sort by

28 publications mentioning mmu-mir-351

Open access articles that are associated with the species Mus musculus and mention the gene name mir-351. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 350
The TNF-α 3′UTR containing the mutated ssc-miR-130a-3p target sequence (TTGCACT to AACGTGA), ssc-miR-181a target sequence (TGAATGT to ACTTACA), ssc-miR-181b target sequence (TGAATGT to ACTTACA), ssc-miR-301a-3p target sequence (TTGCACT to AACGTGA), mmu-miR-130a-3p target sequence (TTGCACT to AACGTGA), mmu-miR-181a target sequence (TGAATGT to ACTTACA), mmu-miR-181b target sequence (TGAATGT to ACTTACA), mmu-miR-301a-3p target sequence (TTGCACT to AACGTGA), and mmu-miR-351-5p target sequence (CTCAGGG to GAGTCCC) were cloned into the pMIR-REPORT Luciferase vector. [score:19]
To verify the regulatory roles of miR-146a and miR-351-5p in Omp25 inhibition of TNF-α transcription, PAMs and mouse RAW264.7 cells were, respectively, transfected with an inhibitor control, miR-146a inhibitor, or miR-351-5p inhibitor, and then infected with LV-Blank or LV-Omp25, followed by LPS stimulation for 0 and 1 h. In the presence of miRNA inhibitor control, LV-Omp25 significantly decreased the levels of p-IκB, TRAF6, and IRAK1 in both PAMs and mouse RAW264.7 cells compared to LV-Blank (Figures 6C,D), yet the presence of miR-146a inhibitor significantly reduced the inhibitory effects of LV-Omp25 on these molecules in PAMs (Figure 6C). [score:15]
Omp25 Induces miR-146a and miR-351-5p to Inhibit the Transcription of TNF-α via Targeting TRAF6 and IRAK1Given Omp25 upregulates miR-146a and miR-351-5p, which inhibit TRAF6 and IRAK1 expression in PAMs or mouse RAW264.7 cells, we examined directly whether or not Omp25 expression affects the levels of TRAF6 and IRAK1 in PAMs and mouse RAW264.7 cells. [score:15]
Herein, we further identified miR-181a and miR-301a-3p to be involved in the posttranscriptional regulation of TNF-α in both Omp25-expressed PAMs and mouse RAW264.7 cells, yet found that Omp25 specially induced miR-130a-3p to inhibit TNF-α expression in porcine macrophages, and Omp25 specially induced miR-351-5p to inhibit TNF-α expression in murine macrophages via targeting the 3′UTR of TNF-α. [score:14]
In our work, miR-351-5p was found to be upregulated by Omp25 in RAW264.7 cells to inhibit TNF-α transcription via targeting TRAF6 and IRAK1, yet in PAMs miR-351-5p was not upregulated by Omp25 to regulate TRAF6 and IRAK1. [score:12]
Given Omp25 upregulates miR-146a and miR-351-5p, which inhibit TRAF6 and IRAK1 expression in PAMs or mouse RAW264.7 cells, we examined directly whether or not Omp25 expression affects the levels of TRAF6 and IRAK1 in PAMs and mouse RAW264.7 cells. [score:11]
Downregulation of Omp25-Induced miRNAs Improves TNF-α Production and Promotes Intracellular Bacterial Clearance in WT B. suis-Infected MacrophagesNow we have shown that Omp25 expression can induce miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p in PAMs and mouse RAW264.7 cells, but whether or not the WT B. suis infection can also upregulate the expression of these miRNAs needs to be examined. [score:11]
These data demonstrate miR-130a-3p, miR-181a, miR-181b, or miR-301a-3p regulates the TNF-α expression at the transcriptional level via targeting its 3′UTR, while miR-351-5p may inhibit murine TNF-α expression both at transcriptional and posttranscriptional level. [score:10]
Taken together, the results present in here demonstrate that miR-130a-3p, miR-181a, and miR-301a-3p regulate TNF-α expression at posttranscriptional level, miR-146a regulates TNF-α expression at posttranscriptional level, whereas miR-351-5p specifically regulate mouse TNF-α expression at both transcriptional and posttranscriptional levels. [score:10]
These results suggest that miR-130a-3p, miR-181a, miR-181b, and miR-301a-3p inhibit TNF-α expression at the posttranscriptional level, while miR-146a and miR-351-5p likely inhibit TNF-α expression in transcriptional level. [score:9]
In this study, we found that the inhibition of miR-130a-3p, -181a, and -301a-3p partially blocked Om25 -induced TNF-α inhibition, while inhibition of miR-146a or miR-351-5p attenuates the inhibitory effects of Omp25 or WT B. suis on TNF-α transcription. [score:9]
showed that miR-146a inhibitor markedly decreased the inhibitory effects of Omp25 on TNF-α transcription in PAMs, while both miR-146a and miR-351-5p inhibitors significantly reduced the inhibition of Omp25 on TNF-α transcription in mouse RAW264.7 cells (Figures 6E,F). [score:9]
Further studies revealed that miR-130a-3p, miR-181a, and miR-301a-3p target to the 3′UTR region of TNF-α to restrain TNF-α production at the posttranscriptional level, whereas miR-146a and miR-351-5p transcriptionally suppress the expression of TNF-α by targeting TRAF6 and IRAK1 (Figure 9). [score:9]
In PAMs, transfection of miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p inhibitors apparently improved the relative TNF-α levels compared with the inhibitor control, but miR-181b and miR-351-5p inhibitors had no effects on TNF-α expression (Figure 7A). [score:8]
These results further confirm that Omp25 inhibits TRAF6 and IRAK1 expression in PAMs and RAW264.7 cells through upregulating miR-146a or miR-351-5p. [score:8]
