sort by

16 publications mentioning cel-lsy-6

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name lsy-6. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 71
Our synergistic data corroborate this idea in an in vivo context and demonstrate that the COMPASS complex acts before the birth of the ASE neurons, providing a potential molecular link between the early Notch signal, the expression of tbx-37/38 and the ASEL specific expression of lsy-6. Together, these histone-modifying complexes may form part of a lineage-specific “chromatin mark” that acts, in cohort with specific TFs to bias lsy-6 expression, such that it is only expressed in ASEL. [score:8]
The early lineage determination of ASE left-right asymmetry led us to postulate the existence of either an “asymmetry mark” that can be remembered through several rounds of division to regulate expression of the miRNA lsy-6 expression or a cascade of TFs that leads from tbx-37/38 to lsy-6 [12]. [score:6]
The most upstream component of the previously described network of laterality factors is the ASEL-expressed miRNA lsy-6. We find that lsy-6 expression is lost upon abrogation of various COMPASS components (Figure 7C and Table S3). [score:5]
This Notch -mediated signal results in a differential and transient expression of a pair of paralogous T-box genes, tbx-37/38 [13], and then, several rounds of cell division later, in the expression of the miRNA lsy-6 in the ASEL, but not the ASER neuron [12]. [score:5]
Consistent with such a notion we find that on examining ASEL, partial removal of hlh-14, through RNAi in animals that express two distinct markers for ASEL fate simultaneously, sometimes leads to loss of one but not the other marker (13/28 embryos in which ASEL was still present, as assessed by a lsy-6::yfp reporter, lost ceh-36::mCherry expression) suggesting the ASE cell is still produced but fails to differentiate correctly. [score:4]
Previous work from our lab has identified a MYST-type histone acetylase complex that controls ASEL/R asymmetry through regulation of the lsy-6 miRNA [33] and in this study we have shown that the histone methyltransferase complex COMPASS also regulates ASE laterality through regulation of lsy-6 (Figure 7). [score:4]
D: Graphs indicating the left-right ASE expression of gcy-5 [prom]::gfp (ntIs1) in lsy-6 overexpressing, rbbp-5(tm3463) and double-mutant animals. [score:4]
As such, it provides a potential molecular link between the early Notch-signal, tbx-37/38 expression and ASEL-specific lsy-6 expression in the maturing ASE neurons. [score:4]
All together, this data demonstrates that rbbp-5 and the COMPASS complex acts early during embryogenesis, before the birth of the ASE neurons and in conjunction with the MYST complex to regulate the expression of the miRNA lsy-6 and therefore ASE laterality. [score:4]
Brown asterisks indicate that the COMPASS histone-modifying complex, also identified in this paper, acts earlier than che-1 and before the birth of the ASE neurons to regulate lsy-6 expression and control ASE asymmetry. [score:3]
Through analysis of known and novel mutants in components of this complex we show that the COMPASS complex acts during embryogenesis, before the birth of the ASE neurons, to regulate lsy-6 expression. [score:3]
Through genetic epistasis analysis, we have found the earliest trigger of asymmetry to be the expression of the lsy-6 miRNA [16]. [score:3]
The lsy-6 miRNA has been uncovered through genetic screens for mutants in which the expression of ASEL- and ASER-specific chemoreceptors is disrupted [14]. [score:3]
The COMPASS complex acts during embryogenesis and upstream of the miRNA lsy-6 to regulate ASE lateralityTo determine when and where COMPASS acts to regulate ASE asymmetry we focused on rbbp-5 and generated several reporter gene and rescue constructs. [score:3]
Overexpression: OH7805 otIs204 Is[ceh-36 [prom2]::lsy-6, elt-2 [prom]::gfp]. [score:2]
C: Graphs indicating the left-right ASE expression of lsy-6 in wild-type and COMPASS complex mutants. [score:2]
Previous genetic screens have revealed that a MYST-type histone acetyltransferase (HAT) complex also shows ASE laterality defects that are indistinguishable from those of the COMPASS histone methyltransferase (HMT) complex, in that the ASEL neurons convert into ASER neurons and that lsy-6 expression is lost in the post-mitotic ASE neurons [33]. [score:2]
The COMPASS complex acts during embryogenesis and upstream of the miRNA lsy-6 to regulate ASE laterality. [score:2]
