sort by

201 publications mentioning hsa-mir-320a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-320a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 357
The PCR results demonstrated that pre-miR-320a transfection could significantly upregulate miR-320a expression in MDA-MB-231 and BT-549 cells (more than 50 folds), and anti-miR-320a transfection could significantly downregulate miR-320a expression in SK-BR-3 cell (about 5 folds) (Figure 2A). [score:11]
Pre-miR-320a transfection in MDA-MB-231 and BT-549 cells significantly upregulated miR-320a expression (more than 50 folds), and anti-miR-320a transfection in SK-BR-3 cells significantly downregulated miR-320a expression (about 5 folds). [score:11]
Figure 4MTDH expression in paired breast cancer and normal tissue samples and its in vitro effect on breast cancer migration/invasion A. Among the 18 cancer tissues with low miR-320a expression, MTDH was overexpressed in 17 (arrow, MTDH was underexpressed in cancer tissues). [score:9]
In this study, pre-miR-320a and anti-miR-320a were introduced to upregulate and downregulate miR-320a expression respectively. [score:9]
We found that miR-320a upregulation in MDA-MB-231 and BT-549 cells significantly inhibited cell migration and invasion abilities (Figure 2B, Supplementary Figure S1), and miR-320a downregulation in SK-BR-3 cells significantly promoted cell migration and invasion (Figure 2C, Supplementary Figure S1). [score:9]
To explore the possible mechanisms implicated in the suppression of migration and invasion induced by miR-320a, we adopted a wi dely acknowledged bioinformatics tools (TargetScan) to search for the potential targets. [score:7]
To assess whether MTDH and VDAC1 are clinically correlated with miR-320a expression, we examined their expression in 18 paired fresh tissue samples where miR-320a was underexpressed in breast cancer more than 2-fold in comparison to normal adjacent breast tissues by western blot (MTDH and VDAC1) and PCR (miR-320a). [score:7]
Therefore, we conclude that miR-320a can suppress MTDH expression and inhibit breast cancer invasion and metastasis in vivo. [score:7]
In contrast, inhibition of miR-320a expression in SK-BR-3 cells resulted in marked induction of MTDH and VDAC1 protein expression, whereas YWHAZ protein level was decreased (Figure 3B). [score:7]
A. Among the 18 cancer tissues with low miR-320a expression, MTDH was overexpressed in 17 (arrow, MTDH was underexpressed in cancer tissues). [score:7]
In addition, the function study showed MTDH expression was directly inhibited by miR-320a. [score:6]
Downregulation of miR-320a would result in the MTDH overexpression which contributes to the progression of breast cancer. [score:6]
The result showed that miR-320a was downregulated in breast cancer, which was in favor of previous report which suggested that miR-320a functions as a tumor suppressor. [score:6]
In conclusion, our data suggest that miR-320a may inhibit invasion and metastasis of breast cancer by downregulating MTDH. [score:6]
We examined miR-320a expression in 41 pairs of fresh breast cancer and their corresponding non-tumorous breast tissues, which showed that miR-320a was significantly downregulated in breast cancer tissues. [score:6]
MTDH expression was inversely correlated with the expression level of miR-320a. [score:5]
Next we ascertained whether MTDH reduction might produce a suppression of cell invasion/migration similar to miR-320a overexpression. [score:5]
The western blot results showed that miR-320a could effectively inhibit MTDH expression. [score:5]
Our previous CISH study for miR-320a showed that miR-320a expression in invasive breast cancer with LN metastasis was significantly lower than that of breast cancer in situ, and patients exhibiting low miR-320a expression levels had shorter overall survival times. [score:5]
Moreover, qRT-PCR analysis revealed that miR-320a overexpression caused suppression or degradation of MTDH and VDAC1 mRNA in MDA-MB-231 and BT-549 cells. [score:5]
Ectogenic overexpression of MTDH was able to rescue migration/invasion attenuated by miR-320a, confirming that MTDH was a major target of miR-320a. [score:5]
com/breast) to narrow down the targets within potential oncogenes, and finally identified six genes (GNB2L1, GRB2, HLTF, MTDH, VDAC1 and YWHAZ) which were among the possible target mRNAs of miR-320a. [score:5]
Comparatively, suppression of miR-320a expression caused increased mRNA levels of MTDH, VDAC1 and YWHAZ in SK-BR-3 cells (Figure 3C). [score:5]
The wild-type 3′-untranslated sequences (wt-3′UTR) of potential targets containing the miR-320a binding site were amplified by PCR. [score:5]
Patients suffering LN or distant metastasis are more apt to have low miR-320a expression [24] and high MTDH expression. [score:5]
B, C. MTDH, VDAC1 and YWHAZ protein (B) and mRNA expressions (C) in breast cancer cells after miR-320a introduction and suppression. [score:5]
Decreased miR-320a expression was associated with high MTDH expression which contributed to breast cancer metastasis and poor prognosis. [score:5]
Moreover, function studies showed that MTDH silencing phenocopied overexpression of miR-320a in breast cancer cells, resulting in migration/invasion suppression. [score:5]
In addition, we found that MTDH, a metastasis adhesion gene that is frequently overexpressed in breast, prostate, liver, kidney and colon cancer [26], was a novel functional target of miR-320a in breast cancer. [score:5]
Overexpression of miR-320a in MDA-MB-231 and BT-549 cells resulted in significant reduction of MTDH and VDAC1 protein expression levels, whereas YWHAZ protein level was unchanged. [score:5]
Given that miR-320a is tightly related to cancer invasion, we consider the in vivo tumor size is affected through miR-320a induced invasion inhibition instead of proliferation regulation. [score:4]
MTDH status correlates with miR-320a expression in breast cancer. [score:3]
Figure 6 A. Representative images of MTDH and miR-320a expression in consecutive sections. [score:3]
MiR-320a is downregulated in breast cancer tissues and cell lines. [score:3]
In our study, the luciferase reporter assay, mRNA quantification and western blot analysis demonstrated that MTDH was a direct downstream target of miR-320a, and there existed an inverse relationship between miR-320a and MTDH. [score:3]
We found that transfection of siRNAs against MTDH (Figure 4B, 4C) in MDA-MB-231 and BT-549 cells reduced cell invasion and migration abilities (Figure 4D, Supplementary Figure S1), which is similar to the effect of miR-320a overexpression. [score:3]
In terms of these findings, we hypothesize that miR-320a might act as a tumor suppressor in breast cancer. [score:3]
B. The growth curves showed miR-320a could inhibit tumor growth in the first two weeks. [score:3]
On the basis of our earlier study [24], we examined miR-320a expression by qRT-PCR in 41 paired fresh frozen breast samples. [score:3]
These data indicated that MTDH overexpression might be attributed to miR-320a reduction in breast cancer. [score:3]
MDA-MB-231 cells with miR-320a overexpression were subcutaneously injected into the third mammary pads. [score:3]
The present study provides new insight into anti-oncogenic roles of miR-320a in the breast cancer pathogenesis and suggests that miR-320a/MTDH pathway could be a putative therapeutic target in breast cancer. [score:3]
and further rescue study revealed that MTDH was the functional target gene of miR-320a. [score:3]
We cloned the wt-3′UTR of the potential target genes containing putative miR-320a binding sites into the pluc-reporter vector, and generated a series of luciferase reporter vectors. [score:3]
To the best of our knowledge, this is the first report to demonstrate that MTDH is the functional target gene of miR-320a. [score:3]
Identification of miR-320a target genes is critical for understanding its role in carcinogenesis. [score:3]
Spearman correlation was applied to assess the correlation between miR-320 a and MTDH expression. [score:3]
To conclude, these results indicate that MTDH and VDAC1 are potential targets of miR-320a in breast cancer. [score:3]
MTDH is a functional target of miR-320a. [score:3]
Figure 3MiR-320a targeted VDAC1 and MTDH in breast cancer cells A. Dual luciferase activity in 293T cells upon co-transfection of wild-type (wt) or mutant (mt) 3′-UTR -driven reporter construct and pre-miR-320a. [score:3]
PcDNA3.1- MTDH transfection could counteract miR-320a induced migration/invasion inhibition. [score:3]
A. Representative images of MTDH and miR-320a expression in consecutive sections. [score:3]
Together with the CISH result for miR-320a expression, a significantly inverse correlation between miR-320a and MTDH can be identified (Table 1). [score:3]
In the present study, we firstly demonstrated that miR-320a suppressed the migration and invasion abilities of breast cancer. [score:3]
In the present study, we also demonstrated that miR-320a suppressed breast cancer cell migration and invasion. [score:3]
Nonetheless, we found that the tumor with higher miR-320a expression tended to grow slowly in the early stage. [score:3]
More candidate target genes of miR-320a still need to be further explored. [score:3]
The tumor with ago-miR-320a transfection showed weaker MTDH expression than NC tumor. [score:3]
Figure 1 A. miR-320a was underexpressed in breast cancer tissues. [score:3]
The 18 paired samples where miR-320a in cancer tissue was 2-fold lower than normal tissue prepared for determining both miR-320a and its potential targets. [score:3]
Moreover, the qRT-PCR analysis revealed that miR-320a expression level in breast cancer cell lines (T-47D, MCF-7, SK-BR-3, BT-549, MDA-MB-231) was markedly lower than MCF10A, a non-tumorigenic breast epithelial cell line. [score:3]
Figure 7MiR-320a inhibited breast cancer metastasis in vivo A. Tumor formation after injection of MDA-MB-231 cell treated with ago-miR-320a or NC. [score:3]
Our earlier study showed that miR-320a expression in breast cancers with lymph node (LN) metastasis was significantly lower than those without LN metastasis, which indicated that miR-320a was involved in the process of breast cancer metastasis [24]. [score:3]
B. Migration/invasion inhibition in MDA-MB-231 and BT-549 cells after pre-miR-320a transfection. [score:3]
To date, only a few target genes of miR-320a are validated, including β-catenin [7], p olycomb complex protein Bmi-1 [10], integrin β3 [12], i nsulin-like growth factor-1 receptor [13], small GTP binding protein Rac1 [14], ARPP-19 [15], survivin [16], and neuropilin-1 [17], etc. [score:3]
A. miR-320a was underexpressed in breast cancer tissues. [score:3]
MiR-320a inhibits breast cancer invasion and metastasis in vivo. [score:2]
MicroRNA-320a (miR-320a) has been reported to be deregulated in multiple types of cancers, including intrahepatic cholangiocarcinoma [6], colon cancer [7], primary squamous cell lung cancer [8], and prostate cancer [9]. [score:2]
MiR-320a targeted VDAC1 and MTDH in breast cancer cells. [score:2]
Herein our data provided for the first evidence that VDAC1 and MTDH are target genes of miR-320a by luciferase reporter assay. [score:2]
MiR-320a inhibited breast cancer cell migration and invasion. [score:2]
MiR-320a alteration could significantly affect MTDH and VDAC1 expressions, but not YWHAZ. [score:2]
MiR-320a and MTDH expression level in 130 breast cancer samples. [score:2]
MiR-320a directly regulates MTDH and VDAC1. [score:2]
MiR-320a expression in breast cancer tissues/cells and normal breast tissues/cells. [score:2]
MiR-320a inhibited breast cancer metastasis in vivo. [score:2]
The data suggest that dysregulation of miR-320a may be involved in invasive breast cancer progression, and miR-320a presents a potential biomarker for the prognosis of invasive breast cancer [24]. [score:2]
B. miR-320a was underexpressed in breast cancer cell lines (MDA-MB-231, BT-549, SK-BR-3, MCF-7, and T-47D) compared with non-tumorigenic breast epithelial cell line MCF10A. [score:2]
MiR-320a suppresses migration and invasion of human breast cancer cells. [score:2]
After transfection with pcDNA3.1-MTDH or pcDNA3.1-control, pre-miR-320a or pre-NC was co-introduced into these cells (Figure 5A). [score:1]
To further determine the in vivo effect of miR-320a, we treated MDA-MB-231 cells with ago-miR-320a (Supplementary Figure S4). [score:1]
HEK-293T cells were seeded in 24-well plates, co -transfected with 10-nmol pre-miR-320a or pre-miR-NC and 100-ng pluc-3′-UTR, and harvested 24 hours after transfection. [score:1]
To investigate the clinical relevance of VDAC1, we investigated VDAC1 expression in 18 paired breast tissues using western blot; however, only 4 cases (22.2%) suffered high expression of VDAC1, and no obvious inverse correlation was observed between miR-320a and VDAC1. [score:1]
C. Migration/invasion promotion in SK-BR-3 cells after anti-miR-320a transfection. [score:1]
The interaction between miR-320a and MTDH. [score:1]
Figure 2 A. The transfection efficiencies for pre-miR-320a and anti-miR-320a were validated by qPCR. [score:1]
Briefly, all sections were digested with pepsin, prehybridized with a prehybridization solution at 54°C for 2 h, and then hybridized at 54°C for 16–20 h with 5′-digoxin-conjugated locked nucleic acid probes for miR-320a, U6 (positive control) and scrambled RNA (negative control) (all Exiqon, Copenhagen, Denmark). [score:1]
Figure 5 A. MTDH alteration after pcDNA3.1- MTDH and/or pre-miR-320a co-transfection. [score:1]
After transfection for 24 h, total RNAs were extracted and PCR for miR-320a was performed. [score:1]
To further explore miR-320a characteristics in breast cancer, we applied TaqMan qRT-PCR to quantify miR-320a expression in 41 pairs of fresh breast cancer tissues and the corresponding non-tumorous breast tissues, which showed that miR-320a was significantly lower in breast cancer tissues (P < 0.001) (Figure 1A). [score:1]
To further assess the relationship between miR-320a and MTDH, the expression of MTDH was investigated in 130 invasive breast cancer FFPE samples using IHC. [score:1]
Next we assessed the effect of miR-320a on MTDH, VDAC1 and YWHAZ protein levels by performing western blot. [score:1]
By cotransfection of pre-miR-320a and wt-pluc-reporter vector, we found that luciferase activity was decreased by pre-miR-320a in three (MTDH, VDAC1 and YWHAZ) of the six wt-3′UTR containing vectors compared with pre-NC, whereas mutation of the binding sites in these 3′-UTR-containing vector abolished responsiveness to pre-miR-320a (Figure 3A). [score:1]
For transient transfection, pre-miR-320a, anti-miR-320a (Invitrogen, Carlsbad, CA USA), siRNA- MTDH (RiboBio, Shanghai, China) and their cognate negative control (NC) RNAs were transfected into cells using lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. [score:1]
A. Tumor formation after injection of MDA-MB-231 cell treated with ago-miR-320a or NC. [score:1]
In the present study, we investigated the in vitro and in vivo biological functions of miR-320a, and then tried to identify its potential targets. [score:1]
In addition, 23 cases of paired fresh tissue samples (breast cancer tissues and the corresponding non-tumorous breast tissues) were collected at the time of surgery and snap frozen in liquid nitrogen immediately, which were prepared for miR-320a detection. [score:1]
The ago-miR-320a (RiboBio, Shanghai, China) for in vivo xenograft experiment was chemically modified and cholesterol-conjugated from a hydroxyprolinol-linked cholesterol solid support and 2′-OMe phosphoramidites [32]. [score:1]
When taking the CISH result for miR-320a into account together with the present IHC result for MTDH, we found an inverse relationship between miR-320a and MTDH (P = 0.007) (Table 1, Figure 6A). [score:1]
A. Dual luciferase activity in 293T cells upon co-transfection of wild-type (wt) or mutant (mt) 3′-UTR -driven reporter construct and pre-miR-320a. [score:1]
Immunohistochemistry was performed for MTDH, and CISH was performed for miR-320a. [score:1]
However, miR-320a alteration could not affect proliferation of breast cancer cells (Supplementary Figure S2). [score:1]
MDA-MB-231 and BT-549 cells were co -transfected with pre-miR-320a and pcDNA3.1- MTDH. [score:1]
After transfection with ago-miR-320a or NC for 24 h, 3×10 [6] cells were suspended in 100 μL phosphate buffered saline and then injected orthotopically into the third mammary fat pads on either side of 6 to 8-week-old female athymic nude mice (Shanghai Laboratory Animal Center, Chinese Academy of Sciences, Shanghai, China). [score:1]
MDA-MB-231 and BT-549 cells were transfected with pre-miR-320a, and SK-BR-3 cells were transfected with anti-miR-320a. [score:1]
Of the 7 mice in NC group, 4 (57.1%) developed lung metastasis while none suffered metastasis in the mice with ago-miR-320a transfection (Figure 7D). [score:1]
However, the detailed biological roles of miR-320a in breast cancer and the underlying mechanisms remain unexplored. [score:1]
A. The transfection efficiencies for pre-miR-320a and anti-miR-320a were validated by qPCR. [score:1]
A. MTDH alteration after pcDNA3.1- MTDH and/or pre-miR-320a co-transfection. [score:1]
Available data suggest that miR-320a plays pivotal roles in key cellular processes of carcinogenesis [10, 11]. [score:1]
We found that luciferase activity was decreased by pre-miR-320a in three (MTDH, VDAC1 and YWHAZ) of the six wt-3′UTR vectors compared with pre-NC, whereas mutation of the binding sites in these 3′UTR-containing vector abolished responsiveness to pre-miR-320a. [score:1]
The results showed that the passed cells significantly decreased after pre-miR-320a transfection. [score:1]
[1 to 20 of 112 sentences]
2
[+] score: 322
In AGS, BGC-823, and HGC-27 cells, the overexpression of miR-320 resulted in the inhibition of FoxM1 mRNA expression and the recovery of P27 [KIP1] expression (Figure 2A, 2B and 2C). [score:9]
miR-320a directly inhibits the expression of FoxM1 through the binding of FoxM1 3′-UTR, resulting in the increased expression of P27 [KIP1]. [score:8]
Figure 7Overexpression of FoxM1 and inhibition of P27 [KIP1] by miR-320a knockdown in nude mice A. Tumorigenesis after injection of BGC-823 cells stably expressing miR-320a and controls. [score:8]
FoxM1- P27 [KIP1] axis is a direct target of miR-320aThe effect of miR-320a on FoxM1 expression was evaluated using overexpression of miR-320a mimics and inhibitors. [score:8]
On the contrary, the inhibition of miR-320a resulted in the overexpression of FoxM1 and the decreased expression of P27 [KIP1] both at the mRNA and protein levels (Figure 2D-2J). [score:7]
F. Percentage positive area for FoxM1 and P27 [KIP1] expression with the control and miR-320a inhibitors stable expression determined immunohistochemically. [score:7]
Association of miR-320a reduced expression and increased FoxM1 expression with the inhibition of P27 [KIP1] in human gastric cancer. [score:7]
Thus, miR-320a directly targeted the binding site located at FoxM1 3′-UTR and FoxM1- P27 [KIP1] axis may be a direct target of miR-320a. [score:7]
The luciferase assay and the recovery experiment further revealed that miR-320a controlled the expression of P27 [KIP1] through directly binding to the 3′-UTR of FoxM1, thus inhibiting FoxM1 expression. [score:7]
Figure 1Association of miR-320a reduced expression and increased FoxM1 expression with the inhibition of P27 [KIP1] in human gastric cancerQRT-PCR analyses of A. miR-320a and B. FoxM1 mRNA in normal and cancerous human gastric tissues. [score:7]
With the transfection of miR-320a inhibitors, the FoxM1 expression increased with P27 [KIP1] inhibition in all the gastric cancer cell lines. [score:7]
Overexpression of FoxM1 and inhibition of P27 [KIP1] by miR-320a knockdown in nude mice. [score:6]
Figure 3The recovery experiment of miR-320a's regulation of P27 [KIP1] expression through FoxM1in human gastric cancer cells A. Western blot analyses of FoxM1 and P27 [KIP1] protein levels in gastric cancer cells treated with control and miR-320a inhibitors or FoxM1 siRNA for 48 h. B. Western blot analyses of FoxM1 and P27 [KIP1] protein levels. [score:6]
The results of clone genetics and the recovery experiment showed that the inhibition of cell proliferation with miR-320 overexpression was through the regulation on FoxM1- P27 [KIP1] axis. [score:6]
D. QRT-PCR analysis of FoxM1 and P27 [KIP1] mRNA expression with stably expressing miR-320a and control. [score:5]
To identify the mechanisms involved in miR-320a -associated gastric tumor growth, we examined the effect of miR-320a inhibition on FoxM1 and P27 [KIP1] expression in the tumors. [score:5]
E. HE and IHC staining for FoxM1 and P27 [KIP1] in the control group (left panel) and miR-320a inhibitors stable expression group (right panel). [score:5]
By qRT-PCR and immunohistochemistry (IHC), we observed suppression of miR-320a expression and activation of FoxM1 in 10 cases (71.5%). [score:5]
There are few studies of the function of miR-320a, including its inhibition of ARDP-19/ERRr in breast cancer and targeting ITGB3 in bladder carcinoma [19, 20]. [score:5]
The effect of miR-320a on FoxM1 expression was evaluated using overexpression of miR-320a mimics and inhibitors. [score:5]
In order to determine whether miR-320a affects the P27 [KIP1] expression by suppressing FoxM1, the recovery experiment was performed. [score:5]
The results in human samples also showed that miR-320a expression negatively correlated with FoxM1 expression but positively with P27 [KIP1]. [score:5]
As shown in Figure 6, inhibition of miR-320a resulted in the increase of colonies in all three gastric cancer cell lines, while co-transfection of miR-320a inhibitors and FoxM1 siRNA almost recovered the number (Figure 6A, 6B). [score:5]
While with the co-transfection of miR-320a inhibitors and the special FoxM1 siRNA, both the expression of FoxM1 and P27 [KIP1] recovered to the normal levels (Figure 3A, 3B). [score:5]
Human gastric cancer tissues exhibit low miR-320a expression and increased FoxM1 expression. [score:5]
The nude mice mo dels confirmed that the inhibition of miR-320a could improve tumorigenesis with overexpression of FoxM1 and decrease of P27 [KIP1]. [score:5]
QRT-PCR and IHC analyses demonstrated that silencing of miR-320a increased expression of FoxM1 and decreased expression of P27 [KIP1] (Figure 7C, 7D and 7E). [score:5]
The results of qRT-PCR and IHC showed that the expression of miR-320a was decreased in gastric cancer samples and negatively correlated with FoxM1 expression. [score:5]
miR-320a regulates proliferation of gastric cancer cells through FoxM1- P27 [KIP1] axisColony formation assay in AGS, BGC-823, and HGC-27 cells revealed that enforced expression or knockdown of miR-320a affected cloning of cells (Figure 5A). [score:4]
The recovery experiment of miR-320a's regulation of P27 [KIP1] expression through FoxM1in human gastric cancer cells. [score:4]
A. Colony formation ability in AGS, BGC-823 and HGC-27 cells with overexpression and knockdown of miR-320a and B. quantification. [score:4]
Compared with normal human tissues, gastric cancer specimens showed significant inhibition of miR-320a expression and activation of FoxM1 (Figure 1A, 1B and 1C). [score:4]
Altogether, our data have revealed a crucial role of miR-320a in limiting the gastric carcinoma by directly targeting FoxM1- P27 [KIP1] axis. [score:4]
miR-320a suppression increases gastric tumor growth in nude mice through altered FoxM1- P27 [KIP1] signalingTo evaluate the effect of miR-320a knockdown on the gastric tumor growth in vivo, we established stable lentiviral-miR-320a inhibitor -transfected BGC-823 cells and injected them subcutaneously into nude mice. [score:4]
Figure 5 A. Colony formation ability in AGS, BGC-823 and HGC-27 cells with overexpression and knockdown of miR-320a and B. quantification. [score:4]
FoxM1- P27 [KIP1] axis is a direct target of miR-320a. [score:4]
Therefore, miR-320a inhibited the proliferation of human gastric cells through the regulation on FoxM1- P27 [KIP1] axis in vitro. [score:4]
The potential mechanisms of miR-320a's down-regulation of gastric cancer may be diverse. [score:4]
A. Colony formation ability in AGS, BGC-823 and HGC-27 cells with knockdown of miR-320a or co-knockdown of FoxM1 siRNA (5μM) and B. quantification. [score:3]
A. Western blot analyses of FoxM1 and P27 [KIP1] protein levels in gastric cancer cells treated with control and miR-320a inhibitors or FoxM1 siRNA for 48 h. B. Western blot analyses of FoxM1 and P27 [KIP1] protein levels. [score:3]
Our in vitro and in vivo data indicate that the biological activity of miR-320a is to inhibit the gastric cancer cell proliferation. [score:3]
Sixteen (8-10 weeks old) male nude mice were purchased from QING ZI LAN Animal Company (Nanjing, China) and divided into two groups with one as control and the other as miR-320a inhibition. [score:3]
The special fragment of the FoxM1 3′-UTR containing the miR-320A predicted target site was synthesized by Invitrogen (USA). [score:3]
Figure 2The effect of miR-320a on FoxM1 and P27 [KIP1] expression in human gastric cancer cellsqRT-PCR analyses of A. miR-320a, B. FoxM1 and C. P27 [KIP1] mRNA levels in control and miR-320a mimics -transfected AGS, BGC-823 and HGC-27cell lines after 48 h. * P < 0.05 and ** P < 0.01. [score:3]
Transfection of miR-320a mimics reduced the number of colonies, while the inhibition of miR-320a markedly increased the number of colonies (Figure 5B). [score:3]
Figure 6 A. Colony formation ability in AGS, BGC-823 and HGC-27 cells with knockdown of miR-320a or co-knockdown of FoxM1 siRNA (5μM) and B. quantification. [score:3]
miR-320a suppression increases gastric tumor growth in nude mice through altered FoxM1- P27 [KIP1] signaling. [score:3]
G. Western blot analyses of FoxM1 and P27 [KIP1] protein levels in gastric cancer cells treated with control and miR-320a mimics or inhibitors. [score:3]
These results suggest that miR-320a suppression increases the tumor growth through altered FoxM1- P27 [KIP1] signaling. [score:3]
The effect of miR-320a on FoxM1 and P27 [KIP1] expression in human gastric cancer cells. [score:3]
C. Growth curve with stably expressing miR-320a and control. [score:3]
The profiling identified that miR-320a was inhibited in human gastric cancer tissues vs. [score:3]
D. miR-320a, E. FoxM1 and F. P27 [KIP1] mRNA levels in control and miR-320a inhibitors -transfected AGS, BGC-823 and HGC-27 cells after 48 h. * P < 0.05 and ** P < 0.01. [score:3]
In contrast to control cells, lentiviral-miR-320a inhibitor -transfected BGC-823 cells produced much larger gastric tumors with faster growth (Figure 7A, 7B). [score:3]
The comparison of FoxM1, P27 [KIP1] and miR-320a expression, and foci numbers after different treatments was made with a Student's t-test. [score:3]
Colony formation assay in AGS, BGC-823, and HGC-27 cells revealed that enforced expression or knockdown of miR-320a affected cloning of cells (Figure 5A). [score:3]
Next, we validated FoxM1 as a direct target of miR-320a by luciferase report assay. [score:3]
This clinical evidence supports the negative association of miR-320a and FoxM1 expression in gastric cancer. [score:3]
B. Tumor volume with stably expressing miR-320a and controls. [score:3]
Thus, we analyzed the expression of miR-320a and FoxM1 in human gastric cancer species. [score:3]
The mimics and the inhibitor of miR-320a were purchased from Ruibo (Guangzhou, PR China). [score:3]
One group was injected with miR-320a inhibitor stable-transduction cells and the other group was injected with the matched control cells. [score:3]
Bioinformatics analysis indicated that the target of miR-320a is FoxM1. [score:3]
A. Tumorigenesis after injection of BGC-823 cells stably expressing miR-320a and controls. [score:3]
To examine the direct conjugation of miR-320a to the 3′-UTR of FoxM1, pMIR-REPORT- FoxM1-3′-UTR and pMIR-REPORT- FoxM1-3′-UTRmut were co -transfected into AGS, BGC-823 and HGC-27 cell lines with miR-320a mimics. [score:2]
org)] predicted that miR-320a is an up-stream regulator of FoxM1. [score:2]
miR-320a regulates proliferation of gastric cancer cells through FoxM1- P27 [KIP1] axis. [score:2]
To evaluate the effect of miR-320a knockdown on the gastric tumor growth in vivo, we established stable lentiviral-miR-320a inhibitor -transfected BGC-823 cells and injected them subcutaneously into nude mice. [score:2]
miR-320a directly bound to the 3′-UTR of FoxM1. [score:2]
MiR-320a has been identified to act as a tumor suppressor in some types of cancers, such as colon cancer, breast cancer, and bladder cancer [19– 21]. [score:2]
In this study, we aimed to identify the role of miR-320a in gastric carcinoma and the down-stream FoxM1 and P27 [KIP1] regulatory mechanisms both in vitro and in vivo. [score:2]
FoxM1, P27 [KIP1] and miR-320a expression in different tissue samples analyzed by qRT-PCR and IHC was evaluated by One-Way ANOVA. [score:1]
Co-transfection of miR-320a and wild-type 3′-UTR plasmid reduced the luciferase activity by approximately 62% relative to the control, whereas mutant 3′-UTR co-transfection almost restored the luciferase activity (Figure 4A, 4B and 4C). [score:1]