To further determine the roles of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p in regulating TNF-α, cells were transfected with inhibitor control, miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, miR-351-5p inhibitor, or miRNA inhibitor mix and infected with LV-Omp25 or LV-Blank. [score:8]
Now we have shown that Omp25 expression can induce miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p in PAMs and mouse RAW264.7 cells, but whether or not the WT B. suis infection can also upregulate the expression of these miRNAs needs to be examined. [score:8]
In mouse RAW264.7 cells, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p were upregulated, while miR-125a-5p and miR-146b were downregulated (Figure 4B). [score:7]
Omp25 Upregulates miR-146a, -181a, -181b, and -301a-3p in Both PAMs and Mouse RAW264.7 Cells, but Separately Upregulates miR-130a-3p and miR-351-5p in These Two Cells. [score:7]
Notably, in PAMs transfected with a mix of miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p inhibitors, as well as in mouse RAW264.7 cells transfected with a mix of miR-146a, miR-181a, miR-301a-3p, and miR-351-5p inhibitors, the inhibitory effects of Omp25 on TNF-α induction were further attenuated, leading to the levels of TNF-α were almost close to that of LV-Blank (Figures 7A,B). [score:7]
Figure 6Omp25 -induced miR-146a and miR-351-5p inhibit the transcriptional expression of tumor necrosis factor (TNF)-α by targeting to TRAF6 and IRAK1. [score:7]
Similarly, either miR-146a inhibitor or miR-351-5p inhibitor also decreased the inhibitory effects of LV-Omp25 on p-IκB, TRAF6, and IRAK1 in mouse RAW264.7 cells (Figure 6D). [score:7]
Next, In order to verify the target molecules of miR-146a and miR-351-5p in porcine cells and murine cells, PAMs and mouse RAW264.7 cells were transfected with mimics control, miR-146a mimics or miR-351-5p mimics, and then stimulated with LPS for 24 h. In PAMs, miR-146a mimics significantly suppressed both TRAF6 and IRAK1 expression while miR-351-5p did not have any effect on either protein (Figure 5I). [score:7]
Brucella Omp25 inhibits LPS -induced TNF-α at the transcriptional levels via miR-146a (in both porcine and murine macrophages), or miR-351-5p (in murine macrophages) by targeting TRAF6 or IRAK1 to inhibit the activation of NF-κB signaling pathway. [score:7]
At the posttranscriptional levels, Brucella Omp25 inhibits LPS -induced TNF-α via upregulating miR-181a and miR-301a-3p (in both porcine and murine macrophages), or miR-130a-3p (in porcine macrophages), or miR-351-5p (in murine macrophages). [score:6]
Figure 8Deficiency of Omp25 decreases B. suis -induced miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p whereas inhibition of these miRNAs upregulates tumor necrosis factor (TNF)-α and promotes the intracellular clearance of wild-type (WT). [score:6]
Above results demonstrate that Omp25 induces miR-146a in PAMs and miR-146a and miR-351-5p in mouse RAW264.7 cells, respectively, which suppresses the transcription of TNF-α via targeting TRAF6 and IRAK1 to negatively regulate NF-κB signaling. [score:6]
In this study, we found that B. suis Omp25 upregulated miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p, which was correlated with TNF-α inhibition. [score:6]
Importantly, B. suis infection induces higher levels expression of miR-146a, miR-181a, miR-181b, or miR-301a-3p in both PAMs and mouse RAW264.7 cells, yet specifically upregulates miR-130a-3p in PAMs and miR-351-5p in RAW264.7 cells, respectively. [score:6]
Omp25 Induces miR-146a and miR-351-5p to Inhibit the Transcription of TNF-α via Targeting TRAF6 and IRAK1. [score:5]
In summary, the present data in this study provide certain evidences for miRNAs (miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, and miR-351-5p) participation of Brucella Omp25 -induced TNF-α suppression in porcine and murine macrophages and demonstrate that different regulation patterns are employed by Omp25 between porcine and murine macrophages in this regulatory process. [score:5]
Altogether, these results indicate that miR-146a, miR-181a, and miR-301a-3p participate in the regulation of TNF-α in both PAMs and mouse RAW264.7 cells, whereas miR-130a-3p and miR-351-5p specifically regulate TNF-α expression in porcine and murine cells, respectively. [score:5]
In addition, we observed miR-351-5p only inhibited the expression of mouse TNF-α at the posttranscriptional level (Figure S6 in). [score:5]
Beside miR-146a, miR-351-5p has also been reported to target TRAF6 to inhibit denervation -induced muscle atrophy (41). [score:5]
Figure 7miR-146a, miR-181a, and miR-301a-3p participate in the regulation of tumor necrosis factor (TNF)-α in both porcine alveolar macrophages (PAMs) and mouse RAW264.7 cells, whereas miR-130a-3p and miR-351-5p differentially regulate TNF-α expression in porcine and murine cells. [score:5]
miR-146a, miR-181a, and miR-301a-3p Participate in the Regulation of TNF-α in Both PAMs and Mouse RAW264.7 Cells, whereas miR-130a-3p and miR-351-5p Specially Regulates TNF-α Expression in Porcine and Murine Cells. [score:5]
We found that Omp25 -induced miR-146a, miR-181a, and miR-301a-3p regulate TNF-α in both PAMs and mouse RAW264.7 cells, whereas Omp25 -induced miR-130a-3p and miR-351-5p specifically regulate TNF-α expression in porcine and murine macrophages, respectively. [score:5]