Moreover, the “2 ASEL” fate inducing activity of lsy-6, expressed from a heterologous promoter, is epistatic to the loss of COMPASS activity (rbbp-5 mutants), corroborating the notion that COMPASS acts upstream of lsy-6 (Figure 7D and Table S3). [score:2]
The molecular basis for this bistability is a double -negative feedback loop of transcription factors and at least one miRNA, the above-mentioned lsy-6 miRNA (Figure 1C; [16], [17]). [score:1]
Table S3COMPASS complex genes regulate ASE asymmetry upstream of the microRNA lsy-6. Detailed scoring of COMPASS complex component RNAi or mutant animals. [score:1]
[1 to 20 of 21 sentences]
2
[+] score: 47
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-1, cel-mir-48, cel-mir-84, cel-mir-241
In addition, the loss of vps-52 suppresses the precocious phenotypes of a reduced function hbl-1 mutant, increases the misregulation of the miRNA -targeted gene let-60 during vulva development, as well as enhances the defective gene silencing activity of an hypomorphic lsy-6 mutant in the ASEL neuron. [score:7]
In the ASEL neuron, the reduced expression of the lsy-6 targeted gene cog-1 leads to a subsequent gene regulatory cascade that activates ASEL-specific gene expression. [score:7]
While the hypomorphic lsy-6(ot150) mutation induced a mild penetrant loss of expression of this reporter (Figure 3B) [45], the loss of vps-52 in lsy-6(ot150) mutants augmented the absence of reporter expression in ASEL (11% vs 47%; Figure 3B). [score:5]
This result suggests that vps-52 gene function facilitates the activity of the lsy-6 miRNA in silencing cog-1 expression that subsequently contributes to the establishment of ASEL-specific gene expression. [score:5]
The loss of vps-52 in distinct sensitized genetic backgrounds induces the reiteration of the miRNA-controlled proliferative seam cell division program, enhances the let-7-related lethal phenotype, exacerbates the abnormal vulval development associated to the lessened miRNA-regulation of the let-60 gene, as well as augments the defective expression of a reporter of the lsy-6 miRNA activity in the ASEL neuron. [score:5]
In wild type (WT) animals, gene silencing mediated by the lsy-6 miRNA leads to GFP expression in the ASEL neuron (arrowheads). [score:3]
Impairment of the miRNA activity in vps-52(qbc4); lsy-6(ot150) mutant blocks reporter expression. [score:3]
In order to address if GARP fulfills a restricted or broad modulatory activity on miRNA function, we then studied the regulation of ASEL neuron development by the lsy-6 miRNA. [score:3]
Thus, a transcriptional fluorescent reporter of lim-6 (lim-6p::GFP) serves as an indicator of achieved lsy-6 -mediated cog-1 silencing, when its expression is switched on in ASEL [44]. [score:2]
In contrast, complete absence of lsy-6 activity causes the total loss of expression of the reporter from the ASEL neuron [44]. [score:2]
In particular, the lsy-6 -mediated silencing of cog-1 expression leads to transcriptional derepression of lim-6 [44]. [score:2]
B) Analysis of the lsy-6 -mediated ASEL-specific gene expression. [score:2]
The lsy-6 miRNA promotes the adoption of a unique cell fate by the ASEL chemosensory neuron. [score:1]
[1 to 20 of 13 sentences]
3
[+] score: 42
A major determinant of the exclusive gene expression programs in these two neurons is the ASEL-specific expression of the lsy-6 miRNA and the resulting down-regulation of its target, cog-1. Animals completely lacking lsy-6 fail to down regulate COG-1 in ASEL, and, as a consequence, ASEL neurons in lsy-6(ot71) null mutants adopt an ASER cell fate [63]. [score:11]
Because lsy-6 -mediated regulation of cog-1 expression is dosage -dependent, we speculate that lin-42(lf) mutations suppress neuronal cell fate specification defects by de-repressing lsy-6 transcription in ASEL neurons. [score:6]
Because lsy-6 -mediated cell fate specification is established during embryonic development, we conclude that lin-42 functions throughout development and is critical for multiple miRNA -mediated developmental processes. [score:4]
Mutations in lsy-6 result in animals that fail to express the ASEL-specific cell fate reporter Plim-6::GFP. [score:3]
lin-42 suppresses neuronal phenotypes associated with lsy-6 miRNA -mediated cell fate specification. [score:3]
1004486.g003 Figure 3 lin-42 suppresses neuronal phenotypes associated with lsy-6 miRNA -mediated cell fate specification. [score:3]