The protein levels of FoxM1 and P27 [KIP1] were also affected by miR-320a (Figure 2G-2J). [score:1]
The recovery experiment for miR-320a of colon genetics. [score:1]
The recovery experiment was done also on clone genetics to determine the role of FoxM1- P27 [KIP1] axis in the biological activity of miR-320a. [score:1]
Since these cells are at different differentiation stages, they have different transfection efficiency with miR-320a mimics. [score:1]
miR-320a was involved in gastric cells proliferation. [score:1]
The biological activity of miR-320a was examined in vitro and in vivo. [score:1]
In AGS, BGC-823 and HGC-27 cells, miR-320a mimics were co -transfected with FoxM1 wild-type or mutant-type 3′-UTR plasmids. [score:1]
C. Correlation of miR-320a and FoxM1levels in human gastric cancer tissues after standardization with matched normal tissues. [score:1]
A. The wild sequence on 3′-UTR of FoxM1 that could be bound by miR-320a and the corresponding mutant sequence. [score:1]
More work needs be done to elucidate the role of miR-320a in gastric carcinoma. [score:1]
Based on our findings, we propose that miR-320a might be useful as an anti-gastric cancer therapeutic agent. [score:1]
qRT-PCR analyses of A. miR-320a, B. FoxM1 and C. P27 [KIP1] mRNA levels in control and miR-320a mimics -transfected AGS, BGC-823 and HGC-27cell lines after 48 h. * P < 0.05 and ** P < 0.01. [score:1]
QRT-PCR analyses of A. miR-320a and B. FoxM1 mRNA in normal and cancerous human gastric tissues. [score:1]
Considering the major role of FoxM1 in many types of cancer, miR-320a might be a promising agent to treat other cancers, such as hepatic carcinoma. [score:1]
We have previously found that gastric carcinoma samples have activated several signal pathways, including the Forkhead box M1 (FoxM1) signaling pathway, which includes special miR-320a [17, 18]. [score:1]
We also found an important miRNA, miR-320a, in this study. [score:1]
Figure 4 A. The wild sequence on 3′-UTR of FoxM1 that could be bound by miR-320a and the corresponding mutant sequence. [score:1]
In this study, we demonstrate that miR-320a has an anti-tumor role in gastric cancer. [score:1]
[1 to 20 of 91 sentences]
3
[+] score: 318
MiR-320a inhibits the proliferation and invasion of NSCLC cells in vitro by targeting VDAC1Gene expression meta-analysis identified VDAC1 as a predictor of poor outcome in early stage NSCLC, and knockdown of VDAC1 expression has been shown to inhibit cancer cell proliferation and tumor growth [26, 27], which prompted us to hypothesize that miR-320a may affect NSCLC cell viability through VDAC1. [score:12]
We found that transfection of miR-320a in A549 and H1299 cells significantly suppressed the protein expression of VDAC1, while re -expression of VDAC1 by transfecting VDAC1 cDNA that cannot be targeted by miR-320a in miR-320a-tranfected cells rescued this suppression (Figure 5A), as determined by Western botting. [score:11]
Our results indicated that VDAC1 was a direct target of miR-320a in NSCLC cells, and miR-320a down-regulated VDAC1 expression in NSCLC cells. [score:9]
Further, we confirmed that over -expression of miR-320a in A549 and H1299 cells resulted in significant suppression of cell proliferation and decreased migration, and this suppression could be rescued after re -expression of VDAC1. [score:9]
Gene expression meta-analysis identified VDAC1 as a predictor of poor outcome in early stage NSCLC, and knockdown of VDAC1 expression has been shown to inhibit cancer cell proliferation and tumor growth [26, 27], which prompted us to hypothesize that miR-320a may affect NSCLC cell viability through VDAC1. [score:8]
Up-regulation of miR-320a inhibits proliferation and invasion of NSCLC cells by targeting VDAC1. [score:8]
We found that transfection of miR-320a in A549 and H1299 cells significantly suppressed the protein expression of VDAC1, and this suppression could be rescued by transfecting VDAC1 cDNA in miR-320a-tranfected cells. [score:7]
Our results showed that miR-320a mimics -transfected cells exhibited a significant reduction in the tumor size compared with NC transfectants, suggesting that up-regulation of miR-320a expression possesses a potential tumor suppressive effect. [score:7]
Collectively, our results indicate that miR-320a directly targets VDAC1 mRNA and negatively regulates expression of VDAC1 in both NSCLC cell lines and tissues. [score:7]
In order to determine whether miR-320a directly targets and regulates VDAC1 expression in NSCLC cells, we performed gain-of-function and rescue experiments. [score:7]
Using cell proliferation assay, over -expression of miR-320a in A549 and H1299 cells resulted in significant suppression of cell proliferation, while re -expression of VDAC1 in miR-320a-tranfected cells significantly increased cell proliferation in A549 and H1299 cells (Figure 5B). [score:6]
In summary, our findings suggest that reduced expression of miR-320a facilitates the development of NSCLC by increasing VDAC1 expression. [score:6]
To ascertain whether the decreased expression of hVDAC1 leading to inhibition of cell proliferation and invasion acts through a disruption of energy production, cellular ATP levels by mitochondria isolated from control, miR-320a-tranfected, and re -expression of VDAC1 in miR-320a-tranfected cells were compared. [score:6]
To determine whether miR-320a is down-regulated in NSCLC cells, expression levels of miR-320a were analyzed by qRT-PCR in five human NSCLC cell lines and five normal lung tissues. [score:6]
These results indicate that miR-320a may negatively regulate VDAC1 expression through targeting its 3′-UTR. [score:6]
Based on our results showing that miR-320a was decreased in NSCLC cells, we attempted to determine whether miR-320a is capable of targeting and regulating VDAC1 expression in NSCLC cells. [score:6]
In this current study, we show that miR-320 expression is markedly decreased in NSCLC, which in turn facilitates the development of NSCLC through increasing VDAC1 expression. [score:6]
MiR-320a is highly expressed in normal lung tissues and down-regulated in NSCLC cells. [score:5]
Taken together, our results demonstrate that decreased expression of VDAC1 by miR-320a contributes to the suppression of the growth of NSCLC cells. [score:5]
B. The expression levels of miR-320a were measured in 5 human NSCLC cell lines and 5 nromal lung tissues by qRT-PCR, and the expression levels of miR-320a were normalized to U6 RNA expression for subsequent analyses. [score:5]
HE staining showed that there were more necrosis regions in miRNA mimics transfected tumor cells group than in NC group, indicating tumor cells' proliferation was suppressed when overexpressing miR-320a. [score:5]
These data further demonstrate that decreased VDAC1 expression by miR-320a contributes to the suppression of the growth of NSCLC cells. [score:5]
MiR-320a may serve as a tumor suppressor gene in NSCLC pathogenesis, and miR-320a may be a promising therapeutic target in the treatment of NSCLC. [score:5]
HE staining showed that there were more necrosis regions in miRNA mimics transfected tumor cells group than in NC group, indicating tumor cells' proliferation was suppressed when overexpressing miR-320a (Figure 6C). [score:5]
miR-320a negatively regulates VDAC1 mRNA expression in NSCLC samples. [score:4]
Our results demonstrated that miR-320a was down-regulated in five NSCLC cell lines, especially in A549 and H1299 cells (Figure 2B). [score:4]
We determined whether MiR-320a mimics inhibited the proliferation of NSCLC cells, and whether it could be rescued by transfecting VDAC1 cDNA if the inhibiting effect existed. [score:4]
Our results showed that miR-320a mimics -transfected cells exhibited a significant reduction in the tumor size compared with NC transfectants, suggesting that increased miR-320a expression possesses a potential tumor suppressive effect (Figure 6A, 6B). [score:4]
In matrigel invasion assays, overexpression of miR-320a significantly decreased migration of A549 and H1299 cells, while re -expression of VDAC1 in miR-320a-tranfected cells significantly increased migration of A549 and H1299 cells (Figure 5C). [score:4]
Furthermore, we examined whether the endogenous expression of VDAC1 in NSCLC cells is regulated by miR-320a. [score:4]
Previous studies had reported that miR-320a was down-regulated in human primary squamous cell lung carcinoma [25]. [score:4]
MiR-320a inhibits the proliferation and invasion of NSCLC cells in vitro by targeting VDAC1. [score:4]
Effect of miR-320a over -expression on tumorigenicity. [score:3]
We found that VDAC1 mRNA levels were negatively correlated with miR-320a expression levels in NSCLC tissues (r = −0.50, p < 0.001) (Figure 4C). [score:3]
miR-320a targets VDAC1 in NSCLC cell lines. [score:3]
miR-320a is highly expressed in lung tissues and decreased in NSCLC cell lines. [score:3]
MiR-320a directly targets VDAC1 in NSCLC cells. [score:3]
Figure 4 A. qRT-PCR analysis of miR-320a expression in 60 pairs of NSCLC tissues and their corresponding non-tumor tissues. [score:3]
Figure 3 A. Wild-type (WT) and mutant (Mut) of putative miR-320a targeting sequences in VDAC1 mRNA 3′-UTR. [score:3]
Cells were co -transfected with firefly luciferase reporter plasmid containing putative miR-320a targeting sequences. [score:3]
Expression of miR-320a was normalized to U6. [score:3]
D. The expression levels of miR-320a in miR-320a mimics transfected tumor cells group and NC group determined by RT-PCR. [score:3]
A. Wild-type (WT) and mutant (Mut) of putative miR-320a targeting sequences in VDAC1 mRNA 3′-UTR. [score:3]
C, D. Effects of miR-320a on the endogenous VDAC1 expression levels. [score:3]
A. qRT-PCR analysis of miR-320a expression in 60 pairs of NSCLC tissues and their corresponding non-tumor tissues. [score:3]
A. qRT–PCR analysis of miR-320a, 320b, 320c and 320d expressions in 60 NSCLC corresponding non-tumor tissues. [score:3]
Our results showed that overexpression of miR-320a significantly decreased the activity of luciferase fused with wild-type of VDAC1-3-UTR, but barely affected the activity of luciferase fused with mutated VDAC1-3′-UTR (Figure 3B). [score:3]
A. Western blotting analysis was performed to determine the expression level of VDAC1 after transfection of negative control (NC), miR-320a mimics (miR-320a) or miR-320a plus pGL3-VDAC1 (miR-320a + VDAC1). [score:3]
The clinicopathologic features of 60 patients were listed in Table 1. The expression levels of miR-320a, 320b, 320c and 320d were analyzed using quantitative real-time polymerase chain reaction (qRT-PCR) and normalized against an endogenous control (U6 RNA). [score:3]
Figure 5 A. Western blotting analysis was performed to determine the expression level of VDAC1 after transfection of negative control (NC), miR-320a mimics (miR-320a) or miR-320a plus pGL3-VDAC1 (miR-320a + VDAC1). [score:3]
After normalization to the expression value of normal tissues, RNA levels of miR-320a and mRNA levels of VDAC1 in NSCLC tissues were analyzed by Pearson's correlation coefficient analysis. [score:3]
Total RNAs were extracted from 60 NSCLC tissues, and the expression levels of miR-320a and VDAC1 were analyzed by qRT-PCR. [score:3]
To this end, two NSCLC cell lines (A549 and H1299) were transfected with miR-320a mimics, and VDAC1 expression were determined by qRT-PCR and Western blotting. [score:3]
We found that VDAC1 expression was substantially decreased by mimics of miR-320a in NSCLC cells (Figure 3C, 3D). [score:3]
The upper panel shows one potential target site on 3′-UTR of VDAC1 and the lower panel shows multiple sequence alignment of miR-320 with the binding site on 3′UTR of VDAC1. [score:3]
Therefore, we want to know if there is a functional link between miR-320a and a higher expression of VDAC1 in NSCLC. [score:3]
All primers were listed in Table 2. U6 small RNA was used as an internal control for normalization and quantification of miR-320 expression. [score:2]
We found the protein level of VDAC1 was decreased in miRNA mimics transfected tumor cells group compared to NC group when overexpressing miR-320a (Figure 6D, 6E). [score:2]
Based on the relative expression levels of miR-320 family in lung tissues, miR-320a was further selected to investigate its role in the development and progression of NSCLC. [score:2]
As shown in Figure 2A, miR-320a exhibits a higher expression level compared with miR-320b, 320c and 320d in lung tissues. [score:2]
As far as we know, this is the first report of regulatory mechanism between miR-320a and VDAC1. [score:2]
In our study cellular ATP levels by mitochondria isolated from control, miR-320a-tranfected, and re -expression of VDAC1 in miR-320a-tranfected cells were compared. [score:2]
MiR-320a has been reported to be decreased in human primary squamous cell lung carcinoma [25], and over -expression of VDAC1 is associated with worse outcomes in a number of cancers [26]. [score:2]
E. The protein level of VDAC1 was decreased in miRNA mimics transfected tumor cells group compared to NC group when overexpressing miR-320a. [score:2]
We also confirmed that the protein level of VDAC1 was decreased in miRNA mimics transfected tumor cells group compared to NC group when overexpressing miR-320a. [score:2]
A549 and H1299 cells treated with miR-320a showed a decrease of cellular ATP levels as compared to controls, while re -expression of VDAC1 in miR-320a-tranfected cells significantly increased cellular ATP levels of A549 and H1299 cells (Figure 5D). [score:2]
We found that A549 and H1299 cells treated with miR-320a showed a decrease of cellular ATP levels as compared to controls, while re -expression of VDAC1 in miR-320a-tranfected cells significantly increased cellular ATP levels of A549 and H1299 cells. [score:2]
Our results demonstrated that VDAC1 was negatively regulated by miR-320a in NSCLC cell lines. [score:2]
We identified a novel regulatory mechanism between miR-320a and VDAC1. [score:2]
Furthermore, we found MiR-320a was significantly decreased in NSCLC tissues versus adjacent non-tumor tissues, and its expression is negatively correlated with VDAC1 in NSCLC tissues by Pearson's correlation coefficient analysis. [score:2]
MiR-320a suppresses tumor growth of NSCLC xenografts. [score:2]
Taken together, these findings indicate that miR320a may be critically involved in the development and progression of human NSCLC cells. [score:2]
Furthermore, the newly published CLASH data provided us with the direct evidence showing that both miR-320a and miR-320c have a potential binding site in 3′UTR of VDAC1 [24]. [score:2]
Recently, miR-320 has been shown to be decreased in the squamous cell lung carcinoma tissues [25]. [score:1]
The mimics of miR-320a were transfected into HEK 293T cells, and luciferase assay was used to assess the regulation of VDAC1 by miR-320a. [score:1]
Figure 1 Schematic diagram of VDAC1 mRNA 3′-UTR and the potential binding site for miR-320a. [score:1]
Thus, we investigated the correlation between miR-320a expression and mRNA levels of VDAC1 in NSCLC tissues. [score:1]
In the present report, using computational analysis we found that miR-320 family has a potential binding site on VDAC1 mRNA 3′-UTR. [score:1]
Finally we used an in vivo mo del to evaluate the effect of miR-320a overexpression on tumorigenicity. [score:1]
A conserved miR-320 (miR-320a, 320b, 320c and 320d) binding site exists in the 3′-UTR of VDAC1 across human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR)), gorilla (Gorilla gorilla) and etc (Figure 1). [score:1]
Bioinformatic analysis of miR-320 binding site in VDAC1 mRNA 3′-UTR. [score:1]
Sequence of human miR-320a mimics was 5′-AAA AGC UGG GUU GAG AGG GCG A-3′. [score:1]
To determine the levels of miR-320 family in lung tissues, total RNAs were extracted from 60 adjacent non-tumor tissues from NSCLC patients. [score:1]
An in vivo mo del was used to evaluate the effect of miR-320a overexpression on tumorigenicity. [score:1]
C. A negative Spearman correlation between miR-320a and VDAC1 mRNA levels were found in 60 NSCLC samples. [score:1]
Schematic diagram of VDAC1 mRNA 3′-UTR and the potential binding site for miR-320a. [score:1]
Therefore, miR-320a was selected for further studies. [score:1]
D. ATP cellular levels were analyzed in A549 and H1299 cells after transfection of NC, miR-320a or miR-320a + VDAC1. [score:1]
A549 and H1299 cells were co -transfected with miR-320a mimics and negative control oligonucleotides. [score:1]
Briefly, HEK 293T cells plated in a 96-well plate were co -transfected with 50 nM miR-320a mimics or negative control oligonucleotides, 20 ng of firefly luciferase reporter and 10 ng of pRL-TK (Promega, USA) using the INTERFERin reagent (Polyplus-transfection, France). [score:1]
Our results confirmed that miR-320a is markedly decreased in five NSCLC cell lines, especially in A549 and H1299 cells. [score:1]
[1 to 20 of 91 sentences]
4
[+] score: 317
Western blot results verified that miR-320a transfection significantly decreased MMP2 and MMP7 proteins (P<0.05~0.001) through inhibiting SND1 or β-catenin expression (P<0.05~0.01) in GBM cells, and the suppressive effects of miR-320a could be reversed by SND1 or β-catenin overexpression (P<0.05~0.001; Figure 5E and 5F). [score:9]
These results indicate that SND1 promotes MMP2 expression as a signaling amplifier of TGFβ1 pathway, and that miR-320a restrains the MMP2 overexpression induced by TGFβ1 pathway overactivation via directly silencing SND1, thereby inhibiting the migration and invasion of GBM cells (Figure 6E). [score:8]
These facts indicated that miR-320a was a glioma suppressor, and suggested that SND1 and β-catenin overexpressions induced by miR-320a downexpression were important causes leading to the unlimited proliferation, migration and invasion of malignant glioma cells, highlighting the potential values of miR-320a, SND1 and β-catenin in the therapy of malignant gliomas. [score:7]
In our glioma specimens, the expression of Ki-67, a known proliferation marker, not only was significantly increased with glioma grade elevation, but also was inversely correlated with miR-320a expression and positively correlated with SND1 and β-catenin expressions. [score:7]
We ascertained 47 mRNAs co -expressing with miR-320a using the data from TCGA database, but only expressions of the six mRNAs had highly negative correlation with miR-320a expression in GBM (Supplementary Table 2). [score:7]
These data identify the positive correlations of SND1 and β-catenin expressions with the grades and cell proliferation of gliomas, reveal that they are potential prognostic biomarkers for glioma patients, and indicate that miR-320a downexpression is an important cause inducing SND1 and β-catenin overexpressions in gliomas. [score:7]
The genes of co -expression and highly inverse correlation with miR-320a in GBM were optimized as the candidates of miR-320a targets by analyzing the expression profile data from TCGA database. [score:7]
The results demonstrate that miR-320a directly binds with SND1 and β-catenin 3′-UTRs, and inhibits their protein expressions through inducing the mRNA degradation in GBM cells. [score:6]
Subsequently, we confirmed that miR-320a -induced knockdowns of SND1 and β-catenin significantly increased p21 [WAF1] or decreased cyclin D1, and reduced the expressions and extracellular activities of MMP2 and MMP7 of GBM cells, consequently suppressing their G1/S phase transition, proliferation, migration and invasion. [score:6]
miR-320a functions as a glioma suppressor by directly targeting SND1 and β-catenin. [score:6]
In summary, our study revealed that miR-320a inhibited the proliferation and invasion of glioma cells by directly targeting SND1 and β-catenin, and predicted better prognosis in human gliomas, especially in GBM. [score:6]
SND1 and β-catenin overexpressions are associated with miR-320a downexpression and poorer prognosis in human gliomas. [score:5]
The inverse correlation between miR-320a and SND1 or β-catenin implied that miR-320a downexpression resulted in SND1 and β-catenin overexpressions in gliomas. [score:5]
Combining the inverse relevance between miR-320a and SND1 or β-catenin in the glioma specimens, our results indicated that SND1 and β-catenin overexpressions induced by miR-320a downexpression could decrease p21 [WAF1] and also increase MMP2, MMP7 and cyclin D1 by enhancing the activities of TGFβ1/Smad and Wnt/β-catenin pathways, thereby accelerating the cell proliferation and invasion of malignant gliomas (Figure 6E). [score:5]
miR-320a inhibits GBM cell migration and invasion by targeting SND1 and β-catenin. [score:5]
Subsequently, the functions of the potential targets in gliomagenesis were assessed by reference review and the important ones were identified as the crucial targets of miR-320a in gliomas. [score:5]
Significantly, we found that glioma patients in the same grade, IDH status, age and KPS groups could be divided into two subgroups with different outcomes based on miR-320a expression, i. e., the higher expression of miR-320a was, the better prognosis of patients (DFS: P<0.0001; OS: P<0.0001; Figure 1E-1I and Supplementary Figure 3A-3D). [score:5]
Our present data verified that miR-320a expression was significantly decreased, while SND1 and β-catenin expressions were observably increased with the grade elevation in 120 human gliomas of WHO grade II-IV, and that the subgroups with higher miR-320a and lower SND1 and β-catenin had better prognoses in the glioma patients with the same grade, IDH status, age and KPS, suggesting that they were potential biomarkers in distinguishing glioma grades and specific biomarkers for prognostic -based glioma subclassification. [score:5]
In the present study, we identified miR-320a as a tumor suppressor to inhibit cell proliferation, migration and invasion in astrocytic gliomas. [score:5]
We demonstrated that miR-320a expression in gliomas was lower than that in the control (P<0.001) and that its expression was significantly decreased with the elevation of glioma grades and was the lowest in GBM (P<0.001; Figure 1A and 1B). [score:5]
Our findings also indicate that miR-320a downexpression is an important cause leading to SND1 and β-catenin overexpressions, and suggest that miR-320a, SND1 and β-catenin are potential therapeutic candidates for malignant gliomas. [score:5]
miR-320a inhibits the migration and invasion of GBM cells by targeting SND1 and β-catenin. [score:5]
miR-320a suppresses GBM cell proliferation by targeting SND1 and β-catenin. [score:5]
The analyses of CCK8, EdU and flow cytometry confirmed that miR-320a transfection significantly restrained the proliferation of GBM cells by inducing their G1 phase arrest, whereas β-catenin and SND1 overexpressions could abrogate the inhibition of miR-320a on the proliferation and cell cycle of GBM cells (P<0.05~0.001; Figure 4A-4E). [score:5]
To identify relationships between miR-320a expression in gliomas and histopathological grades, cell proliferation or patients’ prognoses in the same grade, IDH status, age and KPS groups, ISH and IHC were applied to detect endogenous miR-320a and Ki-67 expressions in the FFPE specimens of 120 gliomas and 20 nontumoral brain tissues from human. [score:5]
SND1 and β-catenin expressions correlate with grades, miR-320a expression, IDH status and prognosis in human gliomas. [score:5]
miR-320a suppresses GBM cell proliferation by targeting β-catenin and SND1. [score:5]
Meanwhile, shRNA knockdown of SND1 perfectly imitated the suppressive effects of miR-320a on migration and invasion of GBM cells by decreasing Smad2, Smad4 and MMP2 mRNAs. [score:4]
In this paper, we report for the first time that miR-320a inhibits the proliferation, migration and invasion of glioma cells by directly silencing SND1 and β-catenin, and identify miR-320a and SND1 as independent predictors and β-catenin as an auxiliary predictor for the survival of glioma patients. [score:4]
Our current study reveals that miR-320a functions as an important suppressor for the cell proliferation, migration and invasion of malignant gliomas by directly silencing SND1 and β-catenin (Figure 6E). [score:4]
Mechanistically, we for the first time demonstrated that SND1 and β-catenin were direct functional targets of miR-320a in gliomas, which facilitated our understanding of the mechanisms underlying glioma malignant progression. [score:4]
SND1 and β-catenin are the direct targets of miR-320a in GBM cells. [score:4]
These findings reveal that miR-320a decreases cyclin D1 and increases p21 [WAF1] by directly silencing β-catenin or SND1, thereby suppressing the G1/S phase transition and proliferation of GBM cells. [score:4]
These findings reveal that miR-320a reduces MMP2 and MMP7 by directly silencing SND1 or β-catenin, thereby suppressing the migration and invasion of GBM cells. [score:4]
E. Schematic illustration of the molecular pathways by which miR-320a suppresses the proliferation, migration and invasion of glioma cells. [score:3]
miR-320a suppresses the proliferation, migration and invasion of GBM cells. [score:3]
Prompted by the above findings, we examined the tumor suppressive effects of miR-320a on GBM cell lines by transient mimics transfection. [score:3]
More importantly, miR-320a might be a novel biomarker for molecular subclassification of malignant gliomas and a therapeutic candidate for these lethal diseases. [score:3]
Furthermore, miR-320a transfection reduced cyclin D1 and increased p21 [WAF1] (P<0.01) by decreasing β-catenin or SND1 (P<0.05~0.01) in GBM cells, which could also be reversed by β-catenin or SND1 overexpression (P<0.05~0.01; Figure 4F and 4G). [score:3]
Our in vitro results showed that miR-320a could effectively suppress the proliferation, migration and invasion of GBM cells. [score:3]
To investigate the underlying mechanisms by which miR-320a suppresses glioma cell proliferation, U87MG and U251 cells were alone transfected with Scr or miR-320a mimics and co -transfected with miR-320a mimics plus the plasmid expressing β-catenin (miR-320a+ CTNNB1) or SND1 (miR-320a+SND1). [score:3]
We identified SND1 and β-catenin as direct functional targets of miR-320a by the analysis of TCGA data, bioinformatics prediction, luciferase reporter assay, qRT-PCR and Western blot. [score:3]
Kaplan-Meier analysis showed that the patients with higher level of miR-320a had longer disease-free survival (DFS; P<0.0001) and overall survival (OS; P<0.0001; Figure 1D). [score:3]
To further clarify the underlying mechanisms of SND1 in miR-320a -induced MMP2 reduction and invasive suppression, we focused on Smad2 and Smad4, two pivotal downstream signaling proteins of SND1 in TGFβ1 pathway. [score:3]
These data indicate the inverse association of miR-320a expression with the grades and cell proliferation of gliomas, and reveal that miR-320a is a potential prognostic biomarker for glioma patients. [score:3]
The results indicate that miR-320a is an important inhibitor of the proliferation, migration and invasion of GBM cells. [score:3]
C. Pearson correlation analysis between miR-320a and Ki-67 expressions in our FFPE samples. [score:3]
Patients were stratified into high and low expression subgroups using the median of miR-320a LIs. [score:3]
However, the expression pattern, prognostic significance and biologic functions of miR-320a remain to be fully elucidated in gliomas. [score:3]
gov/) was used to validate the correlation between miR-320a expression and DFS or OS in GBM. [score:3]
Recent studies have shown that miR-320a promoter may directly bind with transcriptional regulation factor ETS-1 and long noncoding RNA NLC1-C, and may also be methylated, which both repress miR-320a transcription in cancer cells [35, 36]. [score:3]
C. Pearson correlation analysis between the expressions of miR-320a and SND1 or β-catenin in our FFPE samples. [score:3]
However, the molecular mechanism of miR-320a downexpression remains unknown in gliomas. [score:3]
Moreover, miR-320a expression was inversely correlated with proliferation index (Ki-67 LI; r=-0.976, P<0.0001; Figure 1C and Supplementary Figure 1A and 1B). [score:3]
miR-320a inhibits glioma invasion by weakening TGFβ1 pathway activity. [score:3]
miR-320a is decreased in gliomas and its higher expression predicts better prognosis. [score:3]
miR-320a may function as a tumor suppressor or promoter in different tumors [17, 18], but its exact roles and clinical relevance in gliomas remain indeterminate. [score:3]
miR-320a expression correlates with grades, proliferation, IDH status and prognosis in human gliomas. [score:3]
D. Predicted miR-320a binding sites in the 3′-UTRs of SND1 and β-catenin by TargetScan and the designed mutant 3′-UTRs in which miR-320a binding sites were deleted. [score:3]
Stem-loop qRT-PCR detection further verified that miR-320a expression in 7 human GBM cell lines was also significantly reduced in comparison with human astrocyte cell line UC2 (Supplementary Figure 2). [score:3]
The aberrant expression of miR-320a has been reported in various malignant tumors [5– 7]. [score:3]