Interestingly, only miR-146a mimics inhibited the level of TNF-α mRNA in PAMs (Figure 5C), whereas both miR-146a and miR-351-5p mimics inhibited TNF-α mRNA level in mouse RAW264.7 cells (Figure 5D). [score:5]
These results demonstrate that in the process of Omp25 inhibiting TNF-α expression, miRNAs (miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p) play principal roles in PAMs, while miRNAs (miR-146a, miR-181a, miR-301a-3p, and miR-351-5p) play principal roles in mouse RAW264.7 cells. [score:5]
miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p Inhibit TNF-α Expression at Transcriptional or Posttranscriptional Levels. [score:5]
Altogether, these data demonstrate that Omp25 induces the expression of several miRNAs in PAMs and mouse RAW264.7 cells, with miR-146a, miR-181a, miR-181b, and miR-301a-3p being commonly upregulated in both PAMs and mouse RAW264.7 cells compared to miR-130a-3p and miR-351-5p, which are specific for PAMs and mouse RAW264.7 cells, respectively. [score:5]
Considering that miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p might participate in the negative regulation of TNF-α production in Omp25 -expressing cells, we measured the expression of these miRNAs in PAMs and mouse RAW264.7 cells after LV-Omp25 infection. [score:4]
Figure 5Upregulation of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p blocks LPS-stimulated TNF-α production. [score:4]
In PAMs and mouse RAW264.7 cells, we examined the 17 miRNAs expression profiles by Q-PCR assay, some of which have been reported to regulate NF-κB signaling, including miR-146a, miR-146b, miR-155, and miR-351-5p. [score:3]
These results demonstrate that miR-146a and miR-351-5p can repress LPS -induced TNF-α production through targeting same molecules in cells from different species. [score:3]
In mouse RAW264.7 cells, both miR-146a mimics and miR-351-5p mimics showed an obvious inhibitory effect on TRAF6 and IRAK1 (Figure 5J). [score:3]
Given above results, we reasoned that miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p likely play crucial roles in the Omp25 inhibition of LPS -induced TNF-α production. [score:3]
To confirm that TNF-α is regulated at posttranscriptional level by which miRNA, we constructed reporter plasmids encoding the WT 3′UTR of porcine or murine TNF-α mRNA downstream of the firefly luciferase gene (porcine or murine TNF-α WT-3′UTR), as well as parallel plasmids containing mismatches in the predicted binding sites (miR-130a-3p, miR-181a, miR-181b, miR-301a-3p, or miR-351-5p MT-3′UTR) of the 3′UTR region (Figure S5 in). [score:2]
showed that the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p increased at 12–36 h in LV-Omp25-infected PAMs, whereas miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p showed similar changes in LV-Omp25-infected RAW264.7 cells (Figures 4C–G,I–M). [score:1]
To test this, PAMs and mouse RAW264.7 cells were transfected with miRNA control, miR-130a-3p mimics, miR-146a mimics, miR-181a mimics, miR-181b mimics, miR-301a-3p mimics, or miR-351-5p mimics, and stimulated the transfected cells with LPS for 24 h. In PAMs, transfection of the mimics of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p decreased LPS -induced TNF-α, except miR-351-5p (Figure 5A). [score:1]
In RAW264.7 cells, transfection of the mimics of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p decreased LPS -induced TNF-α (Figure 5B). [score:1]
However, miR-351-5p only decreased the level of relative luciferase activity from murine TNF-α WT-3′UTR in contrast to miRNA mimics (Figure S6 in). [score:1]
[1 to 20 of 52 sentences]
2
[+] score: 188
The miRNA-351 inhibitor was miScript miRNA inhibitor Anti-mmu-miR-351-5p (Catalog number: MIN0000609, QIAGEN), and the negative control miRNA inhibitor was miScript Inhibitor Negative Control (Catalog number: 1027271, QIAGEN). [score:9]
Using 1.5-fold cut-off, the analysis identified seven differentially expressed miRNAs: in F28-7-A (apoptosis-fated cell), four mature miRNAs (miR-700, miR-743a, miR-140*, miR-351) were expressed at higher levels, and three mature miRNAs (miR-222, miR-34c*, miR-132) were expressed at lower levels than in F28-7 (necrosis-fated cell). [score:7]
Therefore, we hypothesize that the protein expression of lamin-B1 may be suppressed by miR-351-5p in the translational stage. [score:7]
We consider that miR-351 regulates not only the expression of lamin-B1 but also the expression of other cell-death regulators in the necrosis-apoptosis. [score:7]
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 To test whether inhibition/overexpression of these candidate miRNAs in the F28-7 cells modulate FUdR -induced cell death, we have done transfections of the miRNA inhibitors and/or the synthetic miRNA mimics. [score:7]
Next, we analyzed the inhibition of miR-351-5p in F28-7-A cells using miR-351-5p targeted miRNA inhibitor. [score:7]
In addition, we think it possible that the observed lamin-B1 depression in the miR-351 transfected cells was indirectly mediated by miR-351 targeting of other factors (e. g., translation related proteins). [score:6]
0153130.g004 Fig 4 Forty-eight hours after transfection with the negative control miRNA inhibitor (NCmiRi) or the miR-351 inhibitor (miR351i), the F28-7-A cells were treated with or without 1 μM FUdR for 21 h, and then stained with DAPI as described in. [score:5]