While the alg-1(ma192) mutation alone does not alter Plim-6::GFP expression in ASEL, combining alg-1(ma192) with lsy-6(ot150) results in a dramatic increase in ASEL to ASER cell fate mis-specification (Figure 3B). [score:3]
These phenotypes can be monitored by a failure to express the Plim-6::GFP transcriptional reporter in ASEL in lsy-6 mutants (Figure 3A). [score:2]
While 13% of animals harboring only the lsy-6(ot150) allele fail to maintain Plim-6::GFP in ASEL, the penetrance of this phenotype is partially suppressed in lin-42(ma206); lsy-6(ot150) double mutants (Figure 3B), suggesting that lin-42 may play a modulatory role in neuronal cell fate specification. [score:2]
As with the suppression of alg-1(ma192) heterochronic phenotypes, reducing lin-42 function significantly restores normal ASEL cell fate specification in lsy-6(ot150); alg-1(ma192) animals (Figure 3B). [score:2]
To further explore a potential role for lin-42 in assuring proper neuronal cell fate specification, we developed a more sensitive assay for the lsy-6 -mediated repression of cog-1. As previously mentioned, alg-1(ma192) mutants display defects in variety of miRNA -mediated processes, including developmental timing [49]. [score:1]
Importantly, lsy-6 -mediated repression of cog-1 is dosage -dependent; weak alleles of lsy-6, such as ot150, under-accumulate lsy-6 miRNA as a consequence of reduced lsy-6 transcription and result in a partially penetrant ASEL-to-ASER cell fate transformation phenotype (Fig. 3B) [64]. [score:1]
The ot150 allele of lsy-6 has been used in a variety of contexts as a sensitized genetic background to identify gene products that function in the miRNA pathway [65]– [67]. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 33
[Rh]dextran-([as-2'OMe] lsy-6) [1 ]was highly effective in inhibiting lsy-6. At the injection concentration of only 3 μM, the compound inhibited lsy-6 with nearly 100% penetrance, assayed by the repression of gcy-7 [prom] ::gfp expression in ASEL (Figure 7a), and by the induction of ectopic gcy-5 [prom] ::gfp expression in ASEL (Figure 7b). [score:7]
In order to score the inhibition of lsy-6 activity, we used two reporter strains expressing GFP in either ASEL (gcy-7 [prom] ::gfp, strain OH3191) or ASER (right ASE; gcy-5 [prom] ::gfp, strain OH3192). [score:4]
The lsy-6 microRNA regulates left-right asymmetry of ASE neurons, a pair of chemosensory neurons that share many bilaterally symmetrical features, yet differ in their ability to discriminate different ions by expressing distinct sets of chemoreceptors of the gcy gene family [18]. [score:3]
Among four miRNAs tested (lin-4, lsy-6, let-7 and mir-42), the dose of antisense reagents required for the effective inhibition of individual miRNA varied from as low as three micromolar (lsy-6 and mir-42) to as high as tens of micromolar (let-7). [score:3]
In order to test whether these antisense reagents can be used combinatorially to inhibit more than one miRNAs at a time, we coinjected [Rh]dextran-([as-2'OMe] lsy-6) [1 ]and [Rh]dextran-([as-2'OMe] lin-4) [1 ]into gonads of OH3192 strain (gcy-5 [prom] ::gfp). [score:3]
In order to test whether these conjugated antisense agents can be used to inhibit other miRNAs in worms, we prepared [Rh]dextran-([as-2'OMe] lsy-6) [1 ]and [Rh]dextran-([as-2'OMe] let-7) [1 ]using the same procedure as for making [Rh]dextran-([as-2'OMe] lin-4) [1]. [score:3]
Figure 7Inhibit lsy-6 in neuronal cells with a dextran conjugated antisense reagent. [score:2]
In contrast, [Rh]dextran-([as-2'OMe] lin-4) [1 ]alone did not alter the expression pattern of gcy-5 [prom] ::gfp, and [Rh]dextran-([as-2'OMe] lsy-6) [1 ]by itself failed to cause Egl (Figure 11). [score:2]
Figure 11Concurrent inhibition of lin-4 and lsy-6 in Caenorhabditis elegans with two antisense reagents. [score:2]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3'For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. [score:1]
Rhodamine-dextran ([Rh]Dextran) or its conjugates of antisense 2'- O-methyl oligoribonucleotides against let-7, lin-4, lsy-6, mir-237 were injected into gonads of N2 worms at three different concentrations. [score:1]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3' For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. [score:1]
These two dextran conjugates were designed to block lsy-6 and let-7, respectively, two miRNAs of known functions in C. elegans. [score:1]
[1 to 20 of 13 sentences]
5
[+] score: 20
Loss of mir-52 does not enhance the ability of ectopically-expressed lsy-6 to regulate its target, cog-1.. [score:6]
