellular senescence and apoptosis in cell lines, tissues, and organisms during aging [48]– [51]. [score:4]
miR-34 mediates the downstream effects of p53 by suppressing a number of genes including CDK4/6, Cyclin E2, MET, and Bcl-2, thereby promoting apoptosis [56], [57]. [score:3]
Studies have shown that p53 can bind directly to the promoter and activate miR-34 genes in response to DNA damage and oncogenic stress. [score:2]
A number of other miRNAs including the miR-29 family, miR-34 family, miR-15/16, miR-17-92 cluster, miR-146a/b, and miR-200 family are all known to be involved in networks regulating cell senescence and death [8]– [10]. [score:2]
miR-34 family members participate in downstream signaling of the p53 pathway [55]. [score:1]
Both miR-29 and miR-34 can affect genes that activate or enhance p53 pathways. [score:1]
[1 to 20 of 6 sentences]
64
[+] score: 13
Importantly, several reports showed that members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [8]– [13]. [score:7]
In addition, members of the miR-34 family have been identified as direct p53 targets. [score:4]
miR-34a is a member of the miR-34 family, which in mammals also includes miR-34b, and -34c [6]. [score:1]
miR-34a is encoded by its own transcript, whereas miR-34b and miR-34c share a common primary transcript. [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 12
Based on computational predictions from miRBase, there are a total of 11 potential target mRNAs for miR-34 within our data displaying decreased expression. [score:5]
The miR-34 family was first identified as transcriptional targets of p53 [46], [47]. [score:3]
Among these 17 dynamically regulated miRNAs, the top 5 with the greatest fold change were miR-126 (23-fold), miR-34c (17-fold), miR-130a (12-fold), miR-574 (9-fold) and miR-193b (8-fold). [score:2]
In our real-time PCR miRNA array data, miR-34a, miR-34b-3p and miR-34c were increased when c-Myc was depleted in BASCs (Figure 5C). [score:1]
In our study, three miR-34 members including miR-34a, miR-34b-3p and miR-34c were increased with Myc depletion in BASCs, supporting the concept that all three members have potent anti-proliferative affects with miR-34a additionally promoting apoptosis [48], [49]. [score:1]
[1 to 20 of 5 sentences]
66
[+] score: 12
Intriguingly, miR-34 and HMGA1 generate an intricate regulatory loop since HMGA1 is able to negatively regulate the expression of miR-34 (Puca, unpublished observations) and p53 (61), being the latter able to induce the expression of miR-34. [score:7]
In this process, HMGA1 has a central role since, upon its overexpression, alters miR-34 pathway by acting directly and indirectly on it, through the repression of p53 (Figure 1C). [score:5]
[1 to 20 of 2 sentences]
67
[+] score: 12
Quantitative real-time PCR (qPCR) revealed that miR-34c* and miR-92a were significantly up- and downregulated, respectively, in the exosomes from cAMP -treated brown adipocytes and from serum of mice with active BAT (Fig. 2b,c). [score:4]
Comparison of the abundance of these miRNAs in exosomes and in brown adipocytes revealed that miR-92a and miR-34c* were differentially expressed after cAMP treatment in the exosomes but not in BA (Supplementary Fig. 2a,b). [score:3]
Although miR-34c* is differentially expressed during differentiation of murine brown adipocytes 34, miR-34c* was not detectable in human serum samples (see below). [score:3]
For the analysis of human exosomal miRNAs, we focused on miR-92a and miR-133a, whereas miR-34c* was not detectable in human serum exosomes. [score:1]
002584, Life Technologies) was used to quantify miR-34c* located on chromosome 9: 51103034-51103110 [−] with the sequence: 3′- AAUCACUAACCACACAGCCAGG -5′. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 12
Among those, miR-34c-5p/-34c-3p/-362 and miR-132/-424/-146b followed the same differential expression trend seen at the iPSC stage, together with 44.84% of total differentially expressed miRNAs (Fig.   4f). [score:5]
miRNA -targeting cocktails were composed as follows: AMC, miR -mimics for miR-34c-5p/-34c-3p/-362/-210/-590, anti-miRs anti-miR-132/-146b/-424/-212/-181a; PMC, miR -mimics for miR-132/-146b/-424/-212/-181a, anti-miRs anti-miR-34c-5p/-34c-3p/-362/-210/-590 (all oligonucleotides from Sigma-Aldrich). [score:3]