Since miR-320a may also exert anti-glioma effects by silencing other targets [37, 38] and SND1 is a pivotal multifunctional protein promoting oncogenesis and progression [26], the prognostic significance of β-catenin is not as important as those of miR-320a and SND1 in gliomas. [score:3]
The cDNAs coding SND1 or β-catenin 3′-untranslated region (3′-UTR; p-WT) and their mutants (p-MT) without the putative miR-320a binding sites were inserted downstream of the firefly luciferase reporter gene in the pEZX-MT01 vectors (GeneCopoeia, Guangzhou, China). [score:3]
B. Comparisons among groups of miR-320a expression level [Labeling index (%), LI] in the FFPE samples of 120 gliomas and 20 nontumoral control brain tissues. [score:3]
TargetScan and miRanda predictions revealed that both the 3′-UTRs of SND1 and β-catenin mRNAs contained a conserved miR-320a binding site (Figure 2D). [score:3]
In bladder and colon cancers, its expression level is extremely low [8– 9], whereas in retinoblastoma, higher miR-320a level is associated with a more malignant phenotype [10], suggesting that function of this miRNA may be distinct and even opposite in different tumors. [score:3]
cgi) were used to further verify whether the candidates were the potential targets of miR-320a. [score:3]
A. Growth curves from U87MG and U251 cells transfected with Scr or miR-320a and cotransfected with miR-320a plus plasmid expressing β-catenin (miR-320a+CTNNB1) or SND1 (miR-320a+SND1) assessed by CCK8 assay. [score:2]
The dual-luciferase assay showed that miR-320a could effectively suppress the luciferase activity delivered by recombinant reporter vectors with wild type 3′-UTRs of SND1 and β-catenin in U87MG and U251 cells (P<0.05~0.001), whereas the mutant 3′-UTRs without miR-320a binding sites failed to exert the same effect (Figure 2E). [score:2]
The SND1-knockdown (SND1-SH) and control (SND1-HK) sub-cell lines of U87MG and U251 cells were established by infecting lentiviruses to stably mimic the silencing effect of miR-320a. [score:2]
Figure 4 A. Growth curves from U87MG and U251 cells transfected with Scr or miR-320a and cotransfected with miR-320a plus plasmid expressing β-catenin (miR-320a+CTNNB1) or SND1 (miR-320a+SND1) assessed by CCK8 assay. [score:2]
Transwell assays discovered that the migratory and invasive capacities of GBM cells were obviously weakened by miR-320a transfection (P<0.001) and partially recovered by SND1 and β-catenin overexpressions (P<0.05~0.001; Figure 5A and 5B). [score:2]
Figure 1 A. Representative images of miR-320a ISH with LNA -modified probe. [score:1]
The recombinant plasmids were used to transfect U87MG or U251 cells alone (Mock) or with the miR-320a and Scr using X-tremeGENE HP DNA Transfection Reagent (Roche). [score:1]
Our study indicated that miR-320a was decreased in gliomas, especially in GBM. [score:1]
The cells of rescue groups were transfected with miR-320a plus pSG5-SND1 (320a+SND1) or pCI-neo-β-catenin WT (320a+CTNNB1). [score:1]
Moreover, the qRT-PCR and Western blot detections further confirmed that miR-320a transfection significantly decreased the mRNAs and proteins of SND1 and β-catenin in U87MG and U251 cells (P<0.05~0.001; Figure 2F-2I). [score:1]
Moreover, miR-320a -transfected U251 cells displayed lower colony formation efficiency (P<0.01; Figure 2B), further confirming its long-term anti-proliferative effect. [score:1]
CCK8 assays showed that miR-320a could effectively inhibit the proliferation of U87MG and U251 cells compared with Scr control 48 or 72 h after transfection (P<0.01~0.001; Figure 2A). [score:1]
The U87MG and U251 cells of miR-320a group (miR-320a) and control group (Scr) were transfected with the corresponding dsRNA oligonucleotides using X-tremeGENE siRNA Transfection Reagent (Roche) at a final concentration of 50 nM. [score:1]
Furthermore, miR-320a transfection dramatically suppressed the migration and invasion of U87MG and U251 cells, as gauged by the transwell assays (P<0.001; Figure 2C) and wound healing assays (P<0.05~0.001; Supplementary Figure 5). [score:1]
The computing method of SND1 LI and β-catenin LI was the same as that of miR-320a (see Figure 1 legend) and the data in (B) are presented as the mean ± SD. [score:1]
D-I. Kaplan-Meier analysis of the correlation between miR-320a and DFS (left) or OS (right) of all the glioma patients (D) and the patients with WHO grade II (E), grade III (F), grade IV (G), IDH1 R132H mutant (H) and IDH1/2 wild-type (I) gliomas. [score:1]
For ISH detection, deparaffinized tissue sections were hybridized with 50 nM LNA -modified and digoxin-labeled miR-320a oligonucleotide probe (Exiqon, Vedbaek, Denmark; Supplementary Table 4) for 1 h at 55°C, incubated with 5μg/ml anti-digoxin- Rhodamine antibody (Roche Applied Science, Indianapolis, IN, USA) overnight at 4°C, and stained with DAPI in the dark for 15 min at room temperature (RT). [score:1]
Human miR-320 family has 5 mature members termed as miR-320a to e. They are encoded by the loci on chromosome 1, 8, 13, 19 and X, respectively. [score:1]
Importantly, we found that miR-320a, SND1 and β-catenin, not only were correlated with one another, but also predicted the survival of glioma patients, highlighting their potential values as novel prognostic biomarkers in human gliomas. [score:1]
In situ hybridization (ISH) and immunohistochemistry (IHC)For ISH detection, deparaffinized tissue sections were hybridized with 50 nM LNA -modified and digoxin-labeled miR-320a oligonucleotide probe (Exiqon, Vedbaek, Denmark; Supplementary Table 4) for 1 h at 55°C, incubated with 5μg/ml anti-digoxin- Rhodamine antibody (Roche Applied Science, Indianapolis, IN, USA) overnight at 4°C, and stained with DAPI in the dark for 15 min at room temperature (RT). [score:1]
Then, 5μm continuous sections were prepared for HE staining, miR-320a in situ hybridization and the immunohistochemical detections of SND1, β-catenin and Ki-67. [score:1]
Furthermore, SND1 and β-catenin LIs in gliomas were negatively correlated with miR-320a LI (r = −0.981 or −0.975, P<0.0001; Figure 3C) and positively correlated with Ki-67 LI (r=0.984 or 0.975, P<0.0001; Supplementary Figure 1C and 1D). [score:1]
Thus, miR-320a, SND1 and β-catenin could be the novel and clinical feasible candidates for glioma diagnosis and subclassification. [score:1]
A. Representative images of miR-320a ISH with LNA -modified probe. [score:1]
Both the multivariate and univariate analyses showed that miR-320a was an independent predictor for DFS and OS of glioma patients (Table 1 and Supplementary Table 1). [score:1]
miR-320a levels in UC2 cell line and 7 human GBM cell lines (LN308, U118, U251, SNB19, TJ905, TJ899, U87MG) were quantified by stem-loop qRT-PCR with U6 as the internal control (Ribobio). [score:1]
For TGFβ1 stimulation, the U87MG sub-cell lines were incubated with TGFβ1 (10 ng/ml) for 24 h. miR-320a mimics (miR-320a) and a corresponding scrambled control sequence (Scr; Supplementary Table 5) were synthesized by Ribobio (Guangzhou, China). [score:1]
The prognostic value of miR-320a in GBM was further verified in GBM patients from TCGA database (DFS: P = 0.0036; OS: P = 0.0317; Supplementary Figure 4). [score:1]
Moreover, MMP2 and MMP7 mRNAs were also notably reduced in the miR-320a -transfected cells (P<0.01; Figure 5D). [score:1]
[1 to 20 of 96 sentences]
5
[+] score: 267
In addition to miR-320a, we found a group miRNAs which are differentially expressed in CAD patients, among which miRNAs, miR-21, miR-30a, miR-126, and miR-133a were reported to be up-regulated and miR-208a and miR-320a to be downregulated in infarcted myocardium 35, 36. [score:9]
As expected, SP1 overexpression induced hsa-mir-320a promoter activity, while down-regulation of SP1 suppressed hsa-mir-320a promoter activity, and these effects were reversed by mutations introduced into the 18bp region (Fig. 6B). [score:9]
Considering the major function of miRNAs is to regulate protein expression, we analysed the profile of diseases and pathways that predicted protein targets of miR-320a may involved in (Table 2). [score:8]
Consistent with the results of SRB assays, overexpression of miR-320a inhibited cell proliferation and induced apoptosis, while knocking down endogenous miR-320a by miR-320a inhibitor showed opposite effects (Fig. 5C and D). [score:7]
We constructed SRF expression plasmid (pcDNA-SRF), synthesized hsa-miR-320a mimics, random control and inhibitor (referred as miR-320a, random and inhibitor, respectively) and transfected cultured endothelial cells as indicated in the figure legends. [score:7]
As shown in Figure 2A and Figure S3B, treating mice with pSilencer-miR-320a markedly increased miR-320a expression while treating with pSilencer-anti-miR-320a significantly suppressed miR-320a expression in aorta and plasma. [score:7]
However, miR-320a did not show any effects on the expression of Sp1, ERK2 and JNK in endothelium cells, indicating that miR-320a directly regulates SRF rather than via indirect pathways (Fig. 4E). [score:6]
The results showed that the level of SRF expression was significantly reduced in ApoE [−/−] and wild-type mice treated with pSilencer-miR-320a comparing to the controls; whereas knockdown of endogenous miR-320a by pSilencer-anti-miR-320a injection increased the SRF expression (Fig. 4C). [score:6]
Moreover, miR-320a significantly suppressed nitric oxide release in HUVEC cells, while miR-320a inhibitor directly stimulated nitric oxide production (Fig. 5E). [score:6]
How might miR-320a expression be upregulated in atherosclerosis? [score:6]
To look into the mechanisms of miR-320a in promoting atherosclerosis progress, we first identified the putative targets of miR-320a using computational predictions as described at MICROCOSM, miRanda, TargetScan and Pic Tar. [score:5]
Finally, it was demonstrated that miR-320a expression inhibits human-derived endothelium cell proliferation and induces apoptosis. [score:5]
In vivo, a striking regulation of lipid profiles was detected and atherosclerotic lesion formation was regulated by systemic injection of miR-320a or miR-320a inhibitor encoding plasmid in ApoE [−/−] mice. [score:5]
Pathway name shows the pathways that the predicted targets miR-320a may involved in; Frequency in target gene group shows the number of GO associations belonging to the pathway; Frequency in all genes shows the background distribution from all human genes GO associations. [score:5]
Moreover, induced by SP1, miR-320a downregulated SRF, a key endothelial cell regulator essential for VGEF induced cell signalling and angiogenesis, and contributed to endothelial dysfunction. [score:5]
We focused on one of the potential targets (SRF/c-fos serum response element -binding transcription factor), since it is crucial in cardiovascular physiology and its high probability to be a genuine target of miR-320a as revealed by bioinformatics analysis. [score:5]
As we identified, SP1, a transcription factor, contributes to lipid metabolism and inflammation, regulate miR-320a expression directly. [score:5]
Thus, SP1 seems to participate in the regulation of miR-320a, although SP1 may also target other factors involved in endothelial cell function. [score:4]
Indeed, the expression of miR-1 and miR-133a were regulated by miR-320a. [score:4]
SP1 regulates miR-320a expression in endothelial cells. [score:4]
These data suggest that SP1 is involved in the regulation of miR-320a expression. [score:4]
MiR-320a overexpression promotes atherogenesis by augmenting multiple risk factors of coronary artery disease (CAD). [score:4]
Figure 6SP1 regulates miR-320a expression in endothelial cells. [score:4]
MiR-320a treatment depressed SRF expression and its downstream factors in liver from ApoE [−/−] mice: LXR, an important nuclear receptor target of the cholesterol metabolites; sterol response element -binding protein 2 (SREBP2), which promotes the transcription of the LDL receptor (Fig.  S4A). [score:4]
In addition, SP1 overexpression increased miR-320a level, and knockdown of SP1 reduced miR-320a level (Fig. 6C). [score:4]
We speculate miR-1 and miR-133a are indirect targets of miR-320a downstream of SRF. [score:4]
The combined data show that miR-320a negatively regulates the SRF expression. [score:4]
Interestingly, the expression miR-1 and miR-133a, miRNAs regulated by SRF 21, were significantly decreased by miR-320a transfection in vivo and in vitro (Fig. 4F and G). [score:4]
Further, overexpression of miR-320a resulted in significant increase in levels of plasma lipid and serum inflammatory cytokines. [score:3]
Seven miRNAs (miR-21, miR-30a, miR-126, miR-133a, miR-195, miR-208a and miR-320a) were confirmed to be differentially expressed between CAD and control samples (Fig. 1B). [score:3]
Vectors carrying luciferase reporter gene without the SRF 3′UTR, with the SRF 3′UTR or with the mutant SRF 3′UTR were cotransfected with miR-320a mimics, random or inhibitor. [score:3]
To analyse the activity of the putative hsa-mir-320a gene promoter, three plasmids pGL3-1K (−885/+195), pGL3-500bp (−427/+96) and pGL3-150bp (−152/+96) were constructed by placing different length of the putative promoter region and the 5′-end of the gene in front of the reporter coding sequence (Fig. 6A), and were cotransfected with SP1 expression plasmid (pcDNA-SP1) and SP1 specific siRNAs into HUVEC cells. [score:3]
In conclusion, our data provide evidence that overexpression of miR-320a is a key risk factor for atherosclerosis. [score:3]
Taken together, these data indicate that SRF is a physiological target of miR-320a. [score:3]
And the expressions of miR-320a in liver were shown in Figure S4C. [score:3]
Utilizing ApoE [−/−] mice, it was found that miR-320a expression attenuates endothelium cell function and promotes atherogenesis. [score:3]
MiR-320a mimics resulted in significant decrease in luciferase activity while miR-320a inhibitor slightly increased luciferase activity (Fig. 4B). [score:3]
MiR-320a inhibits endothelia cell proliferation and induces cell apoptosis via SRFBoth gain-of-function and loss-of-function approaches were employed to explore the role of miR-320a and SRF in cultured endothelial cells. [score:3]
Figure 4SRF is a target of miR-320. [score:3]
For the expressions of miR-320a and anti-miR-320a, two pairs of two complementary oligonucleotides were designed based on their sequences (Accession: MIMAT0000510), synthesized, annealed, and ligated into p Silencer 4.1-CMV neo vector (Ambion, ABI, Austin, TX, USA), respectively, according to the manufacturer's protocol. [score:3]
These results demonstrate that miR-320a adversely regulates lipid metabolism and therefore contributes to development of atherosclerosis and CAD. [score:3]
In vitro, miR-320a was shown to inhibit endothelial cells proliferation and induced apoptosis of endothelial cells. [score:3]
In both wild-type and ApoE [−/−] mice, miR-320a overexpression resulted in significant increase in TC, TG and LDL and significant decrease in HDL level. [score:3]
It was observed that circulating miRNA-320a was highly expressed in CAD patients. [score:3]
The levels of miR-320a in aorta were determined at 12 weeks by real-time PCR assays, which showed that the expression of mature miR-320a were significantly increased in ApoE [−/−] mice compared with wild-type C57BL6 mice, and pSilencer-anti-miR-320a treatment reduced the mature miR-320a in both wild-type mice and ApoE [−/−] mice, pSilencer-miR-320a treatment elevated mature miR-320a expression in both wild-type mice and ApoE [−/−] mice. [score:3]
The most important of all, overexpression of SRF reversed the effects of miR-320a. [score:3]
These observations strongly suggest that SRF is a physiological target of miR-320a. [score:3]
We detected the expressions of miR-1 and miR-133a by real-time PCR in aorta of miR-320a treated mice and endothelium cells treated with miR-320a. [score:3]
To provide further evidence, we examined the effects of miR-320a on SRF expression in vivo and in vitro by western blot. [score:3]
These results strongly indicate miR-320a promotes proinflammatory reactions, which greatly contribute to endothelia dysfunction, key components of atherosclerosis genesis and development. [score:2]
Cell viability analysis showed that addition of miR-320a decreased the number of viable cells in a time- and dose -dependent manner, while treatment of miR-320a inhibitor increased the number of viable cells as determined by the SRB assay (Fig. 5A and B). [score:2]
LF2K refers to lipofectamine 2000, n = 3. Data are expressed as relative percentage compared with normal control, * P < 0.05 versus control, ** P < 0.01 versus control, [##] P < 0.01 versus miR-320a. [score:2]
In in vitro assays, we transfected 2H-11 cells and HUVEC cells with miR-320a mimics, random control and inhibitor. [score:2]
MiR-320a inhibits endothelia cell proliferation and induces cell apoptosis via SRF. [score:2]
MiR-320a overexpression also increased vascular collagen deposition in ApoE [−/−] mice as shown by Masson trichrome staining (Fig. 2H). [score:2]
MiR-320a may serve as a novel biomarker and therapeutic target for atherosclerosis and CAD. [score:2]
Here, we provide evidence that miR-320a is a key regulator of atherogenesis. [score:2]
The results showed that miR-320a inhibited luciferase activity, compared with controls. [score:2]
SRF is a physiological target of MiR-320a. [score:2]
analysis identified serum response factor as a potential target for miR-320a, which was validated by luciferase reporter activity assay and Western-blot both in vitro and in vivo. [score:2]
MiR-320a transfection significantly reduced SRF expression (Fig. 4D). [score:2]
No change in luciferase activity was observed when miR-320a random control was used or when miR-320a mimics was co -transfected with the control vector without the SRF 3′UTR or with the mutant SRF 3′UTR. [score:1]
Our data reveal links among SP1, miR-320a, SRF and miR-1/miR-133a in endothelial dysfunction in atherosclerosis. [score:1]
Figure 2Effects of miR-320a on lipids metabolism and plaque formation in wild-type and ApoE [−/−] mice. [score:1]
Furthermore, analysis of plaque composition revealed a significant increase in smooth muscle cell content, whereas macrophage content also tended to be increased in the miR-320a treated ApoE [−/−] mice, indicated by α-actin staining and MAMO-2 staining (Fig. 2I and J, respectively). [score:1]
Effects of miR-320a on serum inflammatory cytokines and endothelium cell function in wild-type and ApoE [−/−] mice. [score:1]
Taken together, these data suggest that miR-320a plays important roles in endothelial cell dysfunction, a key event for atherogenesis via SRF. [score:1]
Here, we show that miR-320a is markedly elevated in both CAD patients and high risk individuals. [score:1]
HE staining suggested that the primary effect of miR-320a on adverse lipid profiles were not from the adverse effect of hepatic injury due to the method itself (Fig.  S4D). [score:1]
Since hsa-miR-320 participates in cardiac ischemia/reperfusion injury and lipid/glucose metabolism 7, 28, 29. [score:1]
ApoE [−/−] mice received pSilencer-miR-320a treatment developed significantly larger atherosclerotic lesions throughout the aorta comparing to the controls (Fig. 2G). [score:1]
And as a result, the free fatty acid levels in liver tissue were increased and anti-miR-320a treatment reversed the effects (Fig.  S4B). [score:1]
Significantly, pSilencer-miR-320a injection resulted in marked elevation of proinflammatory cytokines (Fig. 3A– F). [score:1]
Both gain-of-function and loss-of-function approaches were employed to explore the role of miR-320a and SRF in cultured endothelial cells. [score:1]
Interestingly, wild-type mice treated with pSilencer-miR-320a also developed atherosclerotic lesions (Fig. 2G). [score:1]
The 3′ end of predicted binding site (characters in red) in human SRF was completely complementary with the 5′ end of miR-320a, where the crucial seed regions (characters in blue) are located; Lower: the putative miR-320a binding sites within the SRF 3′UTR are conserved among mammalian species. [score:1]
The complimentary seed sequences of hsa-miR-320a were located at 1527–1533 bp of human SRF 3′UTR (Fig. 4A). [score:1]
Interestingly, ox-LDL, which is also the most important proatherosclerotic factor, increased miR-320a significantly, other than glucose or palmitate (Fig. 5F). [score:1]
Figure 5Effects of miR-320a on cell viability and function in cultured endothelium cells. [score:1]
Furthermore, we investigated the expression and function of miR-320a in liver. [score:1]
To examine the effects of miR-320a on the growth of endothelial cells, we carried outs. [score:1]
Sequence alignment revealed that one of these candidates miR-320a is encoded within the intergenic region of chromosome 8. The sequence coding for miR-320a is highly conserved in mammals (Fig. 1C), which prompted us to choose miR-320a for further study. [score:1]
Each group was treated via tail vein injection with different naked plasmids (negative treatment, pSilencer-random; pSilencer-anti-miR-320a; and pSilencer-miR-320a; 5 mg/kg every 4 weeks), respectively, while consuming a high-cholesterol diet containing 0.3% cholesterol and 21% (wt/wt) fat for 12 weeks. [score:1]
To test the effects of miR-320a on serum lipid profiles, plasmids carrying negative control sequence (negative treatment), miR-320a sense or antisense sequences (pSilencer-miR-320a and pSilencer-anti-miR-320a) were intravenously administrated to high-fat fed ApoE [−/−] mice and wild-type mice every 4 weeks for 12 weeks. [score:1]
Taken together, in current study, we determined the circulatory level of miR-320a in coronary heart disease patients and investigated its role in lipid metabolism and atherosclerosis formation utilizing in vivo and in vitro experimental mo dels. [score:1]
We analysed the promoter region of hsa-mir-320a and observed that it contains several binding sites for the transcription factor SP1, which contributes to lipid metabolism and inflammation 31. [score:1]
Although the plasma miR-320a levels were significantly higher in the high risk and CAD patients, there is very little difference in the lipid profile values among healthy volunteers, high-risk patients, and CAD patients. [score:1]
We next examined the effects of miR-320a on nitric oxide production, an important indicator of endothelium cell function (Fig. 3G). [score:1]
Conversely, pSilencer-anti-miR-320a treatment resulted in the dampening of the proinflammatory response. [score:1]
MiR-320a promotes adverse serum lipid profiles and atherogenesis in wild-type and ApoE [−/−] miceTo test the effects of miR-320a on serum lipid profiles, plasmids carrying negative control sequence (negative treatment), miR-320a sense or antisense sequences (pSilencer-miR-320a and pSilencer-anti-miR-320a) were intravenously administrated to high-fat fed ApoE [−/−] mice and wild-type mice every 4 weeks for 12 weeks. [score:1]
To construct pGL3-luciferase reporter plasmids, the 5′ fragments of hsa-mir-320a were inserted at the Mlu1 and Xho1 sites, into upstream of the luciferase gene in the pGL3.0 Vector (Promega Beijing, China) according to the manufacturer's protocol. [score:1]
[1 to 20 of 91 sentences]
6
[+] score: 194
We found that epithelial molecules, such as β-cadherin and E-cadherin mRNA, were down-regulated, while the mRNA levels of mesenchymal markers including Fibronectin, N-cadherin, Vimentin, ZEB1 and Snail2 were up-regulated in PANC-1 cells with enforced expression of miR-320a (Fig. 2G). [score:9]
The putative targets of miR-320a were predicted using target prediction programs, Target Scan, Pictar and miRanda. [score:7]
To explore whether the promotion of miR-320a on drug-resistance in pancreatic cancer cells was dependent on targeting PDCD4, we performed rescue experiments through over -expressing PDCD4 in PANC-1 and PATU8988 cells infected with lentivirus expressing miR-320a. [score:7]
In our study, we firstly show that miR-320a promotes 5-FU resistance through raising EMT transformation in pancreatic cancer cells, exhibiting as down-regulation of epithelial cells markers (β-cadherin and E-cadherin) and up-regulation of mesenchymal cells markers (Fibronectin, N-cadherin, Vimentin, ZEB1 and Snail2). [score:7]
To further determine whether PDCD4 was a direct target of miR-320a in pancreatic cancer cells, we over-expressed miR-320a in the two pancreatic cancer cell lines and detected PDCD4 protein levels. [score:6]
For example, miR-320a is associated with liver metastasis in colorectal cancer (CRC) and inhibits tumor invasion by targeting neuropilin1 26. miR-320a/c/d regulate GNAI1 on hepatocellular carcinoma cell migration and invasion post-transcriptionally 27. [score:6]
We found that miR-320a directly targeted the 3′-UTR of PDCD4 mRNA and repressed its expression. [score:6]
For miRNA target analysis, the 293TN cells were co -transfected with 0.4 ug of the reporter construct, 0.02 ug of pRL-TK-Renilla luciferase plasmid (Promega, Madison, WI, USA), and miR-320a over -expression construct or control. [score:5]
So we think miR-320a could suppress cell apoptosis by inhibiting PDCD4 and further contribute to drug-resistance, which will be studied in future. [score:5]
In our study, we created 5-FU-resistant pancreatic cancer cell lines and analyzed the expression profile of miRNAs using miRNA microarray to systematically screen the miRNAs involved in the induction of 5-FU drug resistance, and we demonstrated miR-320a played important role in regulating 5-FU resistance in pancreatic cancer firstly. [score:4]
In conclusion, we found that miR-320a was up-regulated in 5-FU resistant pancreatic cancer cells and that miR-320a could promote pancreatic cancer cell proliferation, migration and invasion then contributed to the increased 5-FU resistance. [score:4]
Up-regulation of miR-320a in PATU8988/5-FU cells. [score:4]
To determine whether PDCD4 is a direct target of miR-320a, wild-type 3′-UTR binding sites were cloned into the downstream of firefly luciferase coding region in pMIR-reporter vector. [score:4]
Taken together, these findings indicate that PDCD4 can be negatively regulated by miR-320a, and miR-320a modulates 5-FU resistance in human pancreatic cancer cells by targeting PDCD4. [score:4]
PDCD4 is a direct target of miR-320a in pancreatic cancer cells. [score:4]
These results led us to speculate that up-regulation of miR-320a may be associated with 5-FU resistance of pancreatic cancer cells. [score:4]
The relative luciferase activity was reduced to 60% of the control in miR-320a over -expression group (Fig. 5B). [score:3]
Over -expression of miR-320a promotes invasion of pancreatic cancer cells. [score:3]
While miR-320a was significantly up-regulated in the PATU8988/5-FU cells compared with that in PATU8988 cells with a fold change of 5.2 (***p < 0.0001). [score:3]
The rescue experiments indicated PDCD4 can rescue the phenotype by miR-320a gain of function and suggested that miR-320a played its function in drug-resistance of pancreatic cancer cells by targeting PDCD4. [score:3]
In this study, we firstly clarified miR-320a promoted pancreatic cancer cells proliferation and 5-FU resistance in pancreatic cancer cells by targeting PDCD4. [score:3]
In our study, we find that over -expression of miR-320a not only induces resistance to 5-FU, promotes EMT molecular marker changes, but also promotes proliferation, migration and invasion of pancreatic cancer cells. [score:3]
By the way, we found that over -expressing miR-320a can reduce sensitivity of the pancreatic cancer cells for gemcitabine, also promote gemcitabine resistance. [score:3]
Over -expression of miR-320a promotes pancreatic cancer Cell invasion. [score:3]
Consistent with the PDCD4 protein level, PDCD4 over -expression rescued the increased proliferation rate by miR-320a in PANC-1 and PATU8988 cells (Fig. 6B). [score:3]
Thus the IC50 values in miR-320a overexpressed cells were approximately 2.6 times higher than that of the control cells. [score:3]
Over -expression of miR-320a induces resistance to 5-FU in pancreatic cancer cells. [score:3]
IC50 of gemcitabine was 913.5 ng/ml for the GFP control, 2615 ng/ml for miR-320a over -expression group and 306.4 ng/ml for PDCD4 restore group in PANC-1 cells. [score:3]
Our analysis revealed that PDCD4 was a potential target of miR-320a. [score:3]
In this study, we found that over -expression of miR-320a can reduce the sensitivity of the pancreatic cancer cells for 5-FU, promote 5-FU resistance. [score:3]
The results showed that there were 20 miRNAs including miR-320a, miR-3153, miR-21, miR-221, miR-320e, significantly up-regulated in PATU8988/5-FU cells compared with PATU8988 cells. [score:3]
Pictar predicted PDCD4 to be a theoretical target gene of miR-320a. [score:3]
Over -expression of miR-320a promotes EMT molecular marker changes in pancreatic cancer cells. [score:3]
Over -expression of miR-320a promotes proliferation and migration of pancreatic cancer cells. [score:3]
Thus the IC50 values in miR-320a overexpressed cells were both higher than that of the control cells. [score:3]
Over -expression of miR-320a promotes pancreatic cancer cell proliferation and migration. [score:3]
Meanwhile, restoration of PDCD4 expression could attenuate the 5-FU or gemcitabine resistance of pancreatic cancer cells induced by miR-320a. [score:3]