Higher expression of miR-351 modulates the expression of the nucleus intermediate filament lamin-B1. [score:5]
In addition, miR-351 regulates development of the nerve-system [11] and promotes muscle regeneration [12] by targeting transmembrane proteins 59 (TMEM59) and E2f3, respectively. [score:5]
Here, we showed that the “overexpression” of miR-351 in necrosis-fated cells leads to reduction of lamin-B1 expression, accompanying a shift from necrotic morphology to apoptotic morphology. [score:5]
Forty-eight hours after transfection with the negative control miRNA inhibitor (NCmiRi) or the miR-351 inhibitor (miR351i), the F28-7-A cells were treated with or without 1 μM FUdR for 21 h, and then stained with DAPI as described in. [score:5]
Exponentially growing 2×10 [5] cells were suspended in 75 μl siPORT electroporation buffer (Ambion) containing miR-351 mimic, non-silencing siRNA, miR-351 inhibitor or negative control miRNA inhibitor (final concentration 8×10 [−7] M) and introduced into a 0.1-cm gap electroporation cuvette (Bio-Rad). [score:5]
To test if an higher expression of miR-351 in F28-7 can modulate the expression levels of these three regulators, we investigated the protein levels of lamin-B1, cytokeratin-19, and ATF3 using western blot analysis. [score:4]
These findings suggest that miR-351 could regulate nuclear scaffold lamin-B1 expression and mediate FUdR -induced apoptosis. [score:4]
This suggests that the lamin-B1 regulation by miR-351 may reside in the translation stage. [score:4]
Of note, lamin-B1 is not a validated target of miR-351 (miRBase: http://www. [score:3]
By examining the available sequence information (miR-351-5p, accession number MIMAT0000609 in miRBase; lamin-B1 mRNA, accession number NM_010721 in NCBI), we became aware that these two RNAs may interact in the coding region of lamin-B1 mRNA, resulting in the inhibition of protein synthesis. [score:3]
Association of miR-351 and the nucleus-scaffold protein lamin-B1 expression. [score:3]
We found that the higher expression of miR-351 in F28-7 by the synthetic miR-351 mimic caused a shift from necrosis to apoptosis. [score:3]
It may be that the overexpressed miR-351 could have received exclusion or degradation in the F28-7 cells. [score:3]
0153130.g006 Fig 6By examining the available sequence information (miR-351-5p, accession number MIMAT0000609 in miRBase; lamin-B1 mRNA, accession number NM_010721 in NCBI), we became aware that these two RNAs may interact in the coding region of lamin-B1 mRNA, resulting in the inhibition of protein synthesis. [score:3]
As shown in Fig 1A–1D, miR-700, miR-743a, miR-140*, and miR-351 were expressed at higher levels in F28-7-A than in F28-7 cells. [score:3]
Higher expression of miR-351 by synthetic miR-351 mimic-transfection. [score:3]
These observations indicate that the expression of miR-351 plays a key role in FUdR -induced apoptosis. [score:3]
Our results demonstrated that the high miR-351 expression shifts FUdR -induced necrotic morphologies into apoptotic morphologies. [score:3]
Thus, a transfection of miR-351 inhibitor shifted the FUdR -induced apoptotic morphology into necrotic morphology in the apoptosis-fated F28-7-A cells. [score:3]
We explored the morphology of the F28-7 cells possessing high miR-351 expression on treatment with FUdR. [score:3]
Transfection of miR-351 inhibitor in F28-7-A shifts the FUdR -induced cell-death morphology from apoptosis to necrosis. [score:3]
The expression level of miR-351 in F28-7 cells significantly decreased in a time -dependent manner. [score:3]
Higher expression of miR-351 shifts the FUdR -induced cell death morphologies from necrosis to apoptosis. [score:3]
As shown in Fig 4, the miR-351 inhibitor -transfected cells underwent a typical necrotic morphology (cell swelling; indicated by the arrowhead) at 21 h after treatment with FUdR. [score:3]
We found that a higher expression of miR-351 in the FUdR -treated death-destined cell caused a shift from the necrosis to apoptosis. [score:3]
Quantitative real-time PCR analyses performed for total small RNA fraction in F28-7 at 48, 56, and 64 h after the transfection indicated that the synthetic miRNA mimic-treatment resulted in a higher expression of the miRNA-351 (Fig 2A). [score:3]
Conversely, transfection of an miR-351 inhibitor into F28-7-A resulted in a switch from apoptosis to necrosis. [score:3]
Expression of (A) miR-700, (B) miR-743a, (C) miR-140*, (D) miR-351, (E) miR-222, (F) miR-34c*, (G) miR-132, and RNU6B were analyzed by quantitative real-time PCR using primers for miR-700-3p, miR-743a-3p, miR-140-3p, miR-351-5p, miR-222-3p, miR-34c-3p, miR-132-3p, and RNU6B (see ). [score:2]
We thus identified a new regulator of the cell death, the microRNA miR-351. [score:2]
Here, we show that the miR-351 can participate in regulating cell death morphology. [score:2]
The expression efficacy of miR-351 became more than 100-fold at 48 h in miR-351 mimic -transfected F28-7 cells, compared to that in the non-silencing siRNA -transfected cells. [score:2]
Therefore, we assumed that the miR-700, miR-743a, miR-140*, miR-351, miR-222, and miR-132 were candidate miRNAs as cell-death regulators in necrosis and apoptosis. [score:2]