Intriguingly, among the miRNAs we filtered into the anti-myogenic pools, miR-34c/-362/-210 have been previously associated with pathological state of muscles 24– 26 and miR-590 has been recently associated with differentiation inhibition and the TGFβ pathway [27]. [score:3]
Following this RNA-seq -based filter, we identified miR-34c-5p/34c-3p/-362/-210/-590 for fibroblast-derived MiPs, and miR-212/-132/-424/-146b/-181a for MAB-MiPs (Fig.   4e and Supplementary Fig.   2). [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 12
For instance, miR-103 and miR-107, having very similar mature sequence and expression levels (Figure 6c), are two known miRNAs that have the same roles in regulating insulin sensitivity and promoting metastasis of colorectal cancer [20], [21]; miR-34b and miR-34c, having very similar mature sequence and expression levels (Figure 6c), are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth [22]; let-7a/b/c were also claimed to reduces tumor growth in mouse mo dels of lung cancer [23] and miR-29a/b/c reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B [24] while these two miRNA clusters have very similar mature sequences and expression levels (Figure 6d). [score:12]
[1 to 20 of 1 sentences]
70
[+] score: 11
In many tumors, there is either overexpression of so-called oncogenic miRNAs (e. g., miR-155, miR-17−5p and miR-21) [15, 16] or downregulation of tumor suppressor miRNAs (e. g., miR-34, miR-15a, miR-16−1 and let- 7) [17– 20]. [score:8]
Consequently miRNAs have been demonstrated to act either as oncogenes (e. g., miR-155, miR-17−5p and miR-21) [15, 16] or tumor suppressors (e. g., miR-34, miR-15a, miR-16−1 and let- 7) [17– 20]. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 11
Increasing evidences have suggested that miRNAs are deregulated or upregulated in all types of cancers, acting either as tumor suppressors (e. g. miR-34, miR-15/16, let-7, miR 200 family) or as oncogenes (e. g. miR-155, miR-222/221, miR-17-5p, miR-21) [1], [3], [8], in which the miRNAs play key roles in important aspects of tumorigenesis, such as cancer initiation, differentiation, growth and progression [3], [5], [8], mainly by interfering with the expression of target genes involved in cell cycle, apoptosis, cell migration and invasion, angiogenesis. [score:11]
[1 to 20 of 1 sentences]
72
[+] score: 11
In particular, miR-31 and miR-34c were not modulated (Figures 1B,C); miR-206 was up-regulated (Figure 1D) and miR-449 and miR-335 were down-regulated (Figures 1E,F) in the diaphragm of 4-week-old mdx mice. [score:7]
MicroRNA-34b and MicroRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. [score:2]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
miR-34c is strongly induced in ischemia damaged myofibers (Greco et al., 2009) and it promotes cell cycle withdrawal and apoptosis (Corney et al., 2007). [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 11
Members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [14- 19]. [score:7]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
[1 to 20 of 2 sentences]
74
[+] score: 11
However, the slightly up-regulated miR-16, miR-34c-3p and let-7i* miRNAs in this study have been demonstrated to be down-regulated in other cancer settings [56], [57], [58]. [score:7]
Cell Cycle 9 In press 69 Hagman Z Larne O Edsjo A Bjartell A Ehrnstrom RA 2010 miR-34c is down regulated in prostate cancer and exerts tumor suppressive functions. [score:4]
[1 to 20 of 2 sentences]
75
[+] score: 11
Interestingly, they share the same seed sequence as the miR-34 family and are hence expected to regulate overlapping cohorts of target genes (figure 2a). [score:4]
SIRT1 and HDAC1 are deacetylases which inhibit, among others, the activation of p53 and miR-34 has been shown to repress SIRT1[34]. [score:3]
Figure 2 miR-449 is part of the miR-34 family and inhibits cell proliferation. [score:3]
A - miR-449 is part of the miR-34 family and is evolutionarily conserved. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 10