The constructs were then co -transfected with miR-320a over -expression construct or control into 293T cells. [score:3]
These data suggested that miR-320a might serve as a potential target for pancreatic cancer therapy, and was suitable for establishing some quicker and easier clinical test method. [score:3]
MiR-320a was also demonstrated to enhance the sensitivity of human colon cancer cells to chemotherapy in vitro by targeting FOXM1 33. [score:2]
PATU8988 cells with miR-320a over -expression also exhibited markedly increased cell invasion (6.6-fold) at 24 h compared with the control cells (***p < 0.0001, Fig. 4B). [score:2]
Gemcitabine was also one of the most popular chemotherapy drugs used in pancreatic cancer treatment, so we also detected the effect of miR-320a in regulating gemcitabine resistance. [score:2]
The protein levels of PDCD4 were substantially decreased after ectopic over -expression of miR-320a in pancreatic cancer PANC-1 and PATU8988 cell lines (Fig. 5C,E) as evidenced by western blot assays (Fig. 5D,F). [score:2]
Previous studies have shown that miR-320a is dysregulated in several cancers and its potential function has also been partly explored in several studies. [score:2]
To further validate whether pancreatic cancer cells with miR-320a over -expression had enhanced motility, we detected cell migration using wound-healing assay. [score:2]
PANC-1 cells with miR-320a over -expression exhibited significantly increased cell invasion (5.4-fold) compared with the control cells at 24 h (***p < 0.0001, Fig. 4A). [score:2]
MiR-320a Targets PDCD4 in pancreatic cancer cells. [score:2]
MiR-320a was overexpressed successfully in PATU8988 and PANC-1 cells, determined by quantitative RT-PCR (Fig. 2A,D). [score:2]
Our migration results showed that over -expression of miR-320a increased cell migration compared with their control cells in PANC-1 cells and PATU8988 cells. [score:2]
So we speculated that miR-21 and miR-320a cooperatively contributed to drug-resistance of pancreatic cancer cells through down -regulating PDCD4 together. [score:2]
According to these data, expansion of miR-320a might have an important role for the acquisition of 5-FU and gemcitabine resistance. [score:1]
We found that IC50 of gemcitabine was evaluated as 2653 ng/ml for miR-320a over -expression group and 872.5 ng/ml for the control in PANC-1 cells, and 3066 ng/ml vs 954.7 ng/ml in PATU8988 cells (Fig. 2C,F). [score:1]
Over -expression of miR-320a can promote cell proliferation, migration, and invasion of pancreatic cancer cells, also lead to acquisition of EMT characteristic, which all contribute to 5-FU resistance. [score:1]
To determine the contribution of miR-320a to the 5-FU resistance in pancreatic cancer cells, PATU8988 and PANC-1 cells were transduced with lenti_miR-320a and lenti_GFP (as a control) respectively, and treated with 5-FU. [score:1]
IC50 was evaluated as 10.15 μg/ml for miR-320a over -expression group and 3.551 μg/ml for the control in PANC-1 cells, and 11.24 μg/ml vs 4.618 μg/ml in PATU8988 cells (Fig. 2B,E). [score:1]
However, there are no functional evidence of miR-320a in pancreatic cancer. [score:1]
A 500-bp DNA fragment flanking pre-miR-320a was inserted into pcDNA3.1(+) plasmid. [score:1]
In line with these findings, we demonstrated that miR-320a promoted proliferation and migration of pancreatic cancer cells. [score:1]
We found that miR-320a significantly promoted the migration rate during the opening of a wound created in a confluent monolayer (Fig. 3B) in PANC-1 and PATU8988 cells (Fig. 3D). [score:1]
A 500 bp DNA fragment flanking miR-320a was inserted into the downstream of CMV promoter in pMIRNA1 to generate pMIRNA1-miR-320a. [score:1]
IC50 of 5-FU was evaluated as 4.106 ug/ml for the GFP control, 9.898 ug/ml for miR-320a over -expression group and 2.001 ug/ml for PDCD4 restore group in PANC-1 cells. [score:1]
Altogether, our results verified that miR-320a played an important role in modulating 5-FU resistance in human pancreatic cancer cells. [score:1]
PDCD4 could rescue the increased proliferation rate and drug resistance induced by miR-320a in pancreatic cancer cells. [score:1]
Western Blot results indicated that transfection of PDCD4 can alleviate the reduction of PDCD4 which induced by miR-320a in pancreatic cancer cells (Fig. 6A). [score:1]
The 3′-UTR of PDCD4 messenger RNA contains a complementary site for the seed region of miR-320a (Fig. 5A). [score:1]
Virus particles (lenti-miR320a and lenti_GFP) were harvested and concentrated using PEG-it Virus Precipitation Solution (SBI). [score:1]
These results further suggested that miR-320a promoted pancreatic cancer cells to acquire a mesenchymal phenotype to facilitate drug resistance genesis. [score:1]
[1 to 20 of 67 sentences]
7
[+] score: 189
MiR-320 expression was down-regulated, while PBX3 was up-regulated in glioma tissues. [score:8]
PBX3 (Pre-B cell leukemia homeobox 3), a putative target gene of miR-320, has been reported to be upregulated in various tumors and promote tumor cell growth through regulating MAKP/ERK pathway. [score:7]
MiR-320 is downregulated in multiple cancers, including glioma and acts as tumor suppressor through inhibiting tumor cells proliferation and inducing apoptosis. [score:7]
In this research, we found that PBX3 was overexpressed in glioma tissues and was regulated by miR-320, suggested PBX3 may participate in the glioma inhibition function of miR-320. [score:6]
In summary, our current data demonstrated that miR-320 is downregulated in glioma tissues and inversely correlates with PBX3 expression. [score:6]
Either miR-320 overexpression or PBX3 knockdown suppressed the phosphorylation of Raf-1, p38, ERK1/2, ERK5 and JNK. [score:6]
In addition, miR-320 was demonstrated to inhibit osteosarcoma cell proliferation by directly targeting fatty acid synthase [22]. [score:6]
Taken together, the results presented indicated miR-320 may suppress glioma cell growth through targeting PBX3 and regulating MAPK pathway. [score:6]
MiR-320 downregulation and PBX3 upregulation was found in glioma tissues. [score:6]
Both miR-320 overexpression and PBX3 knockdown inhibited Raf-1/MAPK activation. [score:6]
In this study, we found that miR-320 expression was downregulated in glioma tissues. [score:6]
The results showed miR-320 expression was significantly increased by miR-320 mimics, while PBX3 expression was significantly reduced by miR-320 mimics (as shown in Fig.   2a–c). [score:5]
These results suggested that miR-320 directly modulate PBX3 expression by direct binding. [score:5]
Overexpression of miR-320 suppressed glioma cell proliferation, induced cell cycle arrest and apoptosis. [score:5]
To determine whether PBX3 expression was regulated by miR-320 in glioma cells, U87 and U251 cells were transfected with miR-320 mimic, and the expression of miR-320 and PBX3 was determined using qRT-PCR and western blot assays. [score:5]
MiR-320 overexpression or PBX3 knockdown inhibits MAPK pathway activation in glioma cells. [score:5]
Over expression of miR-320 inhibited glioma cell proliferation and induced cycle arrest and apoptosis. [score:5]
a miR-320 expression in U87 and U251 cells following transfection with miR-320 mimics or NC, and miR-320 expression was significantly increased in cells transfected with miR-320 mimics in comparison with that with NC. [score:5]
To address whether miR-320 functions through targeting PBX3, PBX3 knockdown was performed using shPBX3 and the effect of which on the activation of Raf-1, p38 and ERK1/2 was detected. [score:4]
b PBX3 expression in U87 and U251 cells following transfection with miR-320 or NC, and PBX3 expression was significantly reduced by miR-320 compared with NC. [score:4]
Either miR-320 overexpression or PBX3 knockdown induced inactivation of MAPK pathway. [score:4]
In addition, as a putative target gene of miR-320, whether miR-320 functions through regulating PBX3 remains unknown. [score:4]
MiR-320 overexpression suppressed glioma cells proliferation and induced cell cycle arrest and apoptosis. [score:4]
Dong et al. found miR-320 showed significantly low expression in glioblastoma patients [13], however, the exact role of miR-320 in glioma occurrence and development remains unknown. [score:4]
With former relevant researches, the present study suggested that miR-320 may acts as a tumor suppressor. [score:3]
c A representative result of western blot analysis for caspase-3 protein expression in glioma cells transfected with miR-320 mimics or NC. [score:3]
Fig.  1Altered expression of miR-320 and PBX3 in glioma tissues. [score:3]
We then explored the effect of miR-320 expression on cell cycle progression by flow cytometry methods. [score:3]
Mutations were introduced into the potential miR-320 binding sites using the QuikChange site-directed mutagenesis kit (Stratagene, Agilent, San Diego, CA, USA). [score:3]
Luciferase reporter assay showed that over -expression of miR-320 led to a marked decrease of Renilla luciferase activity, which was specifically abolished by the mutation of the corresponding anti-seed sequence in 3′ UTR of PBX3 (Fig.   2d). [score:3]
Wu et al. found miR-320 suppressed tumor angiogenesis driven by vascular endothelial cells in oral cancer by silencing neuropilin 1 [21]. [score:3]
MiR-320 may suppress glioma cells growth and induced apoptosis through the PBX3/Raf-1/MAPK axis, and miR-320 oligonucleotides may be a potential cancer therapeutic for glioma. [score:3]
c Western blot of PBX3 in U87 and U251 cells transfected with miR-320 mimics or NC, and protein expression of PBX3 was significantly reduced. [score:3]
PBX3 was negatively regulated by miR-320 in glioma cells. [score:2]
This study aimed to verify whether miR-320 influences glioma cells growth through regulating PBX3. [score:2]
Luciferase reporter assay was performed to verify the interaction between miR-320 and its targeting sequence in the 3′ UTR of PBX3 in glioma cells U87 and U251. [score:2]
Our results showed that either miR-320 mimics transfection or PBX3 knockdown significantly reduced the phosphorylation levels of Raf-1, p38, ERK1/2, ERK5 and JNK were in U87 and U251 cells. [score:2]
MiR-320 and PBX3 expression in glioma tissues and adjacent healthy tissues was determined using qRT-PCR. [score:2]
We identified PBX3 was regulated by miR-320 in glioma cells. [score:2]
In the present research we identified PBX3 was regulated by miR-320 in glioma cells. [score:2]
MiR-320 mimic transfection suppressed glioma cells proliferation, and induced cell cycle arrest and apoptosis. [score:2]
Twenty-four human glioma and paired adjacent nontumorous tissues were collected for determination of miR-320 and PBX3 expression using RT-qPCR and western blot assays. [score:2]
MiR-320 suppressed glioma cells proliferation through inducing cell cycle arrest at G0/G1 phase. [score:2]
a Growth curves of U87 and U251 cells transfected with miR-320 or NC. [score:1]
U87 and U251 cells were plated in six-well plates and transfected with miR-320 mimics. [score:1]
e Cell cycle distribution of U87 and U251 cells transfected with miR-320 mimics or NC. [score:1]
d Flow cytometric analysis of the indicated glioma cells transfected with NC or miR-320. [score:1]
a Annexin V/PI dual staining for U87 and U251 cells transfected with miR-320 mimics or NC. [score:1]
The results suggested miR-320 might functions through the PBX3/Raf-1/MAPK axis, and miR-320 oligonucleotides might be a potential cancer therapeutic for glioma. [score:1]
a and b Measurement of miR-320 and PBX3 expression in glioma and adjacent tissues of 24 patients using RT-qPCR. [score:1]
In addition, miR-320 transfection resulted in caspase-3 activation evidenced by the increased protein level of cleaved caspase-3 (Fig.   4c), suggesting miR-320 mediated glioma cell apoptosis is caspase enzyme dependent. [score:1]
b and c U87 and U251 cells transfected with miR-320 mimics were cultured for 2 weeks. [score:1]
The findings suggested miR-320 and PBX3 modulated MAPK pathway may contribute to their effect on the proliferation and apoptosis of glioma cells. [score:1]
d Computer prediction of miR-320 binding sites in the 3′UTR of PBX3 gene. [score:1]
Firefly luciferase reporters, Renilla luciferase pRL-TK vector (used as internal control, Promega, USA) and miR-320 mimics were co -transfected into the U87 and U251 cells. [score:1]
Luciferase reporter assays identified miR-320 directly blinds to the 3′ UTR of PBX3 in glioma cells. [score:1]
[1 to 20 of 56 sentences]
8
[+] score: 187
Histograms depicting six significantly different gene expression (A) and seven insignificant gene expression (B) within or regulate Wnt signaling pathway between miR-320 inhibitor -injected (n = 80) and NC inhibitor -injected (n = 50) groups. [score:10]
Knocking down miR-320 in mouse oocytes negatively affected embryonic developmental potential by inhibiting expression of Wnt signaling pathway. [score:7]
Significant and insignificant expression of Wnt signaling pathway genes in oocytes injected with either miR-320 inhibitor or NC inhibitor. [score:7]
Aspm, as reported as a positive regulator of Wnt signaling pathway 59, were down-regulated in the miR-320 inhibitor -injected group. [score:7]
We collected oocytes 8 hours (just before insemination) after injection with miR-320 inhibitor (n = 80) or NC inhibitor (n = 50) and measured the expression levels of 13 genes (Apc, Aspm, Btrc, Csnk1a1, Ctnna1, Ctnnb1, Dvl3, Gsk3b, Lef1, Lrp6, Numb, Tcf7 and Wnt7a) within or regulate Wnt signaling pathway by qRT-PCR. [score:6]
Down regulation of Aspm expression was reported to disrupt meiotic spindle organization in mouse oocytes 58, which may indicate that the low level of Aspm in miR-320 inhibitor -injected group may contribute to the damaged capacity of oocytes to fertilize and develop to 2-cell and blastocyst stage. [score:6]
However, in our study, the expression of Csnk1a1 were significantly increased in miR-320 inhibitor -injected group, which resembled the phenotypes of treatment of pyrvinium pamoate in MI oocyte 54 and therefore, may result in impairment of spindle structure and chromosome alignment and compromise its function during fertilization and embryo development. [score:6]
We found abnormal expression of Btrc, Csnk1a1, Gsk3b, Wnt7a, Dvl3 and Aspm in miR-320 inhibitor injected group. [score:5]
The MII oocytes microinjected with miR-320 inhibitor and its NC inhibitor were placed in 500 μL EmbryoMax® Human Tubal Fluid (HTF, Millipore, Billerica, MA, USA) medium in one well of a 4-well plate under mineral oil. [score:5]
Morphology of the 2-cell stage and blastocyst stage of miR-320 inhibitor -injected (n = 112), NC inhibitor -injected (n = 80) and non -treated (n = 180) in vitro fertilized mouse oocytes. [score:5]
Taken together, abnormal expression of Wnt signaling pathway related genes might contribute to the decreased 2-cell rate and blastocyst rate in the miR-320 inhibitor -injected oocytes. [score:5]
Expression of Wnt signaling pathway genes in miR-320 inhibitor -injected and control groups. [score:5]
The ligand, Wnt7a and the intracellular molecule Dvl3, were significantly decreased in the miR-320 inhibitor -injected, while other three genes as members of β-catenin degradation complex – Btrc, Csnk1a1 and Gsk3b were significantly increased in the miR-320 inhibitor -injected group. [score:5]
Supplementary Figure 2 shows that miR-320 expression was strongly reduced after injection of its inhibitor. [score:5]
The blastocyst stage of miR-320 inhibitor -injected oocytes (C) and NC inhibitor -injected oocytes (D). [score:5]
Another seven genes – Bmp15, Ctnnb1, Lef1, Lrp6, Apc, Numb and Tcf7 were found to have no significant difference between the miR-320 inhibitor -injected (n = 80) and NC inhibitor -injected (n = 50) groups (Figure 4B). [score:5]
Expression levels of Wnt signaling pathway components were abnormal in miR-320 inhibitor -injected oocytes. [score:5]
The proportions of MII oocytes in the miR-320 inhibitor and NC inhibitor -injected groups that developed into the 2-cell stage (E) were 16.41% ± 4.33%, 56.85% ± 5.71% and 75% ± 7.07%, respectively. [score:5]
The 2-cell stage of miR-320 inhibitor -injected oocytes (A) and NC inhibitor -injected oocytes (B). [score:5]
To further investigate the role of miR-320 in embryonic development, we knocked down its expression in mouse MII oocytes by injecting its inhibitor oligonucleotide. [score:5]
The proportions of MII oocytes in the miR-320 inhibitor and NC inhibitor -injected groups that developed into the blastocyst stage (F) were 11.70% ± 0.42%, 39.26% ± 5.37% and 56% ± 5.66%, respectively. [score:5]
Morphology and statistical results of the 2-cell stage and blastocyst stage of oocytes injected with either miR-320 inhibitor or negative control (NC) inhibitor and oocytes of non -treated control group. [score:5]
To investigate the mechanisms behind the impaired fertilization and development competence of miR-320 inhibitor -injected oocytes, we tested 13 genes of Wnt signaling pathway to see if there were any abnormal expression levels that might affect the oocyte (Figure 4A and 4B). [score:4]
As Figure 3 shows, mouse embryo development in the miR-320 inhibitor -injected group was significantly affected. [score:4]
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
Most of the miR-320 inhibitor -injected embryos arrested at the 2-cell stage and only a few proceeded to develop into blastocysts indicating that miR-320 is essential for embryonic development. [score:4]
Thus the association between the miR-320 expression level in follicular fluid and embryonic development was supported in ICSI patients as well as the in vitro fertilization and cultivation of mouse oocytes. [score:4]
Altogether, these imply that Wnt signaling pathway might have effects in fertilization and early embryo development and it may be altered by knocking down the level of miR-320. [score:3]
We subsequently found that the proportions of mouse MII oocytes that developed into 2-cell and blastocyst-stage embryos were strongly affected by knockdown of miR-320, and this further indicated that miR-320 plays an important role in embryo development potential. [score:3]
The proportions of MII oocytes in the miR-320 inhibitor -injected group that developed into 2-cell stage and blastocyst-stage embryos were 16.41% ± 4.33% and 11.70% ± 0.42%, respectively (n = 112). [score:3]
A total of 5–10 pL of the miR-320 inhibitor (50 μmol·L−1) was injected into the cytoplasm of MII oocytes. [score:3]
MiRNA profiles of each group were determined, and miR-320 and miR-197 were found to have significantly different expression levels between the two groups. [score:3]
Knockdown of mmu-miR-320 in mouse MII oocytes affects embryonic development. [score:3]
In the negative control (NC) group, oocytes were injected with universal oligonucleotides provided by the manufacturer which is not homologous with any known mammal genes in the same dosage with miR-320 inhibitor. [score:3]
Microinjection of the miR-320 inhibitor was performed in M2 medium using a Leica Hoffman microscope (LSM6000) equipped with the TransferMan NK2 micromanipulator and InjectMan NI2 (Eppendorf, Hamburg, Germany). [score:3]
It is conceivable that the significant higher level of Gsk3b may have the opposite effect to reduce the embryo cell number after we injected the oocytes with miR-320 inhibitor, or further more might influence the Day 3 embryo cell number of our ICSI patients whose follilular fluids contained relatively low level of miR-320. [score:3]
Diez-fraile et al. demonstrate that miR-320 were among the top 10 highest expressed miRNAs in follicular fluid 19, while Santonocito et al. did not identify miRNA-320 in follicular fluid 20. [score:3]
It has been shown that miRNAs play key roles in a number of signaling pathways 14, and there is evidence to suggest that miR-320 participates in regulating multiple signaling pathways, including Wnt signaling and insulin–PI3K signaling 25 44. [score:2]
In addition, Hsieh et al. have indicated that Wnt signaling pathway could be regulated by miR-320 25. [score:2]
Hsieh et al. have indicated that Wnt signal pathway could be regulated by miR-320 25. [score:2]
In conclusion, we have found that miR-320 and miR-197 in human follicular fluid are associated with embryonic development potential. [score:2]
By miRNA profiling and qRT-PCR, we identified miR-320 and miR-197 in the follicular fluid as potential candidates for being associated with embryo development potential. [score:2]
Because there is no miR-197 or homologous miRNA in the mouse miRNA database, our in vitro experiments focused solely on studying the function of miR-320. [score:1]
As indicated in Figure 2, among the 15 candidate miRNAs, only miR-320 (p = 0.0073, Figure 2A) and miR-197 (p = 0.0080, Figure 2B) were found to be significantly different between the two groups. [score:1]
Scatter plots depicting significantly different levels of miR-320 (A) and miR-197 (B) between the two groups. [score:1]
[1 to 20 of 45 sentences]
9
[+] score: 182
54, 55 As shown in Figure 4o, knockdown of Nucleolin decreased the expression of NLC1-C. Since NLC1-C was a direct target of miR-320a and miR-383 and Nucleolin promoted NLC1-C expression, we investigated whether miR-320a and miR-383 mediated the increase induced by Nucleolin on NLC1-C expression. [score:9]
We used lentivirus -mediated RNA interference (RNAi) to knockdown NLC1-C. As shown in Figure 4a and b, silencing NLC1-C increased primary and mature miR-320a and miR-383 expression, whereas overexpression of NLC1-C decreased their expression. [score:8]
Combined with the observation that the expression of primary and mature miR-320a and miR-383 was down-regulated in MA patients and the hyperactive proliferation of germ cells in patients with mixed patterns of MA, [8] NLC1-C could contribute to spermatogenic arrest caused by the dysregulation of germ cell proliferation by accumulating in the nucleus of spermatogonia and primary spermatocytes, repressing miR-320a and miR-383 transcripts, resulting in hyperactive proliferation of germ cells. [score:7]
The expression of miR-383 targets IRF1 and Cyclin D1 8, 56 (Figure 5j) and miR-320a targets ARPP-19 and ERR γ [57] (Figure 5k) was promoted by pZW1-sno-NLC1-C. These observations and our previous results 8, 56 confirmed that the accumulation of NLC1-C in the nucleus of spermatogonia and primary spermatocytes represses miR-320a and miR-383 transcripts resulting in hyperactive proliferation of germ cells leading to male infertility. [score:7]
[8] In this study, we found that the expression of primary and mature miR-320a was also down-regulated in patients with mixed patterns of MA (Figure 5b and c). [score:6]
Real-time PCR analysis and northern blotting (NB) assay showed that the expression of NLC1-C was significantly inhibited by miR-320a/miR-383 mimics and was promoted by miR-320a/miR-383 inhibitors (Figure 3f and h). [score:6]
Overexpression of NLC1-C (the fourth column from the left in each Figure 4h and i) could partly repress miR-320a/383 expression in cells with si-Nucleolin (the second column from the left in each Figure 4h and i). [score:5]
while, as shown in Supplementary Figure S5a and b, the expression of Nucleolin mRNA and protein level was not affected by miR-320a/miR-383 mimics and inhibitors. [score:5]
We subsequently analysed the expression of NLC1-C in NT2 cells co -transfected with Nucleolin siRNA and miR-320a or miR-383 inhibitors. [score:5]
To confirm that NLC1-C was the direct target of miR-320a and miR-383, 293 T cells were co -transfected with 200 ng pMIR-REPORT/Mutation plasmids, 20 ng of the transfection control Renilla vector and 80 pmol miR-320a/383 mimics/negative control for 30 h. In the promoter activity assay, 293 T cells were co -transfected with 20 pmol Nucleolin siRNA/NLC1-C siRNA and 400 ng pGL3-miR-320a/miR-383 promoter or 400 ng pGL3-miR-320a/miR-383 promoter mutation plasmids in 24-well plates with three replicate wells for each condition. [score:5]
Moreover, overexpression of miR-320a weakened the interaction of Ago2 with NLC1-C in NT2 cells and inhibition of miR-320a increased the interaction of Ago2 with NLC1-C (Figure3i). [score:5]
As shown in Figure 4p, the inhibitors of miR-320a or miR-383 were sufficient to rescue the decrease induced by Nucleolin depletion on NLC1-C expression. [score:5]
In addition, NLC1-C inhibited miR-320a and miR-383 transcripts in vitro and the expression of NLC1-C was accumulated in the nucleus of spermatogonia and primary spermatocytes in the testes of infertile men with mixed patterns of MA. [score:5]
To confirm that NLC1-C was the direct target of miR-320a and miR-383, 293 T cells were co -transfected with 200 ng pMIR-REPORT/Mutation plasmids, 20 ng of the transfection control Renilla vector and 80 pmol miR-320a/383 mimics/negative control for 30 h. In the promoter activity assay, 293 T cells were co -transfected with 20 pmol Nucleolin siRNA/NLC1-C siRNA and 400 ng pGL3-miR-320a/miR-383 promoter or 400 ng pGL3-miR-320a/miR-383 promoter mutation plasmids in 24-well plates with three replicate wells for each condition. [score:5]
After 48 h of Nucleolin knockdown (Figure 4c), the expression of primary and mature miR-320a/miR-383 was increased (Figure 4d–f), similar to NLC1-C knockdown. [score:5]
NLC1-C represses the expression of miR-320a and miR-383 directly binds Nucleolin in the nucleus. [score:4]
Since, we wanted to determine whether NLC1-C can regulate the expression of miR-320a and miR-383. [score:4]
NLC1-C is a direct target of miR-320a and miR-383. [score:4]
Next, we examined whether Nucleolin and NLC1-C co-regulate miR-320a and miR-383 expression. [score:4]
When NLC1-C and precursor miR-320a/383 were exported to the cytoplasm, precursor miR-320a/383 were processed into mature forms targeting NLC1-C to regulate cell survival (Figure 7a). [score:4]
However, when NLC1-C was down-regulated in the cytoplasm, it accumulated in the nucleus of spermatogonia and primary spermatocytes, repressing miR-320a and miR-383 transcripts and leading to hyperactive proliferation of spermatogonia and primary spermatocytes by binding to Nucleolin, ultimately resulting in male infertility (Figure 7b). [score:4]
These results demonstrate that Nucleolin binding to NLC1-C co-regulates miR-320a and miR-383 transcription mediating the increase of NLC1-C expression induced by Nucleolin. [score:4]
As Figure 4g shown, Knockdown of NLC1-C (marked with sh-NLC1-C-1 and sh-NLC1-C-2) or Nucleolin (si-Nucleolin), respectively, increased the expression of miR-320a and miR-383. [score:4]
These findings demonstrate that Nucleolin and NLC1-C repress the expression of miR-320a/miR-383 at the level of transcription and not through post-transcriptional regulation. [score:4]
In addition, we observed that the expression of primary and mature miR-320a/383 was inhibited more significantly when NT2 cells were transfected with pZW1-sno-NLC1-C compared with pcDNA3.1-NLC1-C (Figure 5f–i). [score:4]
To validate whether the NLC1-C gene is a direct target of miR-320a and miR-383, we constructed luciferase reporter constructs containing either the wild-type (WT) full-length NLC1-C RNA or the mutant forms of the seed sites into the pMIR-Report vector (Figure 3j). [score:4]
42, 53 We then sought to determine whether Nucleolin post-transcriptionally regulates the expression of miR-320a and miR-383. [score:4]
Overexpression of Nucleolin and NLC1-C decreased the activity of the miR-320/SGCZ (miR-383) promoter region (−1050/+50 bp), which contains a putative NLC1-C binding site located at −225  to −153 bp (miR-320 promoter) or −793  to −740 bp (SGCZ (miR-383) promoter), by about 50 and 50%, respectively (Figure 4k and l). [score:3]
In summary, we demonstrate that NLC1-C binding to Nucleolin functions as a positive regulator of cell proliferation by directly repressing miR-320a and miR-383 transcripts. [score:3]
To verify that these potential NLC1-C/Nucleolin -binding sites were important for the transcriptional activity of miR-320 and miR-383, expression vectors encoding Nucleolin and/or NLC1-C were transiently co -transfected with miR-320 or SGCZ (miR-383) promoter reporter plasmids into 293 T cells. [score:3]
NT2 cell proliferation was inhibited the most significantly when transfected in combination with the miR-320a mimic, miR-383 mimic, and NLC1-C shRNA (Figure 6d). [score:3]
To validate whether the accumulation of NLC1-C in the nucleus represses both miR-320a and miR-383 transcripts resulting in hyperactive proliferation of germ cells associated with male infertility, we transfected NT2 cells with pcDNA3.1-NLC1-C or pZW1-sno-NLC1-C plasmid, which stably expresses a nuclear NLC1-C. Forty-eight hours after transfection, RNA ISH followed by immunofluorescence or real-time PCR was performed. [score:3]
[58] In this study, we found that in the normal male testes, NLC1-C inhibited miR-320a and miR-383 transcripts by binding to Nucleolin in the nucleus. [score:3]
As described in this study, NLC1-C binding to Nucleolin co-regulates miR-320a and miR-383 transcription. [score:2]