The miR-351 belongs to the miR-125 family, and is shown to perform various roles in cell development, cell death, cancer and inflammation [32– 35]. [score:2]
Modulation of FUdR -induced necrosis and apoptosis, by miR-351. [score:1]
org/) that the miR-351-5p has a seed sequence with "UCCCUGAG" near its 5'-end. [score:1]
We further demonstrate an association of miR-351 and mitochondrial events (including mitophagy and mitochondrial DNA synthesis) in FUdR -induced cell death. [score:1]
As shown in Fig 2B, the transfection of miR-351 mimic into the F28-7 cells did not change the cell viability. [score:1]
MicroRNA-351 (miR-351) is one of the interferon beta (INFβ)-inducible mRNAs, and is known to promote cellular antiviral activities [10]. [score:1]
At 48, 56, and 64 hours after the transfection, the levels of miR-351-5p and RNU6B (an internal standard) were analyzed by quantitative real-time PCR. [score:1]
It would be important to further investigate possible management of lamin-B1 expression by miR-351. [score:1]
In addition, FUdR -induced ATF3 induction was not affected by the transfection of miR-351 mimic (Fig 5B). [score:1]
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 Total small RNA fractions were prepared from F28-7 and F28-7-A cells (no drug, no incubation). [score:1]
Bioinformatic analysis shows that the miR-351-5p binding sequence “CUCAGGG” is not present in 3’-UTR of lamin-B1 mRNA sequence. [score:1]
In addition, either the non-silencing siRNA alone or the miR-351 mimic alone had no effect on the cell morphology; i. e., the morphology-change required subsequent FUdR-treatment (Fig 3A, upper diagram). [score:1]
In addition, microscopic observation showed that the distribution of cell morphologies was 10% normal, 10% necrosis, and 80% apoptosis in the miR-351 transfected F28-7 cells. [score:1]
The miRNA-351 mimic was Syn-mmu-miR-351-5p miScript miRNA mimic (Catalog number: MYS0000609, QIAGEN), and the nonsilencing siRNA was AllStars Negative Control siRNA (Catalog number: 1027280, QIAGEN). [score:1]
0153130.g005 Fig 5 (A) At 48 hours after transfection with the vehicle, non-silencing siRNA (NSsi) or the mature miR-351-5p mimic (miR351m), the F28-7 cells were examined by western blotting for anti-lamin-B1, cytokeratin-19, and GAPDH. [score:1]
Possible association site for miR-351-5p and lamin-B1 mRNA. [score:1]
0153130.g002 Fig 2(A) F28-7 cells were transfected with nonsilencing siRNA (NSsi), and with mature miR-351-5p mimic (miR351m). [score:1]
In contrast, the synthetic miR-351 mimic -transfected cells showed a typical apoptotic morphology; the chromatin condensation and the cell bleb (Fig 3A, at the bottom). [score:1]
We confirmed, by western blot analysis for high mobility group box 1 (HMGB1) in culture medium, a known indicator of necrotic cell death [24, 25], that the leakage of HMGB1 from nucleus to culture medium in FUdR -induced necrosis became almost null by the transfection of miR-351 mimic (Fig 3B). [score:1]
The miRNA-351, a species-specific microRNA, is found only in mouse and rat. [score:1]
It is known that miRNA-351 and miR-125a, members of a human miRNA family, play a critical role in mitochondrial autophagy (mitophagy) and erythropoiesis [36– 38]. [score:1]
At this point of treatment, the cell viability was 23% (n = 3) with the vehicle, 21% (n = 3) with the non-silencing siRNA, and 20% (n = 3) with the miR-351 mimic transfection (Fig 2B). [score:1]
As shown in Fig 5A, the transfection of miR-351 mimic in F28-7 led to reduction of lamin-B1 protein without any reduction of cytokeratin-19. [score:1]
We became aware that this miR351-5p's possible binding region is present in lamin-B1 mRNA (1904–1911, CUCAGGGA) (Fig 6). [score:1]
The GAPDH protein levels as a control showed no change by the transfection of miR-351 mimic (Fig 5A and 5B). [score:1]
0153130.g003 Fig 3 (A) At 48 hours after transfection with the vehicle, non-silencing siRNA (NSsi) or the mature miR-351-5p mimic (miR351m), the F28-7 cells were treated with or without 1 μM FUdR for 21 h, and then stained with DAPI. [score:1]
We also plan to investigate miR-351 functions in these two types of cell death processes by use of F28-7 and F28-7-A cells having equal miR-351 expression levels. [score:1]
The 10% necrosis in this experiment might have been caused by unsuccessful transfection of the miR-351 mimic, or by degradation of the transfected miRNA. [score:1]
[1 to 20 of 68 sentences]
3
[+] score: 46
Potential target transcripts, which mature sequences for mir-24-2, mir-26a, and mir-351 might be repressing, were predicted and rather than considering targets individually, scores were combined multiplicatively to identify potential transcripts that might be synergistically repressed by all three (Table 4), a method that penalizes targets where one or more scores are abnormally low. [score:7]
As the second best target, Dystrophin was targeted most robustly by mir-351 (TargetScan score = −0.45). [score:7]
Several putative miRNA probe sets correspond to known miRNAs mir-24-2, mir-351, mir 26a-2, mir-92-2 and mir-7-2. According to these probes, miRNAs mir-24-2, mir-351, and mir-26a-2 were potentially upregulated in differentiating myoblasts, while mir-92-2 and mir-7-2 loci were downregulated (Table 3). [score:7]
We observed that three known miRNAs, mir24-2, mir-351, and mir-26a-2 were upregulated in myoblasts and showed robust expression. [score:6]