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-34a
Notably, miR-34a is directly up-regulated by p53 [14, 20- 22] and a related family member, miR-34c, also has tumor suppressive affects [8, 23, 24]. [score:7]
Alterations in cell signalling/phosphoprotein in response to miR-34 over -expression. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 10
MiR-34a (another member of the miR-34 family) is a known tumor suppressor in neuroblastoma; it has been suggested as an epigenetic target for treatment of diffuse large B-cell lymphoma by 5′-AZA [10, 24, 25]. [score:5]
Single TaqMan expression assays (STAs), extended to miR-34b (another member of the miR-34 cluster), revealed that miR-29a-3p, 34b-3p, 181-c-5p and 517a-3p are upregulated in at least three different neuroblastoma cell lines (Table 1). [score:5]
[1 to 20 of 2 sentences]
78
[+] score: 10
miR-34b and miR-34c were up-regulated in our AD mo del mice and have been reported to be up-regulated in AD patients [18] (Additional file 4: Table S4). [score:7]
Aging and neurodegeneration seem to be modulated by miR-34 expression through microglial activation [23, 24] and activation of microglial chemokine receptor 1 (CX3CR1) is known to lead to neuronal death in AD. [score:3]
[1 to 20 of 2 sentences]
79
[+] score: 9
Direct targets of p53 include the already mentioned miR-34 and also miR-192, miR-194 and miR215, which then modulate MDM2 expression [15]. [score:6]
It is now known that p53 induces the expression of miRs such as the miR-34 family [17]. [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 9
Among the targets for differentially expressed miRNAs in lung of M. fortis, miR-466j, miR-322, miR-34c and miR-497 had important roles in immune function (involved in the Toll-like receptor signaling pathway in miR-497), signal pathway induction (involved in the calcium signaling pathway in miR-466j), and nutrition metabolism (involved in inositol phosphate metabolism in miR-322 and the insulin signaling pathway in miR-34c ). [score:5]
miR-200a, miR-34c and miR-34b-3p were identified as regulators of the immune response and part of the p53 tumor suppressor network, respectively [49]. [score:4]
[1 to 20 of 2 sentences]
81
[+] score: 9
Other miRNAs from this paper: mmu-mir-34b, mmu-let-7b, mmu-mir-34a
Both let-7b and miRNA 34 have been shown to target KRAS [15], and both miR34 and p53 can act synergistically to suppress tumor growth [16]. [score:5]
miRNA34 has been shown to inhibit SIRT1 [75] and we previously reported that miR34 levels are markedly reduced in women with endometriosis [13], likely regulated by inflammation [76]. [score:4]
[1 to 20 of 2 sentences]
82
[+] score: 9
Frequent downregulation of miR-34 family in human ovarian cancers. [score:4]
miR-34 miRNAs provide a barrier for somatic cell reprogramming. [score:1]
The miR-34 family in cancer and apoptosis. [score:1]
Intact p53 -dependent responses in miR-34 -deficient mice. [score:1]
miR-34 is a p53 responsive miRNA family and its members, notably miR-34a, have been observed to be lost in pancreatic, colon, breast and liver cancers, and is a predictor of poor prognosis in CLL (Chim et al., 2010; Christoffersen et al., 2010; Corney et al., 2010; Hermeking, 2010; Choi et al., 2011; Fabbri et al., 2011). [score:1]
Repression of c-Kit by p53 is mediated by miR-34 and is associated with reduced chemoresistance, migration and stemness. [score:1]
[1 to 20 of 6 sentences]
83
[+] score: 8
The proliferation data showed that miR-20a and miR-290 did not affect cell proliferation as expected, the down regulated miR-28 and miR-34 significantly reduced the proliferation of immortalized MEF with similar efficiency, while miR-21 did not inhibit cell proliferation (Fig. 3C). [score:4]
Interestingly, the switch of p21 expression was accompanied by the change of the signature of miRNAs related to MEF senescence, including the p53 -dependent miR-34 and miR-28 [20]. [score:3]
MiR-20a, miR-21, miR-28, miR-34, miR-290 and miR-NC (negative control) (GenePharma Shanghai, China) MEF were isolated from 13.5d mouse embryos, expanded and then replated every three days (6T3 protocol). [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 8