WT miR320 promoter and miR-383 promoter were obtained by amplifying two −1000 /+50 bp fragments of miR320 promoter and miR-383 promoter harbouring the NLC1-C -binding sites, whereas mutated miR320 promoter and miR-383 promoter were generated by PCR -based site-directed mutagenesis. [score:2]
WT NLC1-C-pMIR-Report was obtained by amplifying a 730-bp fragment of NLC1-C harbouring the miR-320a and miR-383 -binding sites, whereas mutated NLC1-C-pMIR-Report was generated by PCR -based site-directed mutagenesis. [score:2]
Dysregulation of NLC1-C/Nucleolin-miR-320a/miR-383-NLC1-C pathways is associated with spermatogeneic arrest. [score:2]
Co-transfection of the miR-320a or miR-383 mimic and the reporters into 293 T cells resulted in an ~50% decrease in luciferase activity (Figure 3k), whereas mutation of the seed sequences abolished the silencing effects of miR-320a or miR-383 (the right panel of Figure 3k). [score:2]
In addition, the NLC1-C/Nucleolin-miR-320a/miR-383-NLC1-C pathways are identified in the regulation of NT2 cell survival. [score:2]
These results indicate that the miR-320 and SGCZ promoter region might contain a critical Nucleolin-responsive regulatory element. [score:2]
Conversely, Mutation of putative NLC1-C binding site in the miR-320/SGCZ (miR-383) promoter region recued the luciferase activity repression induced by Nucleolin and NLC1-C (Figure 4k and l). [score:2]
Analysis of bioinformatics data revealed one seed site for miR-320a and miR-383, separately, in the NLC1-C RNA sequence (Figure 3e). [score:1]
For NLC1-C, β-actin, miR-320, miR-383 NB, total RNAs collected from transfected cells were resolved on 1.5% denatured agarose gels ands were carried out according to the manufacturer's protocol (DIG Northern Starter Kit, Roche). [score:1]
Antibodies to normal IgG failed to immunoprecipitate miR-320 and SGCZ promoter (Figure 4m and n). [score:1]
miR-320a and miR-383 mediate the proliferation and apoptosis of NT2 cells induced by NLC1-C depletion. [score:1]
Digoxigenin (DIG) -labelled antisense of NLC1-C and β-actin probes were made using either SP6 or T7 RNA polymerases by in vitro transcription with the DIG Northern Starter Kit (Roche) and 5'-end DIG -labelled LNA modified DNA oligonucleotides (LNAs) complementary to the mature miR-320 and miR-383 were supplied by Exiqon A/S (Vedbaek, Denmark). [score:1]
Analysis of bioinformatics data revealed that there is one binding site of NLC1-C on the miR-320 and SGCZ (miR-383) promoter (Figure 4j). [score:1]
WT and mutated miR320 promoter and miR-383 promoter sequences were inserted into the KpnI and XhoI sites of the pGL3-basic vector. [score:1]
For cell apoptosis analysis, NT2 cells were seeded in six-well plates at 70–80% confluency and transfected with either 80 nM indicated siRNAs or 100 nM miR-320a/383 mimic. [score:1]
Similarly, miR-320a and miR-383 enhanced apoptosis of NT2 cells induced by NLC1-C depletion (Figure 6e). [score:1]
The probes sequences of miR-320 and miR-383 are listed in Supplementary Table S3. [score:1]
The accumulation of NLC1-C in the nucleus represses both miR-320a and miR-383 transcription by binding to Nucleolin is associated with male infertility. [score:1]
We next examined the effects of miR-320a/miR-383 on NT2 cell proliferation and apoptosis induced by NLC1-C. Our results revealed that co-transfection of any two of miR-320a mimic, miR-383 mimic and NLC1-C shRNA into NT2 cells resulted in more significant decrease in cell proliferation than transfection with any one of them (Figure 6d). [score:1]
[1 to 20 of 53 sentences]
10
[+] score: 150
To evaluate whether CD71 was a direct target of miR-320, we generated CMV -based expression constructs containing the miR-451 and miR-320 genomic sequences and then tested for their ability to specifically suppress expression from their respective “indicator” reporter constructs containing two copies of identical miR-451 or miR-320 target sequences in a specific manner (Fig 5F). [score:10]
While reticulocytes transfected with the scrambled sequence LNA oligonucleotide underwent normal CD71 downregulation, miR-320 inhibition by the antisense oligonucelotide led to a persistent high expression of CD71 (Fig 5C, D) in three separate experiments. [score:8]
Since miR-320 expression does not change during the transition between reticulocyte and erythrocytes, its upregulation is not likely to be a trigger for the loss of CD71 expression. [score:8]
Taken together, these results showed that miR-320 can directly regulate the expression of CD71 and suggested that the poor expression of miR-320 in HbSS cells is associated with their persistently high CD71 level during terminal differentiation. [score:7]
Poor expression of miR-320 in HbSS cells was associated with defective CD71 downregulation during terminal differentiation. [score:6]
We found that miR-320 played an important role for the down-regulation of its target gene, CD71 during reticulocyte terminal differentiation. [score:6]
Instead, miR-320 is likely to fine tune the translational activities of CD71 in reticulocytes and contribute to its loss of CD71 surface expression together with the exosome release. [score:5]
In addition to CD71, miR-320 was also predicted by TargetScanS [24] and PicTar to target other mRNAs (Table S1, S2 [1]), including ETS2 (v-ets erythroblastosis virus E26 oncogene homolog 2) and EPB41L5 (erythrocyte membrane protein band 4.1 like 5), two mRNA encoding proteins important for erythrocyte biology (A) HbSS reticulocytes exhibited defective terminal differentiation. [score:5]
This suppression was abolished when three nucleotides in the miR-320 predicted target site were mutated as indicated in the 3′UTR of CD71. [score:5]
CD71 downregulation during terminal differentiation is defective in HbSS reticulocytes and is a potential mRNA candidate for miR-320 regulation. [score:5]
To further validate the miR-320/CD71 interaction, we overexpressed miR-320 in K562 cells and examine their influence on surface CD71 expression. [score:5]
In addition to CD71, miR-320 was also predicted by TargetScanS [24] and PicTar to target other mRNAs (Table S1, S2 [1]), including ETS2 (v-ets erythroblastosis virus E26 oncogene homolog 2) and EPB41L5 (erythrocyte membrane protein band 4.1 like 5), two mRNA encoding proteins important for erythrocyte biology To test for the possibility that mature erythrocytes contain previously undetected RNAs, we developed a protocol to obtain a pure population of mature erythrocytes by removing other blood cells through a series of purification procedures (Fig 1A). [score:5]
MiR-320 was predicted to regulate CD71 by all three predictive algorithms (TargetScans [24], PicTar [25] and miRanda [26]) with a perfect match between its “seed” sequence (5′- GUCGAAAA-3′, nucleotides 2–8) and the regulatory region in the CD71 3′ UTR (CAGCTTTT, 2693 to 2700 of CD71 mRNA) that is conserved in five species (Fig 4B). [score:5]
Table S1 The mRNA targets for miR-320 predicted by TargetScanS. [score:5]
This suggested that low miR-320 expression may have a role in the dysregulated maturation and decreased cell survival seen in SCD [1]. [score:4]
Further investigation revealed that poor expression of miR-320 in HbSS cells was associated with their defective downregulation CD71 during terminal differentiation. [score:4]
Collectively, these results indicated that CD71 was a direct target of miR-320 via the interaction between its 3′UTR and the miR-320 seed sequence. [score:4]
The CD71 3′UTR miR-320 mutant reporters were constructed with QuikChange® II Site-Directed Mutagenesis Kits (Stratagene, CA), which created three base pair changes in the miR-320 seed sequence -targeted regions (underlined) (CTAGATGTCTTTAGGCAG GA TC CTTTAA to replace CTAGATGTCTTTAGGCA GCAGCTTTTAA). [score:4]
When synthesized mature miR-320 was transfected into reticulocytes, we detected a three-fold increase in miR-320 expression with real-time RT-PCR (Fig 5B). [score:3]
Furthermore, the miR-320 expression level, which was very high in HbAA erythrocytes, was dramatically reduced in HbSS erythrocytes (Fig 4C, D), consistent with a possible role in the defective repression of CD71 seen in HbSS cells. [score:3]
This miR-320 -mediated repression was dependent on the predicted miR-320 target site in the CD71 3′UTR since a three base pair change in this site abolished miR-320 -mediated repression (Fig 5G, right). [score:3]
These differences are likely to provide additional information about the disease phenotypes, similar to the miR-320::CD71 connection established in our current study. [score:3]
To assess the effect of miR-320 on CD71 3′UTR activity, expression constructs encoding miR-320 and miR-451 were inserted into a CMV -based pcDNA3 cloning vector (Invitrogen, CA). [score:3]
The reporter activities when empty vector or miR-451 and miR-320 expression constructs were co -transfected into K562 cells with respective indicator plasmids containing duplicated copies of sequences identical to miR-451 and mIR-320. [score:3]
When this reporter construct was co -transfected into K562 cells with expression constructs encoding miR-320, miR-451 or empty vectors, we found that only miR-320, but not miR-451 or empty vectors, repressed its activity (Fig 5G, left). [score:3]
The phenotype of miR-320 inhibited normal cells resembled that of HbSS cells, including defective maturation and decreased survival. [score:3]
The miR-320 expression level did not change significantly between reticulocyte and erythrocyte samples in our real-time RT-PCR analysis of HbAA cells (Fig 4E). [score:3]
Table S2 The mRNA targets for miR-320 predicted by PicTar (0.62 MB XLS) Click here for additional data file. [score:3]
Finally, microRNAs may have additional functional roles in erythrocytes via a mechanism independent of mRNA targeting as suggested in our observation that the blockage of mIR-320 leads to decreased erythrocyte survival. [score:2]
miR-320 dysregulation and CD71 phenotypes in HbSS individuals. [score:2]
The following primers were used to amplified the expression constructs from the genomic DNA of K562 cells and cloned into the XhoI and EcoRI site of pcDNA3: miR-320 (forward: ccgaattccaggaaccagacagggacgc; reverse: ccctcgagccgactcttaagtccaggtc) and miR-451 (forward: ccgaattcacagtgcttttcaagccatgc; reverse: ccctcgagatcctcctgccttggcctctg). [score:2]
To directly test the functional role of miR-320 during terminal differentiation, we developed a transfection technique that allowed us to elevate and reduce the levels of selected microRNAs in reticulocytes. [score:2]
Overexpression of miR-320 in K562 cells led to a significantly lower level of CD71 when compared with control transfection with empty vectors (Fig 5H). [score:2]
In addition, miR-320 inhibition in reticulocytes caused significant cell death and led to fewer cell numbers when compared with cells transfected with the scrambled oligonucleotide or with miR-20a antisense oligonucleotides (Fig 5E, left). [score:2]
In vitro maturation assays of reticulocytes and miR-320 knockdown. [score:1]
0002360.g005 Figure 5(A) The histogram of the fluorescent intensity of reticulocytes transfected with unlabeled (black line) or fluorescently-labeled miR-320 (green line). [score:1]
These results indicated an essential role for miR-320 in maintaining erythrocyte homeostasis during terminal differentiation in normal reticulocytes. [score:1]
To investigate the function of miR-320 during reticulocyte terminal differentiation, we inhibited miR-320 function by transfecting either LNA antisense oligonucleotides against miR-320 or a scrambled sequence LNA oligonucleotide into HbAA reticulocytes before culturing them for in vitro terminal differentiation. [score:1]
On the other hand, the transfection of LNA antisense oligonucleotides against miR-320 led to 80% reduction in miR-320 levels (Fig 5B). [score:1]
Several microRNAs (miR-320, let-7s, miR-181, miR-141) were over-represented in the HbAA erythrocytes, while other microRNAs (miR-29a, miR-144, miR-451, miR-140) were over-represented in the HbSS erythrocytes (Fig. 3C). [score:1]
Locked Nucleic Acid (LNA) oligonucleotides against miR-320, mir-20a and scrambled control sequence (Exiqon, Denmark) were individually diluted in Opti-MEM and mixed with diluted Lipofectamine 2000 (Invitrogen) for 30 min at room temperature before transfecting into reticulocytes at a final concentration of 33 nM. [score:1]
[1 to 20 of 41 sentences]
11
[+] score: 150
Thus, miR-320a can suppress vimentin protein levels both directly through targeting its 3′UTR and indirectly through the downregulation of USP14. [score:10]
The restoration of miR-320a expression can suppress GC cell proliferation, migration and invasion by targeting both USP14 and vimentin, which shows that miR-320a acts as a tumor suppressor in GC. [score:9]
These data indicate that miR-320a targets and downregulates the expression of USP14 and vimentin. [score:8]
In short, these results suggest that the tumor suppressor role of miR-320a in GC cells is mediated or at least partially mediated by the downregulation of USP14 and vimentin expression. [score:8]
We found that both USP14 and vimentin were direct targets of miR-320a, which regulate dual target functions. [score:7]
Thus, miR-320a not only suppresses vimentin directly but also binds to USP14 to inhibit vimentin indirectly in GC (Figure 5N). [score:7]
Together, these results indicate that miR-320a downregulates USP14 and vimentin and functions as a tumor suppressor in GC cells. [score:6]
Surprisingly, bioinformatics showed that miR-320a could target vimentin as well as directly bind USP14, which might contribute to the tumor suppressor role of miR-320a in GC (Figure 4A). [score:6]
Reporter assays demonstrated that miR-320a overexpression decreased the fluorescence intensities of the wild-type reporters in BGC-823 cells, while ASO-miR-320a expression increased the fluorescence intensities of the wild-type reporters in BGC-823 cells; miR-320a overexpression did not influence the fluorescence intensities of the mutant reporters (Figure 4B and 4C). [score:6]
Both USP14 and vimentin are the direct targets of miR-320a, which suppresses GC cell proliferation, migration and invasion. [score:6]
To confirm that the tumor suppressor role of miR-320a in GC is mediated by the repression of the expression of vimentin and USP14, rescue experiments were performed. [score:5]
Furthermore, the suppression of migration and invasion induced by miR-320a was abrogated under USP14 and vimentin overexpression (Figure 5J–5M). [score:5]
In addition, we also examined the expression levels of miR-320a in clinical GC specimens and GC cells by RT-qPCR (Figure 5C and Figure S2F) and analyzed the correlation between vimentin/USP14 and miR-320a expression. [score:5]
We found that miR-320a functions as a tumor suppressor in GC cells by suppressing cell proliferation, migration and invasion (Figure 4F–4I). [score:5]
As shown in Figure 5D and 5E, miR-320a expression was inversely correlated with the expressions of vimentin and USP14 in GC tissues. [score:5]
The above data demonstrate that both USP14 and vimentin promoted malignancy and were downregulated by miR-320a in GC cells. [score:4]
In summary, our results demonstrated that vimentin in human GC tissues and cell lines was upregulated due to its de-ubiquitination after interactions with USP14 and miR-320a, which could promote the aggressiveness of GC cells. [score:4]
Notably, the abrogating effects of USP14 on invasion and migration were less than those of vimentin, which may be due to the direct inhibition of vimentin by miR-320a. [score:4]
miR-320a functions as a tumor suppressor in GC cells via USP14 and vimentin. [score:3]
In our study, we found that USP14 and vimentin are target genes of miR-320a. [score:3]
Consistent with these findings, RT-qPCR and western blotting showed that miR-320a reduced the mRNA and protein expression of USP14 and vimentin (Figure 4D–4E and Figure S2C, S2D). [score:3]
In comparing the functions of these miRNAs, miR-320a was chosen for further analysis because it has been identified to be decreased in GC and its expression in serum has been related to GC [27, 28]. [score:3]
Overexpression of USP14 and vimentin rescues the effect of miR-320a on cell viability (F and G), colony formation (H and I), migration (J and K) and invasion (L and M) in BGC-823 and MGC-803 cells, respectively. [score:3]
USP14 and vimentin are suppressed by miR-320a. [score:3]
The promoting effects of USP14 and vimentin on MTT and the rate of colony formation were rescued when a miR-320a expression vector was co -transfected (Figure 5F–5I). [score:3]
We also determined that USP14 and vimentin were both targets of miR-320a. [score:3]
Furthermore, miR-320a inhibits the metastasis of salivary adenoid cystic carcinoma [56]. [score:3]
Because the 3′ UTR of both USP14 and vimentin contain binding sites for miR-320a, we investigated whether USP14 and vimentin are direct targets of miR-320a in GC cells. [score:2]
We generated EGFP reporters containing the USP14 3′UTR or the vimentin 3′UTR, with either the wild-type sequence or mutations in the miR-320a binding sequence (Figure 4A). [score:2]
The 3′-UTR fragments of the USP14 and vimentin genes containing the putative miR-320a binding sites and the respective mutated binding sites were inserted into pcDNA3-EGFP vectors between the BamHI and EcoRI sites by oligo annealing and ligation. [score:1]
For example, miR-320a has been found to be involved in pathogenesis in colorectal cancer [51], breast cancer [52], esophageal cancer [53], hepatoma [54] and chronic myeloid leukemia [55]. [score:1]
Next, to examine the influence of miR-320a on malignancy in GC cells, we constructed a miR-320a plasmid, synthesized ASO-miR-320a (2′-O-methyl -modified antisense oligonucleotide of miR-320a) and verified the effectiveness of pi-miR-320a and ASO-miR-320a (Figure S2A and S2B). [score:1]
Quantitative RT-PCR (qRT-PCR) was performed to detect the relative transcript levels of miR-320a, USP14 and vimentin. [score:1]
Figure 4(A) The vimentin and USP14 3′UTR and mutant 3′UTR containing a miR-320a -binding sites are shown. [score:1]
Antisense oligos against miR-320a (ASO-miR-320a) and siRNA for USP14 were chemically modified and synthesized at GenePharma, Inc. [score:1]
BGC-823 cells or MGC-803 cells were co -transfected with pcDNA3, pri-miR-320a, ASO-NC and ASO-miR-320a in a 48-well plate followed by pcDNA3/EGFP-USP14/vimentin-3′UTR or pcDNA3/EGFP-USP14/vimentin mut-3′UTR. [score:1]
The fragment (82 bp) containing the miR-320a precursor sequence was amplified from gastric cancer cell genomic DNA and cloned into the pcDNA3 vector between the BamHI and EcoRI sites. [score:1]
BGC-823 and MGC-803 cells were transfected with pri-miR-320a, ASO-miR-320a, HA-USP14, flag-vimentin or the corresponding controls. [score:1]
[1 to 20 of 38 sentences]
12
[+] score: 145
Other miRNAs from this paper: hsa-mir-21, hsa-mir-34a, hsa-mir-150, hsa-mir-155
Using univariate survival analysis, the clinical TNM stage (P=0.010), menopause (P=0.020), miR-320a expression level (P=0.015) and distant metastasis (P=0.001) were found to be significantly associated with prognosis, however, no significant differences were identified between prognosis and age (P=0.587), lymph node metastasis (P=0.076), chemotherapy (P=0.900), tumor size (P=0.230), histological grade (P=0.977), ER expression (P=0.802), PR expression (P=0.445) or HER-2 expression (P=0.650) (Table III). [score:9]
Sun et al (10) reported that miR-320a suppressed human colon cancer cell proliferation by directly targeting β-catenin. [score:6]
These results suggest that downregulated miR-320a expression may be involved in cancer progression. [score:6]
Among the 130 invasive breast cancers patients, 57/60 (95%) patients with high miR-320a expression survived, whereas 46/70 (66%) patients with low miR-320a expression survived. [score:5]
The overall survival rate of the 130 invasive breast cancer patients was 79% (Fig. 2A), and the overall survival rate of invasive breast cancer patients with low miR-320a expression levels was significantly shorter than that in patients with high miR-320a expression (P<0.001; Fig. 2B). [score:5]
However, no significant differences were identified between the expression levels of miR-320a and age (P=0.164), histological grade (P=0.745), menopause (P=0.697), human epidermal growth factor-2 (HER-2) expression (P=0.290), estrogen receptor (ER) status (P=0.684) or progesterone receptor (PR) status (P=0.352). [score:5]
miR-320a also inhibits tumor invasion by targeting neuropilin-1 and is associated with liver metastasis in colorectal cancer (11). [score:5]
However, Xu et al (12) reported that miR-320a was upregulated two- to 14-fold in prostate cancer cells, and may exhibit an oncogenic function in prostate cancer. [score:4]
It was found that miR-320a was downregulated in patients with a larger tumor size (P=0.046), more advanced clinical staging (P<0.001) and increased lymph node metastases (P<0.001), as well as the presence of distant metastasis (P=0.006). [score:4]
The results demonstrated that miR-320a was downregulated in invasive breast cancer. [score:4]
Multivariate analyses were then used to determine whether miR-320a expression levels were an independent prognostic predictor of clinical outcomes. [score:3]
Furthermore, low miR-320a expression was found to be associated with invasive breast cancer progression and predicts poor patient prognosis. [score:3]
The survival state of patients was used as the classification variable, whereas ER, PR, HER-2 (negative/positive) and the expression scores of miR-320a were used as the test variables. [score:3]
In the present study, following the analysis of miR-320a expression in 130 invasive breast cancers, the correlation between miR-320a and patient prognosis was determined. [score:3]
miR-320a expression in invasive breast cancer and in situ breast carcinoma. [score:3]
ROC curves were used to compare the sensitivity and specificity of miR-320a expression with commonly used clinicopathological prognostic biomarkers (ER, PR and HER-2). [score:3]
Previous studies have revealed that miR-320a exhibits abnormal expression levels in multiple malignancies and is involved in the formation, progression and metastasis of cancer. [score:3]
High miR-320a expression (SI≥4) was detected in 12/15 (80%) in situ breast carcinoma and 60/130 (46%) invasive breast cancer samples. [score:3]
The χ [2] test and Fisher’s exact test were used to analyze the association between miR-320a expression and clinicopathological features. [score:3]
The results revealed that low miR-320a expression was associated with a poor prognosis in patients with clinical TNM stage III–IV and lymph node metastasis. [score:3]
This result was confirmed using univariate and multivariate survival analyses, whereby low miR-320a expression was found to be an independent prognostic predictor of poor survival. [score:3]
In the present study, the miR-320a expression levels in 15 in situ breast carcinoma and 130 invasive breast cancer samples were examined using chromogenic in situ hybridization. [score:3]
However, no significant differences between high and low miR-320a expression groups were identified between invasive breast cancer patients with clinical stage I–II (P=0.061; Fig. 3C) and those without lymph node metastasis (P=0.231; Fig. 3A). [score:3]
In addition to these results, the prognostic value of miR-320a expression in invasive breast cancer subgroups classified by lymph node metastasis status and clinical TNM stage were also analyzed. [score:3]
The results revealed that a decrease in miR-320a expression [hazard ratio (HR)=0.221; 95% confidence interval (CI), 0.050–0.979; P=0.047] and clinical TNM stage (HR, 4.434; 95% CI, 2.308–8.522; P<0.001) (Table III) showed significant prognostic effects on overall survival. [score:3]
miR-320a expression was observed in the nuclei and cytoplasm, predominately in luminal epithelial cells (Fig. 1). [score:3]
The slides were scored independently by two pathologists, and positive nuclear and cytoplasmic miR-320a expression was detected. [score:3]
Low miR-320a expression was found to significantly correlate with poor survival in patients with clinical stage III–IV (P=0.048; Fig. 3D) and lymph node metastasis (P=0.005; Fig. 3B). [score:3]
CISH was used to detect miR-320a expression in 15 in situ breast carcinoma and 13 invasive breast cancer tissues. [score:3]
Thus, these results indicated that miR-320a expression levels were significantly associated with invasive breast cancer patient prognosis. [score:3]
Low expression levels of miR-320a correlate with poor prognosis in 130 invasive breast cancer patients. [score:3]
In conclusion, the results of this study indicated that miR-320a expression is significantly associated with the progression and prognosis of invasive breast cancer. [score:3]
Using the aforementioned method, the expression of miR-320a was scored as 0, 1, 2, 3, 4, 6 or 9. An SI score of 4 was selected as a cut-off value based on a measurement of heterogeneity with the log-rank test statistic with respect to overall survival (16, 17), and the expression levels of miR-320a were defined as high (SI≥4) or low (SI<4). [score:3]
In addition, levels of miR-320a expression in invasive breast cancer with lymph node metastasis were found to be significantly lower than levels for breast cancer without lymph node metastasis and in situ breast carcinoma (P<0.01; Fig. 1E). [score:3]
miR-320a expression levels were found to be lower in invasive breast cancer when compared with in situ breast carcinoma, which suggested that miR-320a may be associated with the progression of breast cancer. [score:2]
The results showed that miR-320a had a potential function in predicting poor outcomes for invasive breast cancer patients. [score:1]
This result clearly suggests that miR-320a is a more reliable predictor for invasive breast cancer prognosis than commonly used biomarkers. [score:1]
These results indicate that miR-320a may present an improved prognostic biomarker for advanced-stage invasive breast cancer patients. [score:1]
These observations indicated that miR-320a may be involved in the later stages of cancer progression rather than primary tumor formation. [score:1]
The slides were then prehybridized in a prehybridization solution at 54°C for 2 h. Following prehybridization, 5′digoxin-conjugated locked nucleic acid probes for miR-320a, U6 (positive control) and scrambled RNA (negative control) (all Exiqon, Copenhagen, Denmark) were used for hybridization at 54°C for 16–20 h. Following washing with Tris-buffered saline, the slides were incubated with a sheep polyclonal anti-digoxin antibody (Roche Diagnostics GmbH, Mannheim, Germany). [score:1]
Recently, Xu et al (13) revealed that miR-320a was a potentially valuable biomarker for diagnosing older females with gastric cancer. [score:1]
The ROC areas for miR-320a, ER, PR, and HER-2 were 0.710, 0.517, 0.549, and 0.574%, respectively. [score:1]
In the present study, miR-320a expression in 15 paraffin-embedded in situ breast carcinoma and 130 invasive breast cancer tissues was evaluated using CISH. [score:1]
miR-320a is an indicator for predicting the prognosis of advanced-stage invasive breast cancer patients. [score:1]
Thus, it may be hypothesized that miR-320a may have increased prognostic value for advanced-stage invasive breast cancer. [score:1]
The prognostic value of miR-320a expression in selective patient subgroups classified by clinical TNM stage and lymph node status was evaluated. [score:1]
The prognostic value of miR-320a expression levels was evaluated in 130 invasive breast cancer patients using Kaplan-Meier analysis and the log-rank test. [score:1]
Correlation between miR-320a expression and clinicopathological characteristics in invasive breast cancer. [score:1]
The clinicopathological characteristics of the patients and follow-up data are shown in Table I. Chromogenic in situ hybridization (CISH) was used to detect miR-320a expression levels in 15 paraffin-embedded in situ breast carcinoma and 130 invasive breast cancer samples. [score:1]
Notably, miR-320a appears to be a better prognostic biomarker for invasive breast cancer than commonly used prognostic parameters. [score:1]
However, few studies have investigated the clinicopathological value and prognostic significance of miR-320a expression in breast cancer. [score:1]
For statistical analysis, with reference to Tang et al (16), total staining of miR-320a was analyzed based on the proportion of positively stained tumor cells identified, and the following four scores were used: 0, no positive tumor cells; 1, <10% positive tumor cells; 2, 10–50% positive tumor cells; and 3, >50% positive tumor cells. [score:1]
To further evaluate whether low miR-320a expression was associated with the progression of breast cancer, we analyzed the correlation between miR-320a expression levels and the clinicopathological characteristics of 130 invasive breast cancer patients (Table II). [score:1]
[1 to 20 of 53 sentences]
13
[+] score: 100