In all, our results concerning mir24-2, mir-351, and mir-26a-2 upregulation in myoblasts represent added evidence for miRNA based regulation of myogenic genes and suggest that deeper involvement of ncRNAs in myogenesis will be revealed. [score:5]
We were interested in identifying predicted co-repression of target transcripts by all three mature miRNAs observed in C2C12s (mir24-2, mir-351, and mir-26a-2), reasoning that they might act in concert to exert effects on transcripts comparable to much more highly expressed miRNAs that are solitary actors such as mir-206. [score:5]
Finally, mir-351 was upregulated in myoblasts at levels 108-fold over ES. [score:4]
Top 10 predicted targets for synergistic repression by mir-24, mir-26a, and mir-351. [score:3]
The function of mir-351 and this region is unknown, but mir-351 has been observed in SAGE tags derived from embryonic heart [60]. [score:1]
mir-351 is potentially part of a miRNA cluster with mir-503 and mir-322 lying within 2 kb upstream, with numerous ESTs mapped in this region supporting this possibility. [score:1]
[1 to 20 of 10 sentences]
4
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition to the targeting sites for miR-155, miR-181b, and miR-361, the 3′ UTR of mouse Aicda mRNA also contains the putative target sites for miR-125a, miR-351, miR-92b, miR-26a, and miR-103 (identified by using miRNA -targeting prediction tools: TargetScan. [score:9]
Likewise, HDI upregulated miR-351 expression by up to 16.5-fold. [score:6]
Figure 8The Prdm1 targeting miRNAs miR-23b, miR-125a, miR-351, miR-30a/c/d, miR-182, miR-96, miR-98, miR-200b/c, and miR-365 are upregulated by HDI. [score:6]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
miR-125a and miR-351 contain the same seed sequence as miR-125b, and therefore potentially target Prdm1 3′ UTR at the same site as miR-125b. [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 6 sentences]
5
[+] score: 19
Eight miRNAs (miR-351, -762, -210, -145, -486, -339, -34c, and -155) were substantially up-regulated (b), and nine miRNAs (miR-129-5p, -150, -375, -203, -239-3p, -449a, -383, -1907 and -409) were substantially down-regulated in OIR retinas (c). [score:7]
Among the thirteen miRNAs that showed significantly up-regulated in P17 OIR retinas, eight of them (mmu-miR-351, -762, -210, -145, -486, -339, -34c and -155) were mature miRNAs as shown in the heat map (Fig. 2a) with their specific expression fold changes shown in a bar graph (Fig. 2b). [score:6]
In addition, Arora et al. 56 reported that mmu-miR-125, which contain identical seed sequence region as mmu-miR-351, was strongly expressed in the inner plexiform layer in developing mouse retina, and in the inner and outer nuclear layers in adult retinas, suggesting that mmu-miR-351 might be expressed in retinal neurons, including photoreceptors. [score:5]
Among these, mmu-miR-351 displayed the greatest increase of approximately 2.4-fold (log [2] ratio was ∼1.25) (Fig. 2a,b and Table 1). [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 18
Furthermore the magnitude of downregulation in scrapie-infected versus mock-infected cells of mmu-miR-351 and mmu-miR-542-5p was comparable to that estimated by ultra-deep sequencing. [score:4]
However, the regulation of the more abundantly expressed miRNAs mmu-miR-351 and −542-5p was confirmed by qRT-PCR, indicating to a high validity of the ultra-deep sequencing (Figure 2). [score:4]
Among these, twofold downregulation of mmu-miR-351 and mmu-miR-542-5p was confirmed by qRT-PCR. [score:4]
Future studies that will focus on the identification of putative targets of miR-351 and miR-542-5p need to be carried out to reinforce the significance of our results. [score:3]
Interestingly, four of those miRNAs, namely mmu-miR-351, mmu-miR-503, mmu-miR-503*, and mmu-miR-542-5p are located in a genomic cluster within 5 kb on the mouse X-chromosome. [score:1]
The relative expression levels of mmu-miR-503, mmu-miR-503*, mmu-miR-351 and mmu-miR-542-5p was determined in a stem-loop based quantitative real-time PCR (qRT-PCR) assay (TaqMan MicroRNA Assay, Applied Biosystems) according to the supplier's instructions. [score:1]
Four of those miRNAs, namely mmu-miR-351, mmu-miR-503, mmu-miR-503*, and mmu-miR-542-5p, are clustered in a miRNA dense region on the mouse X-chromosome. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 18
These results indicate that miR-497, miR-351 and miR-31 may serve as mediators of neutrophilic inflammation by targeting genes that regulate neutrophil recruitment to the airways; predicted targets of each miRNA are listed in Additional file 9: Table S6. [score:6]
The trans-eQTL locus shared by miR-322 and miR-503 was also weakly associated with the expression of miR-351 and miR-497 (p [adjusted] < 0.1). [score:3]
In the second approach, we constructed putative miRNA/mRNA regulatory networks and identified three miRNAs (miR-497, miR-351 and miR-31) as candidate master regulators of genes associated with neutrophil recruitment. [score:3]
For the set of genes that were positively correlated with neutrophils (n = 674 at FDR < 0.1), we identified miR-497, miR-351 and miR-31 as candidate regulatory hubs (Fig.   7). [score:2]