In addition, miR expression of transcriptional targets of p53 (i. e. miR-34b and miR-34c) is markedly down-regulated in human EOC tissues [42]. [score:8]
[1 to 20 of 1 sentences]
85
[+] score: 8
However, some of the miRNAs identified in this study have not followed this expression pattern, for instance, miR-34c-5p and miR-449a-5p showed higher expressions with more differentiated cells, suggesting important roles at the final spermatogenic process stages, as has also been observed in previous studies [21, 61, 62]. [score:5]
The miR-34c-5p and miR-449a-5p dysregulations have been related with murine oligoasthenoteratozoospermia and sterility [63]. [score:2]
Nevertheless, some miRNA exceptions increased their levels with samples being more highly differentiated (Fig. 8B), as for instance miR-34c-5p, miR-449a-5p or miR-375-3p. [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 8
The results showed that miR-134, miR-155 and miR-222 were down-regulated while miR-34 was up-regulated in the HIFU group (Figure 3). [score:7]
These included miR-34, miR-106a, miR-126a, miR-134, miR-155, miR-181a, miR-221, and miR-222. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Down-regulation of the tumor suppressors miR-34b and miR-34c has been described in PD and linked to decreased expression of parkin protein (Minones-Moyano et al., 2011). [score:8]
[1 to 20 of 1 sentences]
88
[+] score: 8
Conversely, the transcription factors Snail bound to E-boxes in the miR-34 promoters, thereby repressing miR-34 expression [39]. [score:3]
Recent researches have identified a link between p53, microRNA miR-34, and Snail in the regulation of cancer cell EMT programs. [score:2]
So, miR-34 and Snail form a double -negative feedback loop to regulate epithelial-mesenchymal transitions. [score:2]
In the absence of wild-type p53 function, Snail -dependent EMT is activated in cancer cells as a consequence of a decrease in miR-34 levels [38]. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 8
This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis. [score:5]
In addition, a number of studies have reported that c-Myc expression is repressed by let-7, that p53 interacts with miR-34, and that growth arrest can be induced by miR-34 through modulation of the E2F pathway in human colon cancer cells [46], [47], [48]. [score:3]
[1 to 20 of 2 sentences]
90
[+] score: 8
Moreover, miR-34 also downregulates several cyclin -dependent kinases, cyclins, and E2Fs 38, 39, leading to cell cycle arrest. [score:4]
In addition, the miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family, which was found to be a p53-responsive gene cluster 35, 36. miR-34 targets the histone deacetylase SIRT1 [37], leading to the accumulation of acetylated and therefore highly active p53. [score:3]
The miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family and has therefore been classified as a single family of miRNAs. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
MiR-34, which is up-regulated with aging and modulates neurodegeneration in Drosophila and in aged heart by regulating cardiac aging [24], was also increased in aged skeletal muscle. [score:4]
For example, in the liver, age-regulated miRNAs such as miR-34, -93, and -214 target a gene important for oxidative stress defense and decrease its activity with aging [7]. [score:4]
[1 to 20 of 2 sentences]
92
[+] score: 7
At 18 h, 71 miRNAs were upregulated (such as miR-3061-3p, miR-466c-5p and miR-146b-5p), and 32 were downregulated (such as miR-3071-5p, miR-34c-3p and miR-1899) (Figure 3A). [score:7]
[1 to 20 of 1 sentences]
93
[+] score: 7
For instance, miR-34 was identified as a direct p53 target that regulates apoptosis, cell-cycle arrest, or senescence, contributing to tumor suppression [25- 27]. [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
Other miRNAs from this paper: mmu-mir-34b, mmu-mir-21a, mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
Similar to diabetic mice, kallistatin inhibits miR-34 and superoxide formation but stimulates sir-2.1 synthesis in C. elegans. [score:3]