Importantly, the upregulated hsa_circRNA_101238 might inhibit the expression of hsa-miR-320a by acting as an miRNA sponge, and in turn, increasing the expressions of several TAD -associated mRNAs, especially MMP9. [score:10]
Therefore, hsa_circRNA_101238 may initially inhibit the expression of hsa-miR-320a, subsequently increasing the expression of the target genes, and finally participating in the pathogenesis of TAD. [score:9]
Under the circRNA-miRNA-mRNA network, we inferred that the upregulated hsa_circRNA_101238 and the downregulated hsa-miR-320a interaction resulted in an elevated expression of several TAD -associated mRNAs such as MMP9. [score:9]
For instance, the upregulated hsa_circRNA_101238 interacted with hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, which were reportedly downregulated in a miRNAs expression profiling analysis of TAD aortic specimen [4]. [score:9]
This study revealed hundreds of differentially expressed circular RNAs in human TAD, suggesting that hsa_circRNA_101238 might inhibit the expression of hsa-miR-320a and increase that of MMP9 in TAD. [score:7]
According to the initial microarray data analysis, the “Top 5” predicted miRNA targets of hsa_circRNA_101238 were hsa-miR-320b, hsa-miR-320a, hsa-miR-138-5p, hsa-miR-593-5p, and hsa-miR-320c (Figure 4A) out of which, three were downregulated in the TAD aortic specimen [4]. [score:6]
The low expression of hsa-miR-320a, hsa-miR-138-5p and hsa-miR-593-5p was validated in the TAD tissues using qRT-PCR (Figure 4C), whereas the high expression of MMP9 in the TAD tissues was detected byting (Figure 4D). [score:5]
The biomathematically predicted hsa_circRNA_101238 -targeted miRNA-mRNA network based on sequence-pairing prediction and validation for the expression of hsa-miR-320a and MMP9. [score:5]
Quantitative real-time PCR was used to validate the expression pattern of circRNAs, parental genes, and hsa-miR-320a;ting confirmed MMP9 expression with additional samples. [score:5]
Also, the expression of miR-320a that targets MMP9 mRNA, was significantly decreased in B cells in patients with multiple sclerosis and may contribute towards an increased blood-brain barrier permeability and neurological disability [35]. [score:5]
Prediction of hsa_circRNA_101238 -targeted miRNA-mRNA network and validation of the expression of hsa-miR-320a and MMP9. [score:5]
We found that hsa_circRNA_101238 and MMP9 were highly expressed in human TAD tissues as compared to NA tissues, whereas hsa-miR-320a was lowly expressed. [score:4]
The luciferase reporter was constructed to determine whether hsa_circRNA_101238 can directly target the hsa-miR-320a. [score:4]
Quantitative real-time PCR and manifested the low expression of hsa-miR-320a and high of MMP9 in human TAD tissues, respectively. [score:3]
The luciferase signal of hsa-miR-320a was suppressed by the wild-type hsa_circRNA_101238, whereas the luciferase signal of hsa-miR-320a was not affected by the mutant hsa_circRNA_101238 (Figure 4E). [score:3]
In addition, MMP9 was directly declined by miR-320 via its 3′ UTR target sequences as assessed by luciferase reporter gene assays [34]. [score:3]
Furthermore, we examined the expression levels of hsa-miR-320a, hsa-miR-138-5p, hsa-miR-593-5p and MMP9 in the TAD tissues as compared to the NA. [score:2]
C. qRT-PCR analysis shows the expression of hsa-miR-320a, hsa-miR-138-5p and hsa-miR-593-5p in the TAD tissues as compared to the normal controls. [score:2]
Only hsa_circRNA_101238 established interactions with the three altered miRNAs (hsa-miR-320a, hsa-miR-320b, and hsa-miR-320c). [score:1]
Importantly, circRNA_101238-miR-320a-MMP9 axis may be involved in the pathogenesis of TAD. [score:1]
The hsa_circRNA_101238-miRNA-mRNA network indicated the highest degree of hsa-miR-320a. [score:1]
In this figure, hsa-miR-320a exhibited the highest degree, followed by hsa-miR-138-5p, hsa-miR-593-5p, hsa-miR-320b, and hsa-miR-320c. [score:1]
[1 to 20 of 22 sentences]
14
[+] score: 82
Of these potentially differentially expressed miRNAs, three (miR-191, miR-150 and miR-30d) were not supported after TMM testing, and only miR-320a and miR-140 were differentially expressed using upper quantile normalisation as well (Table 2). [score:5]
The miR-320a expression in total RNA across the expanded sample set showed lower expression in the breast cancer blood samples (2.38-fold, p = 0.111) (Table 6, Fig 4A). [score:5]
Welch t-tests for differential expression using RPKM values, upper quantile normalised rates and TMM normalised levels all supported lower miR-320a and miR-140 expression in breast cancer patients. [score:5]
Overall, the highest 15 miR-320a expression levels were observed in healthy female samples, while the lowest observable expression levels for miR-320a were associated with samples from breast cancer patients (Fig 1). [score:5]
By applying these methods to whole peripheral blood RNA from healthy control group and breast cancer patients, miR-320a expression was down regulated using both small RNA sequencing and RT-qPCR. [score:4]
However, upon enrichment for the small RNA population and subsequent analysis of miR-320a using RT-qPCR, its dysregulation in breast cancer patients was more pronounced with an 8.89-fold decrease in miR-320a expression. [score:4]
The size selection step and miR-159 control normalisation indicated an 8.89-fold down-regulation of miR-320a in circulating blood from breast cancer patients relative to the healthy control group. [score:4]
Interrogation of the miRNA results using RPKM adjustment alone would have yielded six differentially expressed miRNAs (miR-320a, miR-140, miR-30d, miR-22, miR-191, and miR-150). [score:3]
The standard curve for the miRNA target miR-320a and Let-7b ranged from 10 [9] to 10 [4] copies. [score:3]
We have further validated the miR-320a differential expression levels between these cohort groups using RT-qPCR when the experimental pipeline outlined in this study is adhered to. [score:3]
These two miRNAs showed lower expression in the blood samples from breast cancer patients relative to the healthy control group: miR-320a had the highest fold-change of 2.30, and miR-140 one of 1.72 (Table 3). [score:3]
After small RNA sequencing normalisation methods were applied, profiling of whole peripheral blood from the healthy control group and breast cancer patients found evidence of lower miR-320a expression in the latter group, consistent with previous observations [68, 69]. [score:3]
The miR-320a effect size (Cohen’s d = 1.05) indicated a high probability (89%) of detecting a true differential expression (Table 3). [score:3]
MiR-320a was analysed further using RT-qPCR in an expanded sample set to examine the expression level of miR-320a. [score:3]
The distribution of miR-320a and miR-140 upper quantile normalised expression levels between the breast cancer and control groups from Illumina reads. [score:3]
The miR-320a total RNA had a decrease in expression of 2.3-fold (p = 0.008) between the breast cancer samples and healthy control group (Table 5, Fig 3A). [score:3]
0137389.g001 Fig 1 The distribution of miR-320a and miR-140 upper quantile normalised expression levels between the breast cancer and control groups from Illumina reads. [score:3]
MiR-320a is a known tumour-suppressor implicated in several cancers including colon. [score:2]
MiR-320a was identified as the most dysregulated miRNA between the two female cohorts. [score:2]
When total RNA was analysed with this miR-320a RT-qPCR assay, a 2.3-fold decrease in expression levels was observed between blood samples from healthy controls and breast cancer patients. [score:2]
Other recent work suggests that miR-320a expression may exhibit complex effects dependent on the genetic composition of the breast cancer subtype, but that its dysregulation is linked to poorer survival outcome [75] as supported consistently across all reported investigations, irrespective of methodology the used. [score:2]
As a proof of concept for this approach, we identified a differentially expressed miRNA (miR-320a) in circulating blood among a cohort of healthy females (n = 23) compared to a cohort of female breast cancer patients (n = 14) based on Illumina sequencing data. [score:2]
MiR-320a was the most dysregulated miRNA across all methods applied here: small RNA sequencing, RT-qPCR of total RNA and RT-qPCR of enriched RNA. [score:2]
A 5.45 fold decrease is observed (with a P value of 0.0001), in miR-320a from Healthy (4.24E +07) to Cancer (7.78E +06) state. [score:1]
MiR-320a, let-7b, miR-195 and miR-16 were analysed and quantified using RT-qPCR in samples from both the healthy controls and breast cancer patients using both total RNA and enriched small RNA. [score:1]
13.8% of miR-320a sequences were identical to this sequence with an additional A nucleotide at the 3’ end. [score:1]
MiR-140 was not evaluated using RT-qPCR because its ranked expression did not partition the groups as clearly as miR-320a. [score:1]
As such, for the purposes of this study miR-320a, let-7b, miR-16 and miR-195 were examined by RT-qPCR using both total RNA and also by developing a pre-RT-qPCR enrichment process for RNA <30 bases. [score:1]
For these sequencing data, the vast majority of miR-320a isoforms detected were mature transcripts (99.6%) of which 83.1% were a single sequence (AAAAGCTGGGTTGAGAGGGCTAT). [score:1]
The largest t-test p-value for miR-320a was 0.00187 (RPKM t = 3.35), and this was supported by the upper quantile (p = 0.00002) and TMM (p = 0.00032) normalised values. [score:1]
A further RT-qPCR analysis of miR-320a was carried out on the total and small RNA from the original samples amplified by sequencing. [score:1]
[1 to 20 of 31 sentences]
15
[+] score: 73
In conclusion, we demonstrated that miR-320a specifically targeted the 3' UTR of Hsc 70, decreased Hsc 70 expression at both the protein and mRNA levels in an α-synuclein-over-expressed SH-SY5Y cells, and resulted in significant α-synuclein intracellular accumulation. [score:7]
It was shown that miR-320a mimics transfection specifically targeted Hsc 70 and reduced its expression in both mRNA and protein levels, and the reduced Hsc 70 promoted a significantly high level of α-synuclein accumulation. [score:5]
Then we screened miRNAs which targeted Hsc 70 or LAMP2A with miRTAR, and it was shown that miR-320a targeted the 3' UTR of Hsc 70. [score:5]
2.3. miRNA-320a Targets and Reduces Hsc 70 Expression in SH-SY5Y-Syn(+) Cells. [score:5]
Thus, we have identified the promotion of miR-320a to the α-synuclein aggregation in the α-synuclein overexpressing SH-SY5Y cells, by inhibiting the Hsc 70 -mediated CMA. [score:5]
In order to confirm the deregulation of miRNA-320a on Hsc 70 expression and its influence on α-Syn degradation, we evaluated the expression of Hsc 70, LAMP2A and α-Syn accumulation in the SH-SY5Y-Syn(+) cells. [score:4]
Moreover, the miRNA-320a mimics transfection could significantly downregulate the α-Syn level in mRNA level (p < 0.05 for 20 nM and p < 0.01 for 40 nM) (Figure 3C) and in protein level (p < 0.05 for 20 nM and p < 0.01 for 40 nM) (Figure 3D,E). [score:4]
The significantly elevated miR-320a level by miR-320a mimics transfection specifically reduced the expression of Hsc 70 at both the mRNA and protein levels. [score:3]
The present study demonstrates for the first time that miR-320a targeted the 3' UTR of Hsc 70, and attenuated the role of Hsc 70 in the α-synuclein degradation. [score:3]
The present study for the first time indicates that miR-320a targeted the 3' UTR of Hsc 70, and attenuated the role of Hsc 70 in the α-synuclein degradation. [score:3]
And miR-320a was also indicated to target the 3' UTR of LAMP2A. [score:3]
However, miR-320a had no influence on the expression of endogenous LAMP-2A in normal SHSY5Y cells, and the luciferase reporter assay reconfirmed that miR-320a had no regulation on the 3' UTR of LAMP-2A [42]. [score:3]
It was indicated that neither 20, nor 40 nM miR-320a mimics transfection significantly regulated the α-synuclein expression in mRNA level (Figure 4A), compared to the miRNA control. [score:3]
However, the expression of the other important CMA molecule, LAMP2A was not influenced by the miRNA-320a mimics transfection (Figure 3D,F,G). [score:3]
2.4. miR-320a Mimics Inhibited α-Synuclein Degradation in SH-SY5Y-Syn(+) Cells. [score:3]
To confirm that the α-synuclein aggregation was only caused by CMA blockage, we further determined the autophagy -associated molecules, LC3-I/II and Atg 5. It was shown in Figure 4D,E that the conversion of LC3-I to LC3-II, and the expression of Atg 5 was not influenced by the miR-320a transfection, compared to the miRNA control (p > 0.05, respectively). [score:2]
To further explore the influence of Hsc 70 knockdown by miR-320a on the α-synuclein aggregation, we determined the influence of miR-320a mimics or miRNA control transfection on the α-synuclein aggregation. [score:2]
In the present study, we first constructed an α-synuclein -overexpressed human neuroblastoma cell line, SH-SY5Y-Syn(+) to evaluate the regulation by miR-320a on the CMA and their influence on the α-synuclein degradation. [score:2]
We found that the miRNA-320a was highly paired to three sites at the 3' UTR or Hsc 70 by miRTarBase analysis (Figure 3A). [score:1]
miR-320a mimics or miRNA control (GenePharma, Shanghai, China) with a concentration of 20 or 40 nM was transfected with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) into the SH-SY5Y cells to promote the miR-320a level. [score:1]
It has been implied that miRNA-320a is highly paired to the 3' UTR or Hsc 70 in neuronal cells [42]. [score:1]
Then we elevated the miRNA-320a level in the SH-SY5Y-Syn(+) cells by transfection of miRNA-320a mimics. [score:1]
Further, the reduced level of Hsc 70 by miR-320a mimics transfection attenuated the α-synuclein degradation in the SH-SY5Y-Syn(+) cells. [score:1]
It implies that miR-320a might be involved in α-synuclein aggravation in PD. [score:1]
It implies that the miR-320a might be involved in α-synuclein aggravation in PD. [score:1]
For the expression analysis of Hsc 70, LAMP2A, α-synuclein, LC3-I/II, Atg 5 in mRNA or protein levels, or miR-320a between two groups, statistical evaluations are presented as mean ± SE. [score:1]
[1 to 20 of 26 sentences]
16
[+] score: 67
miR-320a target genes are shown in white boxes, miR-483-5p target genes in grey boxes and the black box shows a common target gene for both miRNAs The present study is focused on the identification of miRNAs with altered expression in osteoporotic bone. [score:9]
Targets predicted and validated for miR-320a are involved in a variety of cellular processes, including cell proliferation (SRF, ARPP-19, PDGFD) and apoptosis inhibition (MCL1), signal transduction (MAPK1, SGK, DNER, JAK2), gene expression regulation (PPARGC1A, SP1, CAMTA1, ESRRG), growth factors (IGF1, BMP3 and 6), and hormone, growth factor, and cytokine receptors (LEPR, NR3C1, BMPR1A, RARG, RXRA, IGF1R, IL6R, PTGER3, TFR1). [score:8]
miR-320a target genes are shown in white boxes, miR-483-5p target genes in grey boxes and the black box shows a common target gene for both miRNAs The anthropometric features of the OP and Control groups were shown in Table  1. Using the Mann–Whitney U test, no statistical differences in these variables were observed between the two groups. [score:7]
miR-320a is known to target CTNNB1 and predicted to regulate RUNX2 and LEPR, while miR-483-5p down-regulates IGF2. [score:7]
In this context, Hamam et al. [20] observed that miR-320 family (miR-320a, 320b, 320c, 320d and 320e) were upregulated during adipogenesis suggesting the miR-320 family as possible molecular switch promoting adipocytic differentiation of hMSC by targeting RUNX2, MIB1, PAX6, YWHAH and ZWILCH. [score:6]
Genes belonging to the mentioned pathways which are targeted by these two miRNAs are shown in Fig.   6. Fig. 6 Schematic pathway involving miR320a and miR483-5p target genes. [score:5]
In the analysis of differential expression between osteoporotic and control samples, 82 miRNAs reached significance, and after qPCR validation, two miRNAs were significantly over-expressed in osteoporotic samples (miR-320a and miR-483-5p). [score:5]
When the intersection of the pathways targeted by miR-320a and miR-483-5p were explored, prostate cancer, PI3K-Akt signalling, and focal adhesion emerged as the most significant. [score:3]
Regarding the 82 miRNAs differentially expressed between control and OP samples, 46 were also detected in the osteoblast array, including miR-320a and miR-483-5p. [score:3]
Eight hsa-miRNAs underwent validation in the discovery samples by qPCR (miR-675-5p, miR-30c-1-3p, miR-483-5p, miR-542-5p, miR-142-3p, miR-223-3p, miR-32-3p, and miR-320a) according to the following criteria: available Exiqon probes, the best hits in bone array (signal intensity and significant differences between the groups), and predicted to target genes involved in bone metabolism. [score:3]
The intersection pathways involving genes targeted by miR-320a and miR-483-5p are mainly prostate cancer (4.496403e-14), PI3K-Akt signalling (5.614388e-08), and focal adhesion (6.000918e-07). [score:3]
Relative expression levels of miR-320a and miR-483-5p at the validation stage in patients with osteoporotic fracture (n = 5) and controls (n = 6). [score:3]
miR-320a, which is conserved in human, mouse, rat, and cow, is encoded within the basal promoter of the cell-cycle gene POLR3D in the anti-sense orientation. [score:1]
The miR-320a (p = 0.005) and miR-483-5p (p = 0.036) still showed significant differences between biological groups. [score:1]
After validation, three miRNAs –miR-30c-1-3p, miR-320a, and miR-483-5p– showed significant differences between the OP and control groups (Table  2). [score:1]
However, only miR-320a and miR-483-5p withstood BH multiple-testing correction (Fig.   3). [score:1]
miR-320a has been extensively studied, both in cancer and in osteoblastic cell function. [score:1]
[1 to 20 of 17 sentences]
17
[+] score: 61
Our results showed that miR-320 cluster (miR-320a, miR-320b, miR-320c and miR-320d) could down regulated MICB expression in human cancer cells, especially miR-320a that was highly expressed in a CCA cell line (KKU-214). [score:6]
In addition, miR-320a was also displaying high expression in plasma but low expression in the ICC tissues. [score:5]
The study of miRNA expression pattern in intrahepatic cholangiocarcinoma (ICC) by Chen et al. [34], indicated that miR-320 was down expressed in ICC. [score:5]
MiR-320a, miR-320b and miR-940 were expressed in all cell lines whereas miR-320c was only expressed in KKU-214 (Figure 1B). [score:5]
These results indicated that overexpression of the candidate miRNAs (miR-302c, miR-320a, miR542-3p, miR-641, miR-661 and miR-940) could, indeed, reduce the surface expression of MICB protein. [score:5]
These data suggested that not only miR-320a promote the suppression by directly interacted at a predicted binding site in 5′-UTR but also other candidate miRNAs. [score:4]
Thus, we concluded that candidate miRNAs (miR-320a and miR-940) genuinely regulated MICB expression. [score:4]
Finally, we concluded that not only MICB expression was regulated by miR-320a and miR-940 but could also be controlled by other candidate miRNAs such as miR-302c, miR-542-3p, miR-641 and miR-661. [score:4]
Thus, the candidate miRNAs (miR-302c, miR-320a, miR-542-3p, miR-641, miR-661 and miR-940) could regulate 5′-UTR of MICB by direct binding. [score:3]
As mentioned previously, miR-320a and miR-940 were expressed at high levels in several cell lines especially in KKU-214. [score:3]
Overexpression of candidate miRNAs in HeLa was performed by transfection with miRNA mimic vectors (miR-302c, miR-320a, miR542-3p, miR-641, miR-661 and miR-940) or control mimic vector. [score:3]
Consequently, to confirm hypothesis of these studies we constructed plasmids to overexpress candidate miRNAs (miR-302c, miR-320a, miR-542-3p, miR-641, miR-661 and miR-940 mimic) and then these mimic miRNAs or control mimic plasmids were co -transfected with reporter construct containing wild-type 5′-UTR (pMICB_5U) into 293T cells. [score:3]
The overexpressing miRNA mimic vectors (miR-302c, miR-320a, miR-542-3p, miR-641, miR-661 and miR-940 mimics) were transiently transfected into 293T cells and were co -transfected with luciferase reporter constructs containing wild-type 3-′UTR of MICB (pMICB_3U). [score:3]
KKU-214 cells were transfected with anti-sense miR-320a, anti-sense miR-940 or the scramble control. [score:1]
Luciferase reporter constructs containing 126 bp of wild type 5′-UTR-MICB at upstream of luciferase genes (pMICB_5U) and a mutated binding site of only miR-320a (pMut_320a) because the endogenous miR-320a in 293T cell lines are higher than other miRNA (Supplementary Figure S3B) and mutated binding sites of all candidate miRNAs (pMut_miR320a+5 Novel miRNAs) on 5′-UTR-MICB (Figure 3A) were firstly generated. [score:1]
One type of constructs contained the mutated binding sites of both known miRNAs (miR-20a, miR-93 and miR-106b) and nine novel miRNAs (our candidate miRNAs, miR-320c, miR-320a, miR-320b, miR-320c, miR-320d, miR-542-3p, miR-641, miR-661 and miR-940) and another type contained only the mutated binding sites of known miRNAs as a positive control (Figure 3A). [score:1]
Nevertheless, our study could support the role of miR-320 in cancer. [score:1]
KKU-214 cells were seeded at 5 × 10 [4] cells/well in 24-well plates and cultured until 70–80% confluent cell growth then transfected with 500 nM of anti-miR-320a, anti-miR-940 or the scramble control (mirVana [TM], Applied Biosystems) by using FuGene [®] HD transfection reagent (Roche) according to the manufacturer’s instructions. [score:1]
The miR-320a and miR-940 levels were reduced 90% and 55%, respectively, lower than the endogenous miRNAs (Figure 5A). [score:1]
These results indicated that miRNA candidates (miR-320a, miR-542-3p, miR641, miR-940, miR-302c and miR-661) interacted with a predicted binding site on 3′-UTR of MICB. [score:1]
Moreover, the exogenous miR-320a and miR-940 could also reduce luciferase activities (Figure 3C,E,G). [score:1]
[1 to 20 of 21 sentences]
18
[+] score: 50
The expression levels of selected group of miRNAs identified in the microarray experiment, miR−374−5p, −30b, −222, −320c, −186, −320a,−320e and −29c, were validated using quantitative real-time reverse transcription PCR (qRT-PCR) that confirmed the microarray results and showed upregulation of miR-30b, miR-320 family (320a/320c/ 320e) on day 7 post-AD differentiation induction and further increase in expression levels of the same miRNAs in addition to miR-186 on day 13 (Figure 1e). [score:8]
To confirm that RUNX2 is indeed a direct target for miR-320 family, we constructed reporter vector carrying the predicted binding site(s) of RUNX2 downstream of a firefly luciferase gene in the pMIR-REPORTER miRNA Expression Reporter vector (Figure 6c). [score:6]
We found that miR-320 family to be among the top 10% miRNAs predicted to regulate RUNX2, which further supports a role for miR-320 family in regulating RUNX2 expression during AD differentiation (Supplementary Table 5). [score:5]
Concordant with that, qRT-PCR indicated upregulation of several adipocytic markers, AdipoQ, PPAR γ (peroxisome proliferator-activated receptor- λ) and FABP4, in cells transfected with YWHAH, MIB1, RUNX2 and ZWILCH siRNAs, suggesting a plausible role for these genes in miR-320 -mediated effects on adipocytic differentiation of hMSC. [score:4]
Therefore, RUNX2 appears to be a key negative regulator of adipogenesis that seems to be targeted by several miRNA families, including the miR-320 family in our study. [score:4]
Interestingly, RUNX2 had four predicted miR-320 family binding sites on it 3′-untranslated region (3′UTR) located between nucleotides 1175 and 3142 (Figure 6a). [score:3]
Regulation of RUNX2 expression by miR-320 was subsequently confirmed using qRT-PCR and luciferase assay. [score:3]
In the present study, we have identified miR-320 family as novel regulator of bone marrow-derived hMSC differentiation into ADs. [score:2]
Among the identified miRNAs, several members of the miR-320 (miR-320a, 320b, 320c, 320d and 320e) family were differentially expressed and were chosen for further investigation, as they have not previously been implicated in regulating the adipocytic differentiation of MSCs. [score:2]
We identified miR-320 family as the most prominent novel regulator of hMSC differentiation into ADs. [score:2]
The interaction between miR-320 and RUNX2 3′ UTR was found to be specific, as mutating miR-320 seed region in the 3′UTR of RUNX2 completely abrogated its regulatory effects. [score:2]
Using Tri-Pronged approach combined with functional and biochemical assays, we identified several novel gene targets for miR-320 family during adipocytic differentiation of hMSC. [score:2]
To assess the direct interaction between miR-320 miRNA family and the 3′UTR from RUNX2, HEK-293 cells were co -transfected with 100 nM of pre-miR-Neg or pre-miR-320c and 100 ng of pMIR-REPORT carrying either wt or mutant 3′UTR sequences, along with 20 ng of pRL-SV40 vector (Promega, Madison, WI, USA) carrying the Renilla luciferase gene. [score:2]
As miR-320 family was the most novel family of miRNAs identified in current study as a possible regulator of adipocytic differentiation of hMSCs, all subsequent experiments focused on miR-320c member. [score:2]
[24] A mutant version of RUNX2 UTR reporter vector with mutations in the predicted miR-320 seed region(s) in the 3′UTRs was also generated using the primer combination listed in Table 2. The pRL-SV40 (encoding for renilla luciferase) was used for normalization. [score:1]
Bioinformatics analysis revealed that RUNX2 3′ UTR harbors four potential binding sites for miR-320 family. [score:1]
Therefore, it is plausible that miR-320 family promote adipogenesis via blocking other MSC differentiation pathways (i. e., osteoblast; Figure 6d). [score:1]
[1 to 20 of 17 sentences]
19
[+] score: 37
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572, and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-130a-3p, miR-195-5p, and miR-19b-3p were upregulated. [score:7]
miR-151a-3p (ΔΔCt = -2.01, P = 8.29E-06), MiR-181b-5p (ΔΔCt = -3.39, P = 1.04E-10), miR-320a (ΔΔCt = -2.47, P = 5.02E-12), miR-328 (ΔΔCt = -2.28, P = 4.33E-06), miR-433 (ΔΔCt = -2.33, P = 0.0001), miR-489 (ΔΔCt = -2.10, P = 1.25E-06), miR-572 (ΔΔCt = -2.47, P = 2.66E-08) and miR-663a (ΔΔCt = -2.06, P = 0.00002) were downregulated, while miR-101-3p (ΔΔCt = 1.43, P = 0.003), miR-106b-5p (ΔΔCt = 1.30, P = 0.008), miR-130a-3p (ΔΔCt = 2.35, P = 1.89E-09), miR-195-5p (ΔΔCt = 1.43, P = 0.0016) and miR-19b-3p (ΔΔCt = 1.87, P = 6.88E-09) were upregulated in the ASD individuals. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
The results of the present and previous studies are summarized in Table  2, in which hsa-miR-181b-5p, hsa-miR-195-5p, hsa-miR-320a and hsa-miR-328 showed the same direction of regulation as in the brain [13] and lymphoblasts [14- 16], while hsa-miR-106b-5p, hsa-miR-19b-30 and hsa-miR-663a did not. [score:3]
Collectively, these results predicted several neurologically relevant canonical pathways for the target genes of the five miRNAs (miR-130a-3p, miR-19b-3p, miR-320a, miR181b-5p, and miR-572) that showed a good discriminative power in ROC analysis. [score:3]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
High values for sensitivity, specificity and the area under the curve (AUC) were observed for five miRNAs: miR-181b-5p, miR-320a, miR-572, miR-130a-3p and miR-19b-3p (see Additional file 6). [score:1]
High values for sensitivity, specificity and area under the curve (AUC) were observed for five miRNAs: miR-181b-5p, miR-320a, miR-572, miR-130a-3p and miR-19b-3p (see Additional file 6). [score:1]
[1 to 20 of 9 sentences]
20
[+] score: 36
Because HMGB1 is a known direct target of miR-320a, the expression level of miR-320a might regulate the invasion and metastasis of HCC cells by targeting the HMGB1 pathway, partly indicating the potential antimetastasis role of miR-320a in HCC [38]. [score:9]
miR-320a is downregulated in various malignant diseases. [score:6]
Several researchers had reported that, by targeting β-catenin, miR-320 suppresses the proliferation of colon cancer cells [58] and has potential as a prognostic biomarker for colorectal cancer [59]. [score:5]
Yuan et al. have reported that miR-320a has a suppressive effect on the stemness features of HCC cells by repressing CTNNB1 signals and that association of lncRNA-DANCR with CTNNB1 decreases the inhibitory actions of miR-320a on CTNNB1 [65]. [score:5]
One study has demonstrated that miR-320a represses proliferation and metastasis and enhances irradiation -induced apoptosis by directly targeting STAT3 signals in lung adenocarcinoma cells [57]. [score:4]
Other studies have also suggested that miR-320a can inhibit tumor growth in breast cancer [60], glioblastoma [61], gastric cancer [62], and acute lymphoblastic leukemia [63]. [score:3]
Yao et al. have reported that miR-320a deregulates guanine nucleotide -binding protein G(i) α-1 subunit (GNAI1) and facilitates the migration and invasion of HCC [64]. [score:2]