The bioinformatic analysis we conducted to identify miRNAs that may act as key regulators of genes involved in granulocyte (eosinophil and neutrophil) recruitment pointed to three miRNAs of interest for neutrophils, namely miR-497, miR-351 and miR-31. [score:2]
We identified three miRNAs, miR-497, miR-351 and miR-31, that are candidate master regulators of genes associated with neutrophil recruitment. [score:2]
[1 to 20 of 6 sentences]
8
[+] score: 17
Two overexpressed miRNAs (mmu-miR-351 and mmu-miR-672) show the most target mRNAs of 8 (degree 8). [score:5]
We also determined that the expression of Mlycd (malonyl-CoA decarboxylase) can be suppressed by mmu-miR-15a and mmu-miR-351. [score:5]
Coasy (Coenzyme A synthase) was predicted to be the target gene of mmu-miR-652 and mmu-miR-351. [score:3]
Mmu-miR-31, mmu-miR-351, mmu-miR-672, mmu-miR-339-3p, mmu-miR-138, mmu-miR-210, mmu-miR-25, and mmu-miR-322 were found to be more prominent and may play crucial roles in the regulatory network for their degree were more than 5. 10.1371/journal. [score:2]
Mmu-miR-31, mmu-miR-351, mmu-miR-672, mmu-miR-339-3p, mmu-miR-138, mmu-miR-210, mmu-miR-25, and mmu-miR-322 were found to be more prominent and may play crucial roles in the regulatory network for their degree were more than 5. 10.1371/journal. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 15
Among the list, members of the miR-29 family, miR-203, miR-762, and miR-1224, showed upregulation, whereas members of the miR-107 family, miR-127 and miR-130a/b, miR-342-3p, miR-351, miR-379, miR-455, and miR-467a, were downregulated in both strains. [score:7]
miR-351 is detected during myogenic progenitor cell differentiation and inhibits E2f3 expression, a key regulator of cell cycle progression and proliferation [48]. [score:6]
These miRNAs include miR-29a/b, miR-100, miR-107, miR-130b, miR-193b, miR-343-3p, miR-351, and miR-455. [score:1]
These miRNAs include miR-107, miR-127, miR-130a/b, miR-145, miR-342, miR-351, miR-379, miR-455, and miR-467. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 13
a) 6d-8d, b) 8d-12d, c) 12d-15d, d) 15d-21d, e) 21d-P6, f) P48-h6 To further validate these differentially expressed miRNAs identified from the mouse ovary, the expression levels of miR-199a, miR-470, miR-871, miR-34c let-7a, miR-7a, miR-351, miR-191 were further examined in different size follicles (i. e., 100 μm −130 μm, 200 μm -280 μm, 450 μm -550 μm, 500 μm -600 μm) using qRT-PCR assay. [score:4]
D) Expression profile of mmu-mir-351 in sequencing data. [score:3]
During superovulation, mmu-mir-351, mmu-mir-30c, mmu-miR-26a, mmu-mir-25 expressed extensively as already reported by Fiedler et al. using microarray technology [50]. [score:3]
d) Expression profile of miR-351 through qRT-PCR. [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 12
Based on predicted targets of microRNAs and our germ cell mo del predictions, we identified several candidate microRNAs that may repress gene expression during meiotic initiation and progression, including the X-linked mmu-miR-351. [score:5]
Studies have revealed that mmu-miR-351 was ubiquitously expressed in many adult mouse tissues, including the testis and ovary. [score:3]
All these microRNAs are located on autosomes except mmu-miR-351, which was X-linked and predicted to inhibit oocyte genes. [score:3]
Our result indicates that mmu-miR-351 might play a conserved role in pre-meiotic oocytes. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 7
Another key regulator is the KRAB/KAP1-miRNA regulatory cascade, which acts as an indirect repressor of mitophagy genes in mice as well as in human cells, probably by the down and up regulation of a series of miRNAs, such as miR-351 that targets Nix (Barde et al., 2013). [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 7
Thereby, we enlarged the list of highly potential targets of miRNAs implicated in skeletal myoblast differentiation foremost miR-155, miR-206, miR-322-3p/-5p, miR-335-3p/-5p, miR-351, and miR-532-3p/-5p. [score:3]
In contrast, miR-351 targets were functional in the extracellular matrix such as matrix metalloproteinase Mmp12 or Adam17 (S6F Table). [score:3]
S6 TableEnrichment analysis of signal transduction pathway associations of (A) miR-206-3p, (B) miR-322-3p, (C) miR-322-5p, (D) miR-335-3p, (E) miR-335-5p, (F) miR-351-5p, (G) miR-503-5p, (H) miR-133a-3p/miR-133b-3p, (I) miR-155-5p. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 6
In the mouse embryo at Theiler Stage 14, for example, we observed the expression of mir-133a-2 and mir-351 in heart ventricle. [score:3]
Similarly, longSAGE tags also suggest the expression of two human (mir-7-1 and mir-125a) and three mouse (mir-331, mir-351, and mir-495) miRNAs that have not been experimentally confirmed (Table 1). [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 5
Furthermore, we found that Ews/Ewsr1 deficiency reduces the expression of Uvrag (UV radiation resistance associated) gene at the post-transcription level via mmu-miR-125a and mmu-miR-351 [29]. [score:3]
Interestingly, the reduction of Uvrag by mmu-miR-125a and mmu-miR-351 impaired autophagy function in Ewsr1 knockout (KO) MEFs and KO mice. [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 5