Indeed, miR-34a levels are underexpressed in a variety of human tumors, and low levels of miR-34 have been related to poor clinical outcome of cancer patients [66, 67]. [score:3]
Furthermore, human kallistatin treatment prolongs the lifespan of wild-type C. elegans under heat or oxidative stress conditions but has no effect on miR-34 or sir-2.1 (SIRT1 homolog) C. elegans mutants. [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 7
Collectively, the results display 1700020I14Rik interacts with miR-34-5p by both directly targeting and Ago2 -dependent ways in DN. [score:4]
By online databases (USCS, miRbase and BiBiserv2 software) prediction, ten candidates of putative targets for 1700020I14Rik were predicted and miR-34-5p was chosen for further study for being a DN-related miRNA 17, 18 and containing three binding sites in 1700020I14Rik transcript. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 7
A previous paper showed that the miR-34 family, which is a direct transcriptional target of p53, might induce cell cycle progression [42]. [score:4]
miR-34 has been reported to be differentially regulated after ionizing radiation in different cell lines, as well as in mouse spleen and brain, indicating the importance of this miRNA gene family in the response to ionizing radiation. [score:2]
In the present investigation, differential expression of miR-34 was not observed. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 7
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-30b, mmu-mir-141, mmu-mir-151, mmu-mir-10b, mmu-mir-191, mmu-mir-143, mmu-mir-30e, mmu-mir-34b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-21a, mmu-mir-10a, mmu-mir-139, mmu-mir-375, mmu-mir-196b, mmu-mir-465a, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-208b, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-6240, mmu-mir-30f, mmu-mir-465d, mmu-mir-466c-3
In contrast, the expression of miR-34c was some 2-fold higher in the epithelium of the caput epididymis versus that of the cauda, and in the case of miR-467e, we failed to detect this miRNA in the epithelium of any segment of the epididymis (Supplementary Table S3) 26. [score:3]
For instance, miR-34c and miR-467e were found to be predominantly accumulated into epididymosomes in the cauda and caput epididymis, respectively. [score:1]
Candidate miRNAs included representatives with the highest abundance (according to sequencing data) in epididymosomes from the proximal (caput: miR-375, miR-467a, miR-467d and miR-467e) or distal epididymis (cauda: miR-34b, miR-34c, miR-139 and miR-196b). [score:1]
In this context, miR34c and miR-467e were again most abundant in cauda and caput spermatozoa, respectively 22. [score:1]
The selected miRNAs fall into one of two groupings: i) high accumulation in the caput (miR-375, miR -467a, miR-467d and miR-467e), or ii) high accumulation in the cauda epididymis (miR-34b, miR-34c, miR-139 and miR-196b). [score:1]
[1 to 20 of 5 sentences]
98
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
A previous study showed that runx2 is a target of miR-30c, miR-135a, miR-204, miR-133a, miR-217, miR-205, miR-34, miR-23a and miR-338 [34]. [score:3]
Both miR-34c and miR-16, which increased at 2w+, the stage of osteocytes, are possibly osteocyte markers and repressors of osteoblast-maintaining genes. [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 7
A number of studies have shown that miRNAs, such as miR-34, miR-125, miR-200, miR-205, miR-328, and miR-30, were down-regulated and acted as tumor suppressors in breast cancer [16– 22]. [score:6]
The miR-34 family, including miR-34a, miR-34b/c, plays an important role in the p53 networking [17, 23– 25]. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 6
Other miRNAs from this paper: mmu-mir-141, mmu-mir-34b, mmu-mir-34a, mmu-mir-199b
As stated above, several components of the Notch signaling are target of the miR-34 family members [15, 31, 33, 34]. [score:3]
MiR-34 family members were first identified as tumor suppressors [10, 11] and are associated with a variety of tumors [17]. [score:2]
The miR-34 family members share high sequence homology [9]. [score:1]
[1 to 20 of 3 sentences]