The roles of miR-320a in HCC are also under discussion. [score:1]
3.2. miR-320a. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 28
We identified 20 miRNAs to be significantly differentially expressed between the case and control group, including miR-320a which is coincident with Choi et al. Of above 20 miRNAs, there were 17 downregulated miRNA and 3 upregulated miRNA, which was coincident with our previous study showing more upregulated genes than downregulated genes in case group [17]. [score:15]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
They found a significant upregulation of miR-194-5p and miR-320a in MDS patients compared with controls. [score:3]
[1 to 20 of 4 sentences]
22
[+] score: 27
Notably, the Pten -deficient stromal fibroblasts upregulated Ets 2 expression and downregulated miR-320, a negative regulator of Ets 2 expression that contributed to increased mammary tumour growth [53]. [score:12]
Thus, inhibition of Ets2 expression by either its genetic deletion or miR-320 overexpression attenuated the promotion of tumour growth by these fibroblasts [48, 53]. [score:7]
Collectively, these findings suggest that Pten expression in FSP-1 [+] stromal fibroblasts serves as a negative regulator of Ets2 expression via miR-320 to inherently constrain mammary tumourigenesis. [score:6]
Bronisz A. Godlewski J. Wallace J. A. Merchant A. S. Nowicki M. O. Mathsyaraja H. Srinivasan R. Trimboli A. J. Martin C. K. Li F. Reprogramming of the tumour microenvironment by stromal pten-regulated mir-320 Nat. [score:2]
[1 to 20 of 4 sentences]
23
[+] score: 27
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
Down-regulation of the miR-320a level is associated with up-regulation of the muscle-type phosphofructokinase gene and an increase in lactate, namely, enhancement of glycolysis. [score:7]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
Expression of miR-320a is ubiquitously distributed in tissues of cattle [53]; however, its role remains unclear. [score:3]
The lower level of glycolysis-related miR-320a in circulation [54] might be associated with muscle phenotypic changes induced by grazing as shown previously [16]. [score:1]
In the present study, the miR-320a level in circulation was higher in the housed cattle than in the grazing cattle at 4 mo. [score:1]
Meanwhile, in the present study, circulating levels of miR-19b, miR-150, miR-223, and miR-320a were temporarily lower in the grazing cattle than in the housed, suggesting that there might be some stress on the grazing cattle. [score:1]
No exercise -induced changes in circulating miR-19b, miR-150, miR-320a, or miR-361 have ever been reported, which may indicate the specificity of changes in those miRNAs to the grazing movements of cattle. [score:1]
Grazing -induced miRNAs: miR-19b, miR-150, miR-223, miR-320a, miR-361. [score:1]
At 2 mo, the levels of miR-19b, miR-150, miR-223, miR-320a, and miR-361 in the grazing cattle were lower than in the housed cattle (P = 0.015, 0.020, 0.026, 0.023, and 0.089, respectively). [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 27
The results of the present study demonstrate that miR-152, in addition to miR-31, miR-210, and miR-320 miRNAs, targets TFRC directly, evidenced by functional miR-152-TFRC analyses and an inverse correlation between markedly decreased miR-152 level and TFRC up-regulation in human HCC cells and HCC tissue samples. [score:7]
Transfection with miR-152 efficiently down-regulated TFRC at both mRNA and protein levels (Figure 4D and 4E), while transfection with either miR-194 or miR-320 did not (data not shown). [score:4]
Likewise, Chen et al. [47] have reported a significant down-regulation of miR-320 in liver tumors. [score:4]
It has been reported previously that three miRNAs, miR-31, miR-210, and miR-320, in addition to miR-152, may target TFRC [43– 45]; however, considering a high degree of miRNA tissue specificity, the biological significance of any given miRNA-mRNA interaction should be evaluated in a specific target tissue context. [score:3]
In contrast, the expression of miR-194 in PLC/PRF/5, Hep3B, and HepG2 cells was substantially greater than in SK-HEP1 cells and there was no major difference in the level of miR-320 among cell lines (Supplementary Figure 1). [score:3]
The results of in silico screening analysis demonstrated that several miRNAs, including miR-152, miR-194, and miR-320, could target the 3′-UTR of TFRC mRNA. [score:3]
To confirm further the involvement of miR-152 in the regulation of TFRC at the post-transcriptional level, HepG2 cells were transfected with miR-152, miR-194, miR-320 microRNA mimics, or scrambled RNA oligonucleotide. [score:2]
HepG2 cells were seeded in 100 mm dishes at a density of 1 × 10 [6] cells/dish, and transfected with 20 nM of either miR-152, miR-194, or miR-320 microRNA mimics (Life Technologies), in three independent replicates, using Lipofectamin™ 2000 transfection reagent (Life Technologies) according to the manufacturer's instructions. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 27
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
[1 to 20 of 3 sentences]
26
[+] score: 25
Overexpression of miR-320-3p did not significantly affect CYP17A1 mRNA levels but inhibition enhanced levels of both mRNAs; this implies that CYP17A1 is already under maximal inhibition at the miR-320-3p target site. [score:9]
CYP11A1 and CYP17A1 are both targets for miR-320a-3p. [score:3]
This is borne out by the fact that qRT-PCR analysis of specific miRNA levels in the Dicer1 knockdown cells showed no significant reduction on the levels of the miRNAs miR-125a-5p, miR-125b-5p, miR-134-3p, miR-320a-3p, and miR-495-3p relative to controls (data not shown). [score:2]
Our study has shown a high level of miR-320a-3p in the carcinoma-derived H295R cell line and its potency as a CYP17A1 regulator. [score:2]
Like most miRNAs characterised to date, miR-320-3p has been reported to have multiple mRNA targets and regulate different pathways in different cell types. [score:2]
3.4. miR-320a Is a Common Regulator of CYP17A1 and CYP11A1. [score:2]
Of the five miRNAs investigated in the current study, two (miR-125a-5p and miR-495-3p) were expressed at significantly lower levels in APA tissue relative to nontumorous tissue; one (miR-320a-3p) was significantly increased in APA tissue and two (miR-125b-5p and miR-134-3p) did not differ significantly between the tissue types (Figure 6). [score:1]
Pre-miR™ or Anti-miR™ molecules (miR-125a-5p: product code 12561; miR-125b-5p miR-134-3p 10341; miR-495-3p: 11526; and miR-320a-3p: 11621, Applied Biosystems) were transfected to a final concentration of 50 nM and prevalidated siRNA molecules (Dicer 1A: product code s23755; Dicer 1B: s23756, Applied Biosystems) to a final concentration of 30 nM. [score:1]
Reduction of miR-320a-3p levels in H295R cells significantly increased both mRNAs: CYP11A1 (1.40 ± 0.03-fold; p < 0.01) and CYP17A1 (1.53 ± 0.09-fold; p < 0.05). [score:1]
Bioinformatic analysis predicted a miRNA binding site for miR-320a-3p in the 3′UTR of two corticosteroidogenic genes: CYP11A1 and CYP17A1. [score:1]
Raising miR-320a-3p led to significantly decreased CYP11A1 mRNA (0.81 ± 0.02-fold; p < 0.05) but did not significantly affect CYP17A1 (1.02 ± 0.12-fold). [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 25
To the best of our knowledge, we initially detected a decreased expression pattern of miR-320c in human bladder cancer tissue compared with its normal adjacent tissue in the study, Recent miRNA microarray analyses demonstrated that miR-320 was down-regulated in many types of cancer, including breast cancer, acute myelogenous leukemia and colon cancer, indicating that miR-320 could act as a tumor suppressor in cancer, which was similar to our results [16]¿[18]. [score:7]
Previous miRNA microarray analysis illustrated that miR-320 is down-regulated in breast cancer, acute myelogenous leukemia and colon cancer, revealing that miR-320 could probably act as a tumor suppressor in prohibiting the behavior of cancer [16]¿[18]. [score:6]
Additionally, miR-320a/c/d could inhibit the migration and invasion of hepatocellular cancer via targeting GNAI1, a crucial protein of multiple cellular signal transduction pathways [20]. [score:5]
It was reported that miR-320 could inhibit prostate cancer cell proliferation by down -regulating the Wnt/beta-catenin signaling pathway [19]. [score:4]
Therefore, we identified CDK6 as a new target of miR-320. [score:3]
[1 to 20 of 5 sentences]
28
[+] score: 23
Other miRNAs from this paper: hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-221, hsa-mir-342, hsa-mir-422a
Consistently, the well-known mechanistic pathway NF-κB pathway components were targeted and up-regulated by miR-221 and miR320a (Fig. 5G). [score:6]
TNF-α secretion and MMP-9 level/activity were also enhanced in the same pattern, i. e. MV-miR-221 and MV-miR-320a synergistically up-regulated MMP level and activities, as well as TNF-α secretion from BMDMs (Fig. 6D,E, respectively). [score:4]
We chose three specific miRNAs (miR-320a, miR-221, and miR-342) and further confirmed their enhanced expression in Beas2B epithelial MVs after hyperoxia (Fig. 5B). [score:3]
MVs with enhanced miR-221 and/or miR-320a were used to treat mouse BMDMs, as illustrated in Fig. 6A. [score:1]
Both miR-221 and miR-320a promoted macrophage migration significantly. [score:1]
More interestingly, miR-221 and miR-320a robustly exerted synergistic effects on macrophage migration (Fig. 5D). [score:1]
To illustrate the functions of these hyperoxia -induced miRNAs, we transfected THP1 macrophages with miR-221 and/or miR-320a mimics. [score:1]
MiRNA-221 mimics (HMI0398), miRNA-320a mimics (HMI0470), miRNA-92a mimics (HMI0955), and miRNA-422a (HMI0562) were purchased from Sigma Aldrich (St. [score:1]
Similarly, a synergistic effect between miR-221 and miR-320a on macrophage-derived TNF-α secretion was also observed (Fig. 5F), in addition to miR-221 or miR-320a inducing TNF-α secretion individually (Fig. 5F). [score:1]
Here we chose miR-221 and miR-320a as examples to be consistent with the above data. [score:1]
of THP1 macrophages was performed after treated with mir-221 and/or mir-320a mimics which were transfected using lipofectamine 2000, as described in Material and Methods. [score:1]
BMDMs treated with MVs with the enhanced miR-221 and/or miR-320a augmented BMDM migrations. [score:1]
More importantly, MVs which contain both the enhanced miR-221 and miR-320a carried the strongest effects on promoting macrophage migration (Fig. 6C). [score:1]
[1 to 20 of 13 sentences]
29
[+] score: 22
miR-320 was shown to be involved in the regulation of cardiac ischemia/reperpusion injury through targeting heat-shock protein 20: over -expression enhanced cardiomyocyte apoptosis, whereas knockdown was cytoprotective [30]. [score:7]
Ten miRNAs were used for further in silico validation: one predicted by using above programs with elevated expression in microarray analysis (hsa-miR-574-3p; miRBase accession number: MIMAT0003239) and nine up-regulated in microarray analysis but not predicted by the algorithms used (hsa-miR-122, hsa-miR-199a-3p, hsa-miR-140-3p, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-483-5p, hsa-miR-574-5p; miRBase accession numbers: MIMAT0000421, MIMAT0000232, MIMAT0004597, MIMAT0000510, MIMAT0005792, MIMAT0005793, MIMAT0006764, MIMAT0004761, MIMAT0004795, respectively). [score:6]
Other up-regulated and in silico validated miRNAs were miR-199a, four members of miR-320 family and miR-483. [score:4]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
9−9.5380-401yes −21.0−3.1−11.1487-508yes −18.6−8.3−3.959-80yes −18.1−7.5−8.3251-272no miR-320a−21.2−9.9−9.3405-426no −21.8−9.00.3798-819no −21.2−4.7−9.865-86partially (1–4) −23.7−8.2−8.2687-708no −21.8−9.1−11.9123-144partially (1–6) miR-320b−21.2−9.9−9.3405-426no −21.8−9.00.3798-819no −21. [score:1]
In case of SERCA2b, 13 binding sites were predicted for hsa-miR-320a/b, 12 for hsa-miR-320c/d, 15 for hsa-miR-574-5p and 20 for hsa-miR-122. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 21
A study comparing miRNA expression in inflammatory breast cancer (IBC) with non-IBC also found miR-320 to be downregulated in the more aggressive IBC group of tumors [50]. [score:6]
miR-320 has been reported to be decreased in breast tumor tissue and downregulation of miR-320 - through loss of phosphatase and tensin homolog (PTEN) -has been shown to promote tumor proliferation and invasiveness in mouse mo dels; expression of miR-320 distinguished human normal breast stroma from tumor stroma and was correlated with recurrence [49]. [score:6]
Thus, loss of miR-320 expression may be associated with a higher likelihood of lymph node involvement and a more aggressive metastatic phenotype. [score:3]
Of these, miR-320 is of particular interest as we found three miR-320 family members (miR-320b, miR-320d, and miR320e) to be underexpressed in the serum of women who developed lymph node -positive breast tumors. [score:3]
Of the 10 miRNAs differentially expressed in the serum of women with tumors that spread to the lymph nodes (pN1 or higher), four (miR-145, miR-124, miR-125b, and miR-320) have been reported to be associated with breast cancer in previous studies [45- 48]. [score:3]
[1 to 20 of 5 sentences]
31
[+] score: 20
Supporting the notion of disease relevance, this network included several known PD-related genes such as the transcriptional regulator FOXP1 (Kim et al., 2007), that promotes midbrain dopaminergic identity in stem cells (Konstantoulas et al., 2010), which was identified as alternatively spliced in this study and was predicted as targeted by the PD dys-regulated hsa-miR-320 cluster. [score:7]
Statistical significance enrichment analysis identified nine miRNAs as frequently targeted at detected spliced transcripts: hsa-miR-769-3p (predicted to target four transcripts), hsa-miR-378 (with six targets) as well as hsa-mir-320, hsa-miR-92b-5p, hsa-miR-16, hsa-miR-150, hsa-miR-671, hsa-miR-20a, and hsa-miR-18b (The full list and adjusted p-values are given under Table S10). [score:7]
The modified leukocyte miRNAs also differed in their copy numbers (for example, hsa-miR-20a expressed higher as compared with hsa-miR-320, Figure 2G). [score:2]
Intriguing, miR-320, which was modified in PD patients as compared with matched healthy control volunteers is included in a miRNA signature of prion -induced neurodegeneration (Saba et al., 2008), perhaps reflecting a feedback response aimed to avoid disease symptoms that was potentiated by DBS. [score:2]
Enrichment analysis detected 6 of the DBS -modified miRNAs as modified (having adjusted p-value < 0.05): hsa-miR-320 (a, b, and c) as predicted to bind 4 spliced transcripts including hnRNPA2B1, hsa-miR-378 (predicted to bind 6 spliced transcripts), hsa-miR-92b (predicted to bind 4 spliced transcripts), hsa-mir-150, hsa-miR-20a, and hsa-miR-18b (where hsa-miR-18b-3′ changed). [score:1]
Notably, the extended domain spans putative binding sites for several PD -modified miRNAs (including hsa-miR-320a, hsa-miR-320b, and hsa-miR-320c), together indicating that the observed inclusion events may entail functional relevance. [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 20
Schaar D. G. Medina D. J. Moore D. F. Strair R. K. Ting Y. miR-320 targets transferrin receptor 1 (CD71) and inhibits cell proliferation Exp. [score:5]
The importance of miRNA similar to miR-210 and miR-320 in the regulation of iron metabolism in vivo and in non-cancerous cell lines remains to be established, though these findings may represent potential therapeutic targets for sequestering iron from cancerous and tumorigenic cell types. [score:4]
miRNA Target mRNA Reference(s) miR-Let-7d DMT (∆IRE), BACH1Andolfo et al. (2010) [42], Hou et al. (2012) [43] miR-122 HFE, HJVCastoldi et al. (2009) [44] miR-196 BACH1Hou et al. (2010) [45] miR-200b FTHShpyleva et al. (2009) [46] miR-210 ISCU, TFRChan et al. (2009) [47], Yoshioka et al. (2012) [48] miR-214 LactoferrinLiao et al. (2010) [49] miR-320 TFRSchaar et al. (2009) [50] miR-485-3p FPNSangokoya et al. (2013) [51] miR-584 Lactoferrin ReceptorLiao et al. (2010) [52] Whereas hepcidin is considered to be the primary means of regulating systemic iron homeostasis, a family of cytosolic RNA binding proteins known as Iron Regulatory Proteins (IRP) is considered to be the global regulators of cellular iron homeostasis. [score:4]
Furthermore, enhanced expression of miR-320 decreases the abundance of TfR on the plasma membrane and limits iron uptake in the lung carcinoma cell line A549 [50]. [score:3]
MiR-320 contributes to the regulation of cellular iron uptake by repressing TfR translation to decrease transferrin -dependent iron uptake. [score:3]
Finally, it remains to be established whether many of the miRNA demonstrated to affect iron metabolism using cell -based or other genetic approaches, such as miR-320 and miR-200b, have physiological roles in vivo or in non-transformed cell types, especially in response to physiologically-relevant alterations in nutrient intake. [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 20
To begin with the most downregulated miRNA in penile cancer miRNA-320a, we found it often played as a tumor-suppressive miRNA in bladder cancer [55] and colorectal cancer [56] by targeting different oncogenes. [score:8]
Among the deregulated miRNAs, the most abundantly downregulated and upregulated miRNAs were miR-320a and miR-107, respectively. [score:8]
Intriguingly, some miRNAs such as miR-320a, which was differentially expressed between the cancerous and normal penile tissues (Table 3), possessed slightly different modification behaviors between the paired specimens as well (S6 and S7 Tables). [score:3]
In normal penile tissues, let-7a-5p, let-7f-5p, let-7b-5p, let-7c-5p, miR-140-3p, let-7g-5p, let-7e-5p, miR-103a-3p, miR-320a, miR-143-3p were the top abundant miRNAs. [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 19
Notably, our interaction network analysis of miRNA-overtargeted genes showed that miR-320 is involved in several interactions that target important tumor suppressor genes such as CDKN2A and PTEN (Figure 4). [score:7]
Alternatively, miR-320 might perform as an oncomir under certain conditions (e. g., distinct miRNA partners involved in cooperative gene targeting could inhibit the activity of distinct subsets of genes). [score:5]
This may indicate that miR-320 overexpression in the circulation of our HNSCC patients is part of an adaptive response against the cancer. [score:3]
The report by Kim and Choi [52] supports the oncogenic potential of miR-320. [score:1]
As evidenced in Figures 4 and 5, the interaction network approach underscores the key role of let-7a/f, miR-26a/b, miR-103, miR-107, miR-205, and miR-320a/b among others. [score:1]
These authors found that miR-320 promotes proliferation of Dgcr8 -deficient embryonic stem cells (ESCs) by releasing them from G1 arrest. [score:1]
In contrast to the clear oncogenic role demonstrated for miR-103a and miR-107, miR-320 has been mainly reported as an anti-angiogenic miRNA in breast cancer [51] and oral squamous cell carcinoma [43]. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 19
The predicted target of miR-320 is methyl CpG -binding protein 2 (MECP2), which is up-regulated in BC and is an oncogene promoting cell proliferation [374]. [score:6]
The predicted target of miR-320 is MECP2 which is up-regulated in BC and serves as an oncogene promoting cell proliferation. [score:6]
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
In a study of Muller et al. [374], mir-320 has been found to be located in regions with DNA CN loss in BC. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 18
In this study we observed miR-320 and 486-5p to be downregulated with the exposure and both activating the expression and translation of the forkhead box transcription Factor FOXP1. [score:8]
Zhang, T. et al. Down-regulation of miR-320 associated with cancer progression and cell apoptosis via targeting Mcl-1 in cervical cancer. [score:6]
Furthermore, both miRNAs miR-320 and miR-486 have been reported to be downregulated in many types of cancer 26, 27. [score:4]
[1 to 20 of 3 sentences]
37
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
[1 to 20 of 2 sentences]
38
[+] score: 18
Furthermore, gene expression profiling of miR-320 -overexpressing PCa cells showed a significant decrease in downstream target genes of the Wnt/β-catenin pathway and CSC markers (Hsieh et al., 2013). [score:7]
Another miRNA that regulates CSC properties is miR-320, which acts by directly targeting β-catenin in PCa cells (Hsieh et al., 2013). [score:5]
miR-320 and β-catenin expression is inversely correlated in CD44 [+] PCa cells. [score:3]
MicroRNA-320 suppresses the stem cell-like characteristics of prostate cancer cells by downregulating the Wnt/beta-catenin signaling pathway. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 17
MicroRNA-320a suppresses human colon cancer cell proliferation by directly targeting β-catenin. [score:5]
ß-catenin is a direct target of miR-200a (Saydam et al., 2009), (Xia et al., 2012), miR-320a (Sun et al., 2012), and miR-1826 (Hirata et al., 2012). [score:4]
β-catenin is a direct target of miR-200a,, miR-320a, and miR-1826. [score:4]
Downregulation of miR-200a,, miR-320a, and miR-1826 de-repress ß-catenin and activate the canonical WNT signaling cascade in human cancers. [score:4]
[1 to 20 of 4 sentences]
40
[+] score: 17
Song C. L. Liu B. Diao H. Y. Shi Y. F. Zhang J. C. Li Y. X. Liu N. Yu Y. P. Wang G. Wang J. P. Down-regulation of microrna-320 suppresses cardiomyocyte apoptosis and protects against myocardial ischemia and reperfusion injury by targeting IGF-1 Oncotarget 2016 10.18632/oncotarget. [score:11]
miRNA-320, which targets ASK1, suppressed cardiomyocyte apoptosis by down -regulating ASK1/JNK phosphorylation under ischemia/reperfusion injury [33]. [score:6]
[1 to 20 of 2 sentences]
41
[+] score: 17
For example, the common genes (purple nodes), e. g., TSC1, MYC, and CDKN2A, were targeted by different miRNAs in two cancer subtypes while the common miRNA regulators (pink diamonds with red border), e. g., miR-320a, -17-5p, and 92a-3p, can interact with different targets, which leads to a different set of interactions that control the same functional pathway. [score:6]
Xie F miRNA-320a inhibits tumor proliferation and invasion by targeting c-Myc in human hepatocellular carcinomaOnco. [score:5]
Under different conditions, miRNAs tend to target different genes but miR-320a always interacts with the same gene (PKM2) when regulating the glycolysis pathway. [score:4]
Pathways MicroRNAs Conditions (Cancer/Stage) KIRC LIHC UCEC Stage 1 Stage 2 Stage 1 Glycolysis / Gluconeogenesis Pathway miR-18a-3p PGK1, PKM2 PKM2 PKM2 miR-320a PKM2 PKM2 PKM2 miR-193b-3p GPI, PGAM1 GPI, ALDH3A2, ALDH7A1 GPI, ALDH3A2, TPI1 miR-92b-3p PGAM1 ALDOA PGAM1 Pathways MicroRNAs KIRC LUSC UCEC Stage 1 Stage 1 Stage 1 Focal Adhesion miR-18a-3p PAK4, PIK3R3 COL4A1 COL4A1 miR-320a ACTB, CCND2 PAK1, CCND2 LAMA5, MET miR-193b-3p LAMB1 FLNA, RAPGEF1, VAV2 CCND1, PTEN, PAK2, PIP5K1C, COL4A1 miR-92b-3p ACTN4, PARVG, PPP1CB FLNB, MAPK1 ACTN4, FLNA, MAPK1, PARVG, TLN1 Figure 6Illustration of the cooperative regulation of a miRNA module that contains four miRNAs: miR-18a-3p, -320a, -193b-3p, and -92b-3p (pink diamonds). [score:2]
[1 to 20 of 4 sentences]
42
[+] score: 17
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
Using DIANA mirPath software [36], gene targets were interrogated for miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a down-regulated in PCM vs. [score:6]
miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a were down-regulated in PCM vs. [score:4]
[1 to 20 of 3 sentences]
43
[+] score: 16
The relative expression of the five miRNAs (let-7b, miR-29a, miR-30a, miR-140 and miR-320a) in each FF pool was calculated relative to that of miR-16 by using the equation 2 [−∆Ct], in which ∆Ct was determined by the formula: Ct target miRNA−Ct miR-16. [score:3]
Taken together, these data suggest that miR-320a is indicative of mature oocyte quantity and quality and that its intra-follicular expression could be modulated by the ovarian response quality of patients undergoing IVF. [score:3]
Differently from two previous study 5 47, FF miR-320a expression was not affected in our group of women with PCOS. [score:3]
However, miR-320a expression level was significantly lower in FF pools from women with less than two mature oocytes (≤2) compared with women with more than two mature oocytes. [score:2]
In the mouse, miR-320a knockdown in oocytes decreased significantly the proportion of mature oocytes that developed into embryos 32. [score:2]
At oocyte retrieval day, FF pools from women with a low number of mature oocytes (MII) (≤2) contained significant lower FF miR-320 levels than those related to a number of mature oocytes higher than 2 (p = 0.04) (Fig. 3C). [score:1]
This study investigated the expression profiles of five circulating miRNAs (let-7b, miR-29a, miR-30a, miR-140 and miR-320a) in FF pools from patients undergoing IVF/ICSI procedure. [score:1]
By using Spearman’s correlation analysis, miR-320a level in FF pools was significantly and positively correlated with the number of mature oocytes (r = 0.24; p = 0.02) (data not shown). [score:1]
[1 to 20 of 8 sentences]
44
[+] score: 16
Song, C. L. et al. Down-regulation of microRNA-320 suppresses cardiomyocyte apoptosis and protects against myocardial ischemia and reperfusion injury by targeting IGF-1. Oncotarget, doi:10.18632/oncotarget. [score:12]
Validation of a selected few by qPCR identified 10 miRNAs - miR-133b-3p, miR-208b-3p, miR-21-5p, miR-125a-5p, miR-125b-5p, miR-126-3p, miR-210-3p, miR-29a-3p, miR-494-3p and miR-320a, that were significantly up-regulated in HF myocardium compared to normal controls. [score:3]
MiR-210-3p is closely related to hypoxia 41, 42, and interestingly, both miR-320a and miR-494 are reported to be associated with cardiac apoptosis induced by ischemia 43, 44. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Interestingly, the miR-320 was differently expressed in the follicular fluid of women with PCOS in still one study [53] and was along miR-383 upregulated in comparison with healthy (control) women. [score:6]
This study demonstrated that miR-320 regulates the proliferation and steroid production by targeting E2F1 and SF-1 in granulosa cells and is involved in the follicular development. [score:5]
In another study, it has been found that two miRNAs, miR-132 and miR-320, were expressed at significantly lower levels in the follicular fluid of women with PCOS than in a group of healthy women, as can be seen in Figure 3. In addition, it has been evidenced that miR-132, miR-320, miR-520c-3p, miR-24, and miR-222 that are present in the follicular fluid regulate estradiol concentrations and miR-24, miR-193b, and miR-483-5p progesterone concentrations [52]. [score:4]
[1 to 20 of 3 sentences]
46
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Li et al. (2014) showed that miRNA-320a targeted the 3′ UTR of hsc70, decreased hsc70 expression in α-synuclein -overexpressed SH-SY5Y cells, and resulted in significant α-synuclein intracellular accumulation. [score:7]
Targeted suppression of chaperone -mediated autophagy by miR-320a promotes α-synuclein aggregation. [score:5]
Li et al. (2014) demonstrated that miRNA-320a plays an essential role in SNCA aggregation during PD pathogenesis. [score:1]
While in terminal stage of prion infection miRNA-146a-5p, miRNA-142-3p, miRNA-143-3p, miRNA-145a-5p, miRNA-451a, miRNA-let-7b, miRNA-320, and miRNA-150-5p are significantly elevated in the brains of prion-infected animals. [score:1]
At the terminal stage of prion infection miRNA-146a-5p, miRNA-142-3p, miRNA-143-3p, miRNA-145a-5p, miRNA-451a, miRNA-let-7b, miRNA-320, and miRNA-150-5p were elevated. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 15
Among the 13 miRNAs screened except miR-433, which was omitted from further analysis since the amplification was not proper in the cell lines studied, three miRNAs [miR-489 (p = 0.01 at 1μM), miR-572 (p = 0.009 at 1μM; p = 0.0004 at 5μM; p = 0.024 at 10μM); miR-663a (p = 0.032 at 5μM; p = 0.058 at 10μM)] were up-regulated in fluoxetine -treated (1-, 5- and 10-μM) SK-N-SH cells, while four miRNAs [miR-320a (p = 0.004 at 10μM), miR-489 (p = 0.037 at 10μM), miR-572 (p = 0.0002 at 5μM; p = 0.0004 at 10μM); miR-663a (p = 0.006 at 10μM)] were up-regulated in fluoxetine -treated SH-SY5Y cells compared to corresponding DMSO -treated control cells (Fig 2). [score:6]
Up-regulated expression of miRNAs (miR-320a, miR-489, miR-572 and miR-663a) in (a) SK-N-SH cells and (b) SH-SY5Y cells treated with various concentrations of fluoxetine compared to DMSO -treated control cells. [score:5]
The expression of miR-320, miR-489, miR-572 and miR-663a were further compared between 10 μM fluoxetine (6 wells each) treated SK-N-SH and SH-SY5Y cells and their control cells. [score:2]
Confirmation qPCR experimental data with four miRNAs (miR-320, miR-489, miR-572 and miR-663a) of SK-N-SH cells with 10-μM Fluoxetine and equal concentration of DMSO control. [score:1]