Adenylated transcripts associated with the mir322 host gene accumulate in the mMtr4KDThe above analyses identified two significant peaks of adenylation on chromosome X corresponding to a full length non-coding cDNA (RIKEN-C43009B03RIK) containing a miRNA cluster (mir322-mir503-mir351). [score:1]
The top diagram shows the mir322 - mir503 – mir351 cluster and associated RIKEN transcripts on chromosome X. Note that the chromosomal orientation has been reversed such that the mm9 chromosomal coordinates are in decreasing order from left to right because the transcripts are on the minus strand. [score:1]
The above analyses identified two significant peaks of adenylation on chromosome X corresponding to a full length non-coding cDNA (RIKEN-C43009B03RIK) containing a miRNA cluster (mir322-mir503-mir351). [score:1]
In the case of mir322, the 3′ fragment will contain two additional microRNAs, mir503 and mir351, which may subsequently influence the fate of that fragment (discussed below). [score:1]
Although we cannot completely rule out that the mir322-mir503-mir351 cluster is more actively transcribed upon mMTR4 depletion, even a 2-fold increase would seem too small to explain the large, 67-fold increase in adenylated mir322 5′ leader by a mechanism of increased transcription alone. [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 4
MicroRNA-351 inhibits denervation -induced muscle atrophy by targeting TRAF6. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 4
The quantitative PCR results revealed that the relatively expression level of miR-192-5p was 25- and 200-fold higher than that of miR-351-5p and miR-802-5p, respectively (Figure 4D). [score:3]
The average read counts of miR-192-5p, miR-351-5p and miR-802-5p were 14,281, 219 and 12, respectively, and representing the high, middle and low abundance levels for the identified miRNAs (Supplementary Table 2). [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
The analysis showed miRNAs that were related to ER stress pathway (let-7f, miR-351, miR-127, miR-133a, miR-195, miR-214 and miR-503), suggesting CASP3, CASP7, XBP1, ATF6 and ATF4 as possible target genes for these miRNAs (Table 4). [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
The results showed that the expression of miR-322 and miR-351 was increased significantly with the duration of hypoxia exposure (Fig. 1b). [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
The module around miR-351 included, among others, proteins such as CBS (cystathionine β-synthase), MMP11 (matrix metalloproteinase 11) and NEU1 (lysosomal sialidase 1). [score:1]
Nevertheless, miR-351 proposed as aging biomarker by the same study - but not further experimentally validated – was shown to have significant synergy effect on aging process (miR-125b-5p/-351 pair appeared on the 112 [th] rank) and was incorporated in consensus modules. [score:1]
Nevertheless, the same study identified miR-351 as age -dependent but - as stated by the authors - it was not chosen for validation experiments. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 3
The microRNAs that were validated included: hsa-miR-16; mmu-let-7f; mmu-miR-351; has-miR-150; has-miR-425; hsa-miR-196a; hsa-miR-138; and mmu-miR-155 (Applied Biosystems, Foster City, CA). [score:1]
These included miR-150, miR-351, miR-16, let-7, miR-34, and miR138. [score:1]
They included miR-425, miR-196a, miR-155, miR-150, miR-351, miR-16, let-7f, miR-34c, miR-138a, and miR-21. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 2
Ten miRNAs, miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351. [score:1]
Similar analysis of “late” group, including c-Maf, Ets1, N-Myc, Nfat5, and Nfib, yielded 10 miRNAs: miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351, with multiple connections. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 1
Additionally, miR-23a [15], miR-24 [16], miR-26 [17], miR-27a [18, 19], miR-27b [20], miR-29 [21], miR-124 [22], miR-128a [23], miR-146b [24], miR-148a [25], miR-155 [26], miR-181 [27], miR-199 [28], miR-186 [29], miR-214 [30], miR-221/222 [31], miR-351 [32], miR-486 [33], miR-489 [34], miR-499 [35] and miR-3906 [36] are reported to be involved in skeletal myogenesis. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
The expression of mature miRNAs was assayed using TaqMan MicroRNA Assays (Applied Biosystems, Foster City, CA) specific for hsa-miR-486 (ID 001278), hsa/mmu-miR-21a (ID 000397), hsa-miR-455 (ID 001280), hsa-miR-151-3p (ID 002254), mmu-miR-1a (ID 002222), mmu-miR-133b (ID 002247), mmu-miR-5128 (ID 462199_mat), mmu-miR-223 (ID 002295), mmu-miR-146b (ID 001097), mmu-miR-133a (ID 001637), mmu-miR-449a (ID 001030), mmu-miR-122 (ID 002245), mmu-miR-351-3p (ID 464446_mat), mmu-miR-193a-5p (ID 002577), mmu-miR-151-3p (ID 001190), mmu-miR-574-3p (ID 002349), mmu-miR-3107/486 (ID 001278). [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
These include miR-24, miR-30e, miR-351, miR-26a and miR-27a (Figure 4; Additional file 4). [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Mice with loxP sites surrounding the microRNA cluster 24 (which includes miR-322, miR-503, and miR-351) were crossed to mice with a tamoxifen inducible Cdh5 Cre driver (Cdh5-CreERT2) (Sup. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
The four rodent-specific miRNAs—mmu-miR-351, mmu-miR-434, mmu-miR-467a, and mmu-miR-682—were excluded from further studies. [score:1]
[1 to 20 of 1 sentences]