Confirmation qPCR experimental data with four miRNAs (miR-320, miR-489, miR-572 and miR-663a) of SH-SY5Y cells with 10-μM Fluoxetine and equal concentration of DMSO control. [score:1]
[1 to 20 of 5 sentences]
48
[+] score: 15
mRNA, messenger RNA Table 1circRNA-miRNA-mRNA network elements for those circRNA-miRNA interactions predicted by both miRanda and RNAHybrid, with a miRanda match score > = 180 and mRNA targets that are differentially expressed (uncorrected P < 0.05) with log2(fold change) >= 2 or =< − 2 (high stringency network) Circular RNA microRNA target Number of binding sites predicted Target genes (differentially expressed) X:47,431,299–48,327,824 hsa-miR-139-5p 6 NOTCH1, STAMBP, TPD52 8:144,989,320–145,838,888 hsa-miR-320a 2 METTL7A, PBX3, PLS1, SEC14L1, VCL, VIM, VOPP1, YPEL2 8:144,989,320–145,838,888 hsa-miR-320b 2 RTKN, VCL, VOPP1 X:47,431,299–48,327,824 hsa-miR-449a 1 BAZ2A, MFSD8, NOTCH1, TSN, ZNF551 8:144,989,320–145,838,888 hsa-miR-125a-3p 1 ANKRD62, C15orf40, COL18A1, MFSD11, MPEG1, MUL1, TTC31, WDR12, ZNF641 X:47,431,299–48,327,824 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 8:144,989,320–145,838,888 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 X:47,431,299–48,327,824 hsa-miR-324-5p 1 FOXO1, MEMO1, PSMD4, SMARCD2 14:23,815,526–24,037,279 hsa-miR-142-3p 1 BTBD7, CLDN12, CPEB2, CSRP2, DAG1, KIF5B, PTPN23, WHAMM 4:88,394,487–89,061,166 hsa-miR-133b 1 FAM160B1 4:88,394,487–89,061,166 hsa-miR-448 1 DDIT4, PURG 4:88,394,487–89,061,166 hsa-miR-339-5p 1 AXL, HLA-E, METTL7A, ZNF285, ZNRF3 MetaCore pathway analysis on the 255 filtered differentially expressed target genes from the previous analysis revealed 112 perturbed pathways (corrected P < 0.01; Table  2, Additional file  8: Table S5). [score:15]
[1 to 20 of 1 sentences]
49
[+] score: 15
For example, miR-106b, miR-107, miR-130a, miR-34 [9], miR-93, miR-155, miR-181a, miR-21, miR-23a, miR-320a [8], miR-193b, miR-320b [13] are significantly up-regulated and miR-148a [11, 14], miR-330-5p [15], miR-373 [16] significantly down-regulated. [score:7]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
The same occurs for miR-93 and miR-106b that belong to the same family, for miR-320a and miR-320b and for miR-19a and miR-19b (right part Figure 3A) that are clustered together, respectively, according to their miRComb targets. [score:3]
It is worth noting that these 10 miRNAs together (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-448, miR-93, miR-106b, miR-217, miR-539) could potentially be regulating 41% of the mRNAs significantly altered in PDAC. [score:2]
[1 to 20 of 4 sentences]
50
[+] score: 15
Targeting miR-320a may alienate some of the cardiotoxicity associated with doxorubicin treatment by suppressing miR-320c [39]. [score:5]
miR-320a has been shown to target the VEGF signaling pathway. [score:3]
Elevated miR-320a expression was determined to reduce cardiac microvessel density. [score:3]
VEGF-A is a target of miR-320a. [score:3]
These results indicate that miR-320a and VEGF-A play key roles in cardiotoxicity induced by doxorubicin. [score:1]
[1 to 20 of 5 sentences]
51
[+] score: 14
All five miRNAs were detected in both exosomes and the host cell line, with three miRNAs (hsa-miR-4792, hsa-miR-6087, and hsa-miR-181a-5p) downregulated and two miRNAs (hsa-miR-320a and hsa-miR-7704) upregulated in exosomes as compared with the host cell line (Fig. 4e). [score:6]
For target validation, each of the miRNAs (hsa-let-7a-5p, hsa-miR-181a-5p, hsa-miR-320a, hsa-miR-124-3p, and hsa-miR-26a-5p) was transfected into separate A2780 cells, respectively. [score:3]
The expression of five selected miRNAs (hsa-miR-4792, hsa-miR-6087, hsa-miR-320a, hsa-miR-7704, and hsa-miR-181a-5p) was confirmed in both of hAMSC-CM-derived exosomes and a host cell line by using quantitative reverse-transcription polymerase chain reaction (qRT-PCR). [score:3]
Five families (hsa-miR-320, hsa-miR-181, hsa-miR-29, hsa-miR-125, and hsa-miR-151) were each associated with three miRNAs found here. [score:1]
While members of the hsa-miR-320 8 and hsa-miR-125 families 12 are reported as having anticancer properties, miR-151 family members are documented as exhibiting pro-cancer 13 functions. [score:1]
[1 to 20 of 5 sentences]
52
[+] score: 14
The relative expression levels of 62 miRNA (out of 366 human miRNAs tested) expressed substantially in these cells are shown in Figure 6. The most abundant miRNAs expressed in ARPE-19 cells were let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d. [score:7]
MiR-320 regulates cardiac ischemia/reperfusion injury and cell proliferation by targeting heat-shock protein 20 and transferrin receptor 1, respectively [52, 53]. [score:3]
Microarray hybridization analysis identified let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d as the most abundant miRNAs normally expressed in ARPE-19 cells. [score:3]
The most abundant miRNAs that were detected in ARPE-19 cells were let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 14
Specifically, miR-486-5p was the most expressed miRNA in plasma exosomes samples (median reads = 180,173 reads) while miR-320a (median reads = 198 reads), miR-6813-5p (median reads = 5,911 reads), and miR-30a-5p (median reads = 25,910 reads) were the highest expressed in cervical scrapes, stool, and urine, respectively (Supplementary Figure 2B). [score:5]
The most commonly investigated resulted miR-320a whose downregulation is associated with different diseases including cancer [25– 30]. [score:4]
For instance, the high expression of the above mentioned miR-320a and miR-589-5p were also observed in all other datasets. [score:3]
Eleven miRNAs were identified as commonly detectable in all types of specimens: miR-320a, miR-589-5p, miR-636, miR-1273a, miR-3960, miR-4419a, miR-4497, miR-4709-5p, miR-4792, miR-7641-1, and miR-7641-2. Figure 2(A) Venn diagram reporting the number of miRNAs detected in different specimens from healthy individuals and their overlap. [score:1]
Eleven miRNAs were identified as commonly detectable in all types of specimens: miR-320a, miR-589-5p, miR-636, miR-1273a, miR-3960, miR-4419a, miR-4497, miR-4709-5p, miR-4792, miR-7641-1, and miR-7641-2. Figure 2(A) Venn diagram reporting the number of miRNAs detected in different specimens from healthy individuals and their overlap. [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 13
The levels of target mRNAs (STAT3, MFN2 and XIAP) of selected miRNAs (let-7b, hsa-miR-107, hsa-miR-320a) were significantly associated with mitochondria whereas the levels decreased significantly in mitoplast (Figure 7D). [score:3]
We analyzed the targets of 3 miRNAs (let-7b: STAT3; hsa-miR-107: MFN2; hsa-miR-320a: XIAP) by StarBase using intersection of 3 computational tools as described in materials and methods and checked their association with mitochondria. [score:3]
The targets of 3 miRNAs associated with mitochondria (let-7b: STAT3; hsa-miR-107: MFN2; hsa-miR-320a: XIAP) were determined by Starbase and validated by qPCR. [score:3]
The levels of following miRNAs were determined from 10 ng cDNA using U6 snRNA (Accession number: X59362) and 5 S rRNA (NCBI Accession no: V00589) as endogenous control using miRCURY LNA™ Universal RT microRNA PCR, SYBR Green master mix (Exiqon, Denmark): hsa-let-7b (UGAGGUAGUAGGUUGUGUGGUU); hsa-let-7g (UGAGGUAGUAGUUUGUACAGUU); hsa-miR-107 (AGCAGCAUUGUACAGGGCUAUCA); hsa-miR-181a (AACAUUCAACGCUGUCGGUGAGU); hsa-miR-221 (AGCUACAUUGUCUGCUGGGUUUC); hsa-miR-320a (AAAAGCUGGGUUGAGAGGGCGA); hsa-miR-145 (GUCCAGUUUUCCCAGGAAUCCCU). [score:1]
The most abundant miRNAs associated with mitochondria of HEK293 and HeLa were hsa-miR-423-5p, hsa-miR-320a and let-7 family members (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7h and let-7i) followed by hsa-miR-103b, hsa-miR-140-3p, hsa-miR-744, hsa-miR-107 (Figure 4C, Figure 4D, Table S3). [score:1]
The levels of following miRNAs were determined from 10 ng cDNA using U6 snRNA (Accession number: X59362) and 5 S rRNA (NCBI Accession no: V00589) as endogenous control using miRCURY LNA™ Universal RT microRNA PCR, SYBR Green master mix (Exiqon, Denmark): hsa-let-7b (UGAGGUAGUAGGUUGUGUGGUU); hsa-let-7g (UGAGGUAGUAGUUUGUACAGUU); hsa-miR-107 (AGCAGCAUUGUACAGGGCUAUCA); hsa-miR-181a (AACAUUCAACGCUGUCGGUGAGU); hsa-miR-221 (AGCUACAUUGUCUGCUGGGUUUC); hsa-miR-320a (AAAAGCUGGGUUGAGAGGGCGA); hsa-miR-145 (GUCCAGUUUUCCCAGGAAUCCCU). [score:1]
hsa-miR-10a, hsa-miR-128, hsa-miR-1307, hsa-miR-140-3p, hsa-miR-185, hsa-miR-196a, hsa-miR-25, hsa-miR-320a, hsa-miR-330-3p, hsa-miR-340, hsa-miR-423-5p, hsa-miR-629 and hsa-miR-744 significantly associated with the mitochondria of HEK293. [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 13
Hypoxia suppressed miR-320 expression through HIF-1 α and increased the expression of neuropilin 1 (NRP1) and promoted the motility and tube formation ability of endothelial cells via vascular endothelial growth factor (VEGF) signaling pathway, resulting in tumor angiogenesis [41]. [score:7]
miR-320 was downregulated in OSCC-derived cell-lines and tissue specimens, with its expression correlating inversely with the vascularity. [score:6]
[1 to 20 of 2 sentences]
56
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
Meanwhile, miR-320 is able to inhibit HL-60 cell proliferation by suppressing receptor 1 (TfR-1; CD71) [72], and miR-181a was believed to act as an intrinsic antigen sensitivity “rheostat” during T cell development [73]. [score:6]
MiR-320, miR-181a, miR-30a-3p and let-7 were shown to be downregulated in colorectal cancer [74]. [score:4]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 13
For instance, TUBG1 is inhibited by mir-152, STMN1 is inhibited by mir-210, LRRFIP2 and UNG are inhibited by mir-214, GCN1L1 is inhibited by mir-221, RPL37 is inhibited by mir-381, and PIGN is inhibited by mir-320a and mir-653. [score:13]
[1 to 20 of 1 sentences]
58
[+] score: 13
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
[1 to 20 of 1 sentences]
59
[+] score: 12
Expression of miR-320 was up-regulated in the diabetic rat mo del, impairing angiogenesis by repressing IGF-I expression [15]. [score:8]
IGF-I was downregulated by miR-320 in myocardial microvascular endothelial cells of type 2 diabetic rats. [score:4]
[1 to 20 of 2 sentences]
60
[+] score: 12
The 4 miRNAs, including miR-195–5p, miR-199a-3p, miR-320a, and miR-374a-5p, were shown to be upregulated by a factor greater than two-fold. [score:4]
Although the roles of miR-320a and miR-374–5p have been reported in many different types of cancer, there are no direct reports of these miRNAs in osteosarcoma to date. [score:2]
Four plasma miRNAs including miR-195-5p, miR-199a-3p, miR-320a, and miR-374a-5p were significantly increased in the osteosarcoma patients. [score:1]
In addition, circulating miR-195-5p and miR-199a-3p were correlated with metastasis status, while miR-199a-3p and miR-320a were correlated with histological subtype. [score:1]
miR-320a showed significantly higher levels in the osteoblastic patients than the chondroblastic ones (Fig. 5C), while circulating levels of miR-199a-3p was significantly decreased in patients with osteoblastic subtype (Fig. 5D). [score:1]
No significant difference in levels of miR-320a and miR-374a-5p were observed between the two groups. [score:1]
The AUC was 0.9029 for miR-195–5p (95% confidence interval [CI], 0.8602–0.9456) (Fig. 3A), 0.9025 for miR-199a-3p (95% confidence interval [CI], 0.8658–0.9392) (Fig. 3B), 0.9188 for miR-320a (95% confidence interval [CI], 0.8857–0.9519) (Fig. 3C), and 0.9173 for miR-374a-5p (95% confidence interval [CI], 0.8855–0.9492) (Fig. 3D). [score:1]
In this study, miR-195–5p and miR-199a-3p were correlated with metastatic status, and miR-320a and miR-199a-3p were correlated with osteoblastic subtype. [score:1]
[1 to 20 of 8 sentences]
61
[+] score: 11
The expression levels of nine miRNAs, such as miR-16, miR-92a, miR-130b, miR-21, miR-320, and miR-106b, were significantly upregulated in the PDV group (Fig 1C and 1E). [score:6]
Although we emphasized the expression of miR-21 in this study, we also observed a significant increase in the expression of miR-16, miR-92a, miR-130b, and miR-320. [score:5]
[1 to 20 of 2 sentences]
62
[+] score: 11
Namely, hsa-miR-22, a cell growth inhibitor, hsa-miR-181b, hsa-miR-320 and hsa-let-7e, all tumor suppressor miRNAs, were all upregulated in the first 6 h post-infection as part of the host-cell immune response to the virus. [score:8]
Among them are hsa-miR-22, hsa-miR-181b and hsa-miR-320 that were overexpressed at 6 and 12 h post-infection as part of the host immune response to the virus. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 11
MiR-320a is implicated in CRC due to its ability to suppress cell proliferation by targeting β-catenin [54]. [score:4]
The expression of miR-320a can be used to evaluate the risk of CRC metastasis due to its ability to bind directly to the 3′-UTR of neurophilin (NRP-1), a co-receptor of vascular epithelial growth factor [55]. [score:2]
Although the miRs-320a/b are also enriched in EpCAM-Exos, they are more enriched in A33-Exos, especially miR-320a (TPM value 3801.67, 2.28 log [2] ratio fold change relative to CL representation). [score:1]
This analysis revealed the prominence in all three EVs of members from the following families: let-7 (12/12 members observed, let-7a/b/c/d/e/f/g/i, miR-98-5p), miR-181 (6/6, miR-181a-1/a-2/b-1/b-2/c/d), miR-30 (6/6, miR-30a/b/c-1/c-2/d/e), miR-320 (7/8, miR-320a/b-1/b-2/c-1/c-2/d-1/d-2), miR-8 (5/5, miR-141, miR-200a/b/c and miR-429), miR-17 (6/8, miR-106a/b, miR-17, miR-18a, miR-20a and miR-93), miR-192 (2/2, miR-192 and miR-215) and miR-25 (3/4, mir-25 and mir-92a/b). [score:1]
Of these, miRs-19a-3p, -19b-3p, the miR-378 family (miRs-378a-3p, -378c and -378d), -107 and the miR-320a/b predominate. [score:1]
The presence of miR-320a in plasma has been reported as a potential biomarker for the early detection of CRC [44]. [score:1]
There are 6 miRNAs common to the three LIM1863-dervided EVs - let-7a-3p*, let-7f-1-3p*, miR-451a, miR-574-5p*, miR-4454 and miR-7641 and 6 exosome miRNAs that enable discrimination between sMVs (miR-320a/b/c/d, miR-221-3p, and miR-200c-3p); we also report one miRNA (miR-98-5p) observed in sMVs but not in A33- or EpCAM-Exos. [score:1]
[1 to 20 of 7 sentences]
64
[+] score: 10
From these, they discovered that inhibition of miR-1246, miR-196b-5p, and miR-320a, which were upregulated in infected cells, could prevent cell death. [score:6]
miR-320 is an anti-angiogenic factor that inhibits endothelial cell growth and migration 51. [score:3]
However, miR-320a, along with other members of the miR-320 family (miR-320b, -320c, and -320d) increased in abundance during infection. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 10
The relative expression level of each miRNA was calculated using the 2 [−ΔΔCt] method, in which each miRNA is quantified relative to the expression of one reference miRNA, chosen among hsa-miR-324-5p (ID 000539), hsa-miR-320a (ID 002277) and hsa-miR-330-3p (ID 000544) according to the target miRNA level of expression, and a calibrator sample. [score:7]
e. m. value of hsa-miR-137, hsa-miR-376c-3p, hsa-miR-203a-3p and hsa-miR-146a-5p relative expression level in two series of biological replicates from the first microfluidics arrays (five control and five FD hOE-MSCs) and the second arrays (four healthy control and four FD hOE-MSCs), respectively normalized by hsa-miR-320a (for both hsa-miR-137 and hsa-miR-376c-3p), hsa-miR-330-3p and hsa-miR-324-5p. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 10
miRNA Tested cellsChange inexpression Target genes Putative functions Reference miR-17 CD4+ T lymphocytes ↑TGFBR2, PTEN,BCL2L11, CDKN1A Proliferation and activation of T cells[73]miR-34amiR-155miR-346Demyelinatingplaques ↑ CD47 Stimulation of myelin phagocytosis[72] miR-132 B lymphocytes ↑ SIRT1Increased production ofpro-inflammatory cytokines[74] miR-320a B lymphocytes ↓ MMP9 Disturbance of HEB permeability[75] miR-340 CD4+ T lymphocytes ↑ IL4Shift of the balance of Th2/Th1cytokines towards Th1 cytokines[67] Target genes of some miRNAs, whose expression is changed during MS development, were identified in B and CD4+ T cells. [score:10]
[1 to 20 of 1 sentences]
67
[+] score: 9
Inhibition of miR-320 in insulin resistance 3T3-L1 adipocytes was found to improve insulin sensitivity and insulin-stimulated glucose uptake via modulation of p85 expression, phosphorylation of Akt and GLUT4 protein levels [91]. [score:5]
A further study reported miR-320 along with fifty other was upregulated in response to hyperglycemia and hyperinsulinemia in 3T3-L1 adipocytes [91]. [score:4]
[1 to 20 of 2 sentences]
68
[+] score: 9
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
[1 to 20 of 1 sentences]
69
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
MicroRNAs are known to regulate the chaperone network in several conditions including cerebral ischemia; miR-320 has been demonstrated to regulate HSP20 transcripts during cardiac injury [66] and miR-1 is known to target HSP72 mRNAs in cardiac ischemia [67]. [score:5]
MicroRNA miR-1 has also been documented to directly target IGF1 transcripts in cardiac and skeletal muscle [72], as have miR-320 and miR-206 in a rat mo del of myocardial infarction [73]. [score:4]
[1 to 20 of 2 sentences]
70
[+] score: 9
FOXM1 is targeted by miR-1260 and miR-320, which were downregulated in our analysis, suggesting abnormal (increased) FOXM1 expression in DLBCL. [score:8]
MiRs identified in this analysis include miR-320, 34a, 155, 21 and miR-210, which have been previously reported as potential biomarkers in other cancers such as osteosarcoma, lung cancer, breast cancer, myeloid leukemia, high-grade glioma, colon cancer and hepatoma [13– 19]. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
The potential targets of the miRNAs listed above are c-IAP-1 and MCL1, which are important for tumor cell survival following treatment, while miR-23a, miR-30a, miR-30e, miR-203, miR-320 and miR424 are known to target BCR-ABL [48– 52]. [score:5]
Increased miR-124, miR-128-1, miR-194, miR-219–5p, miR-220a and miR-320 expression are associated with increased risk in AML, however the role of microRNAs in the development of AML is unclear [101]. [score:4]
[1 to 20 of 2 sentences]
72
[+] score: 9
Meanwhile, heat shock factor 1-regulated HuR and let-7/miR-320 could contribute to the translation of β-catenin through down-regulation of lincRNA-p21 expression [19]. [score:9]
[1 to 20 of 1 sentences]
73
[+] score: 8
There has been reports showing that miR-320 is down regulated in several tumor types [12– 15], and one of miR-320 ‘s downstream effects was inhibiting cell proliferation by targeting transferrin receptor 1 (CD71) in human leukemia cell line HL-60 [19]. [score:6]
Additionally, it is known that miR-320 suppresses the stem cell like characteristics of prostate cancer cells by down regulating the Wnt/beta-catenin signaling pathway [20]. [score:2]
[1 to 20 of 2 sentences]
74
[+] score: 8
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
199900), and hsa-miR-320a (catalog no. [score:1]
At 70% confluency, cells were transfected with 100 n m LNA against miR-30bcd, miR-320a, or miR-101*. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 8
For instance, miR-378 inhibits insulin signaling by targeting p110α in hepatocytes of ob/ob mice [47], and miR-320 decreases insulin sensitivity in 3T3-L1 adipocytes by targeting the p85 unit of PI3K [48]. [score:7]
Ling H. Y. Ou H. S. Feng S. D. Zhang X. Y. Tuo Q. H. Chen L. X. Zhu B. Y. Gao Z. P. Tang C. K. Yin W. D. Changes in microRNA (miR) profile and effects of miR-320 in insulin-resistant 3T3-L1 adipocytes Clin. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 8
Among these, the over -expression of miR-21, miR-34a, miR-155, miR-320 and the under -expression of miR-122, miR-181a, miR-199a, miR-200a were reported by more than one publication. [score:5]
miRNA Chromosome location Dysregulation References miR-122 18q21.3 Decreased/Increased 52, 103 miR-125b 11q24.1 Decreased 103 miR-126 9q34.3 Decreased 98 miR-155 21q21.3 Increased 31, 99 miR-181a 1q32.1 Decreased 52, 100 miR-199a 1q24.3 Decreased 99, 100 miR-200a 1p36.33 Decreased 100, 103 miR-21 17q23.2 Increased 52, 102 miR-217 2p16.1 Increased 91 miR-320 8p21.3 Increased 100, 103 miR-34a 1p36.22 Increased 52, 103 miR-375 2q35 Increased 101 miR-486 8p11.21 Increased 100 let-7b 22q13 Decreased 52 miRNA is a known regulator of Kupffer cell response to. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 7
Furthermore, re -expression of miR-320a [17], miR-375 [18], and miR-342 [19] could restore tamoxifen sensitivity by inhibiting their targets. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
The down-regulated miRNAs were highly enriched for LCL specific miRNAs (miR-155, let-7a-i, miR-21, miR-142, miR103, miR-320, miR-146a-b) and the up-regulated miRNAs were highly enriched for iPSC specific miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, miR-18a). [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Comparison of 5p and 3p expression among 50 top-ranked miRNAs found in primary human chondrocytes demonstrated that three miRNAs, miR-320a, miR-28 and miR-103a-2, showed expression of their 3p arm only and four miRNAs, miR-199b, miR-98, miR-186 and miR-16-1, expressed their 5p arm only. [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
Eighteen miRNAs, including miR-34b, miR-326, miR-432, miR-548c-3p, miR-570, and miR-603, were drastically and constantly downregulated in GH adenomas, whereas only miR-320 was significantly upregulated. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
To date, only two miRNAs, miR-320a and miR-373, have been demonstrated to regulate gene expression in the nucleus through targeting the promoter regions of protein-coding genes [10] [11]. [score:6]
However, recent studies have reported that a few miRNAs, such as miR-320, miR-373 and miR-29b, localize to or function in the nucleus [9]– [11]. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 7
The lower levels of gene expression and NOX activity may be interpreted by enhanced regulation of miR-320a expressed in the kidney. [score:6]
Interestingly, the allele A increases the potential of hybridization between CYBA and miR-320a by 4.3 kcal/mol. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 7
MiRNA-378 and miRNA-101 target the MAPA1 signaling while miRNA-483-5p, miRNA-320, miRNA-22 affect AKT-3, and BCL9L signaling to develop tuberculosis infection (Zhang et al., 2013). [score:3]
Altered expression of miRNA-365, miRNA-483-5p, miRNA-22, miRNA-29c, miRNA-101, and miRNA-320 are reported in tuberculosis and affect the mitogen-activated protein kinases (MAPK) and transforming growth factor beta (TGF-β) signaling to develop tuberculosis infection (Zhang et al., 2013). [score:3]
Alteration in miRNA-378, miRNA-483-5p, miRNA-22, miRNA-29c, miRNA-101, and miRNA-320 are specific for pulmonary tuberculosis and non-tuberculosis infections. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 7
The four studies considered for the comparison, including the present study, demonstrated the higher expression in naïve B-cells of mir-320, the up-regulation of mir-181b, mir-25, miR-130b in GC B cells as well as the greater expression of both mir-29a and seven members linked to the cluster miR-17/92 in mature B cells. [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
Among those upregulated, we may mention hsa-miR-17-5p, hsa-miR-320, hsa-miR-652, while the downregulated miRNAs were hsa-miR-15a, hsa-miR-16, hsa-miR-23a/b, and hsa-miR-200c [119]. [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
The top 8 downregulated (hsa-miR-200c, hsa-miR-212, hsa-miR-29a, hsa-miR-532, hsa-miR-141, hsa-miR-1, hsa-miR-363, hsa-miR-187) and 8 upregulated (hsa-miR-487, hsa-miR-452, hsa-miR-1233, hsa-miR-92a, hsa-miR-106b, hsa-miR-1290, hsa-miR-320, hsa-miR-26a) miRNAs were presented in Figure 1A. [score:7]
[1 to 20 of 1 sentences]
87
[+] score: 7
MicroRNA-320 inhibits osteosarcoma cells proliferation by directly targeting fatty acid synthase. [score:5]
miR-320 regulates tumor angiogenesis driven by vascular endothelial cells in oral cancer by silencing neuropilin 1. Angiogenesis. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 7
This identified three candidate normalizers: miR-320a, miR-92b-3p and miR-486-5p that were expressed at stable levels across all inflammatory patient groups with levels varying by <20% (Fig. 2A). [score:3]
The best normalizer for our dataset was a combination of miR-320a and miR-486-5p (while miR-92b-3p was excluded because its levels fell below the detection limit of qPCR in many individuals). [score:1]
While miR-92b-3p was below the level of detection in 22/89 patients, the optimal normalizer (by NormFinder stability value 37) was the average Cp of miR-320a and miR-486-5p. [score:1]
The mean Cp of the miR-320a and miR-486-5p is shown in each group and was selected as an internal normalizer for the miRNA qPCR array dataset. [score:1]
Interestingly, miR-320a and miR-486-5p were included in the 5 best miRNAs for least concentration variations in plasma and/or serum in a recent detailed study of blood miRNAs (with n = 12 individuals) by an independent group 9, suggesting that these miRNAs may be useful endogenous normalizers. [score:1]
[1 to 20 of 5 sentences]
89
[+] score: 6
MiR-320a acts as a prognostic factor and Inhibits metastasis of salivary adenoid cystic carcinoma by targeting ITGB3. [score:4]
Human ITGB3 has been shown to be regulated by different human miRNAs including miR-98 (Ni et al., 2015), miR-320a (Sun et al., 2015), let-7c (Zhao et al., 2014), and let-7a (Müller and Bosserhoff, 2008). [score:2]
[1 to 20 of 2 sentences]
90
[+] score: 6
In comparison with uninfected reads, highly expressed aae-mir-23, aae-mir-576 and aae-mir-320 were upregulated in CHIKV-infected Ae. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
For example, miR-199b-5p-levels are significantly higher in UPS as compared with leiomyosarcoma, while miR-320a is upregulated in leiomyosarcoma, whilst being downregulated in UPS [48]. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
[1 to 20 of 2 sentences]
93
[+] score: 6
Recent studies on miRNAs have shown that the expression levels of different miRNAs, such as miR-21, miR-320, miR-498, miR-106a and miR-200c correlate with the probability of recurrence-free survival in CRC stage II-III. [score:3]
Schepeler and colleagues [103] showed that miR-320 or miR-498 expression was significantly associated with progression-free survival in stage II CRC. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 6
Scatter plots showing the number of miRNAs targeting an mRNA (Y axis) versus the correlation between miRNAs and mRNA expression (Y axis) for selected miRNA families within the integrated data set for neuroblastoma (a) the let-7 family and (b) and mir-302 family, and human immune cells (c) the let-7 family and (d) the mir-320 family. [score:5]
In some cases, there is limited evidence of a greater effect, such as in the plots of the mir-302 family in the neuroblastoma data set (Figure 5b) and the mir-320 family in the human immune cells data set (Figure 5d). [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 6
They function by binding to target sites in 3'' UTRs of messenger RNAs (mRNAs) to repress translation or mediate mRNA degradation, although alternative modes of action have been reported recently, such as direct transcriptional silencing of POLR3D by miR-320 [2]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Vishnubalaji R Hamam R Yue S Al-Obeed O Kassem M Liu FF Aldahmash A Alajez NM MicroRNA-320 suppresses colorectal cancer by targeting SOX4, FOXM1, and FOXQ1Oncotarget. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
In this study, five miRNAs (miR-29a, miR-29b, miR-126*, miR-127-3p, miR324-3p) were found upregulated and four (miR-188-5p, miR-25, miR-320a, miR-346) downregulated in both quiescent and active UC compared to healthy controls (Fasseu et al., 2010). [score:6]
[1 to 20 of 1 sentences]
98
[+] score: 6
By analysis of the genome-wide expression profiling of miRNAs, Yan and his colleagues showed that seven miRNAs of hsa-miR-497, hsa-miR-31, hsa-miR-355, hsa-miR-320, rno-mir-140, hsa-miR-127 and hsa-miR-30a-3p were significantly downregulated in BC [20]. [score:6]
[1 to 20 of 1 sentences]
99
[+] score: 6
However, seven miRNAs were either upregulated or downregulated in Exos when compared to whole cells: miR-16-5p, miR-21-5p, miR-200b-3p, miR-205-5p, miR-222-3p, miR-320a, miR-378-3p. [score:6]
[1 to 20 of 1 sentences]
100
[+] score: 6
Using a step-wise approach, we selected five exosomal miRNAs (miR-320c, miR-1202, miR-1225-5p, miR-1207-5p, and miR-7270) and validated miR-320 and miR1225-5p expression in the PLF of 18 CG patients by qRT-PCR. [score:3]
Mir-1225-5p showed higher expression in T4 than in T1–T3 stage CG patients, confirming the results obtained by microarray, whereas there was no difference in miR-320 levels between patient groups. [score:3]
[1 to 20 of 2 sentences]