Loss of mir-52 partially suppressed mutant lim-6::gfp expression in (ot149lf)/lsy-6(ot150rf): 85% of rf/lsy-6lf worms displayed mutant lim-6::gfp expression compared to 61% of mir-52;rf/lsy-6lf (Figure 3B). [score:6]
The syIs63 transgene was used to monitor cog-1 repression in the presence of ectopic expression driven from the otEx1450 transgene array expressing cog-1 [prom]::lsy-6 [hairpin] as described in Johnston and Hobert (2003) [14]. [score:4]
Representative fluorescent image of cog-1::gfp::cog-1 transgene expression in (A) wild type worms and (B) worms with cog-1::lsy-6 transgene with corresponding DIC images (C and D, respectively). [score:2]
85% of these (ot149lf)/lsy-6(ot150rf) heterozygous worms fail to express lim-6::gfp in the ASEL neuron compared to 100% of (ot149lf) and 14% of (ot150rf) worms (Figure 3B; [14]). [score:1]
lsy-6. The mir-51 family members, mir-52 and mir-54/55/56. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 19
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-48, cel-mir-84, cel-mir-237, cel-mir-241
The null allele of lsy-6 causes a highly penetrant cell fate transformation phenotype, where the ASEL neuron adopts the cell fate of the ASER neuron, which is detected by loss of expression of the ASEL marker lim-6. The lsy-6(ot150) allele is a nonnull (hypomorphic) point mutation 111 nt upstream of the lsy-6 hairpin, which disrupts a cis-regulatory element required for lsy-6 expression. [score:6]
stau-1(tm2266) animals do not exhibit any ASE neuron cell fate defects since all the animals have lim-6 expression only in the ASEL neurons, yet the phenotype of lsy-6(ot150) animals is significantly suppressed by stau-1(tm2266) (Figure 1G). [score:4]
It should be noted that our results to date indicate that STAU-1 can inhibit the activity of let-7 family, lsy-6, and perhaps lin-4 miRNAs, but further studies are required to test for similar roles of STAU-1 in opposing the activity of other miRNAs. [score:3]
We show that stau-1 loss-of-function mutation does not appreciably affect the levels of mature miRNAs; in particular, there was no detectable change, in stau-1 mutants, of the levels of the lin-4, let-7 family, and lsy-6 miRNAs whose function we monitored phenotypically in our genetic interaction experiments. [score:2]
These results indicate that loss of function of stau-1 can potentiate the activity of lsy-6, suggesting that the role of STAU-1 as a negative modulator of miRNA activity is not restricted to miRNAs of the heterochronic pathway. [score:1]
lsy-6 is known to regulate the asymmetric cell fate decision in ASE neurons (Johnston and Hobert 2003). [score:1]
lsy-6(0) indicates the null allele of lsy-6; lsy-6(ot150) is a partial loss-of-function mutation. [score:1]
The third sensitized genetic background that we employed is a lsy-6 miRNA hypomorphic mutant. [score:1]
[1 to 20 of 8 sentences]
7
[+] score: 14
lsy-6 microRNA expression in the ASEL cell down-regulates cog-1, the primary determinant of the ASER cell fate, thereby allowing specification of the ASEL fate [36]. [score:5]
By contrast, the alg-1(anti) mutations we describe here cause severe developmental defects consistent with dramatic impairment of let-7-Family microRNA activity, impair functions of other microRNAs including lsy-6 and mir-35-Family, and result in lethality in combination with alg-2(0), consistent with broad defects in the activity of additional microRNAs. [score:3]
lsy-6(ot150) mutants lack the Plim-6::gfp expression in the ASEL neurons some of the time. [score:2]
Using the ASEL-specific transgenic reporter, Plim-6::gfp [36], [38], (Figure 6A), and the lsy-6(ot150) sensitized background, we tested for effects of the alg-1 mutations on the lsy-6(ot150) phenotype. [score:1]
lsy-6 is a microRNA that regulates cell fate specification of two bilaterally symmetric neurons, ASEL and ASER [36]. [score:1]
These data show that an alg-1(anti) mutation reduces the function of lsy-6 microRNA, and does so more severely than alg-1(0) (Figure 6A), similar to the effect of alg-1(anti) on the heterochronic phenotypes. [score:1]
lsy-6(ot150) is a hypomorphic allele that alters a conserved cis-regulatory element in the lsy-6 promoter and reduces but does not eliminate lsy-6 microRNA function [37]. [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 14
lsy-6, mir-55, and mir-56 showed no significant changes in their expression levels, whereas lin-4, mir-48, and mir-84 were upregulated. [score:6]
Similar expression levels for lsy-6, mir-55, and mir-56 were observed between the two stages; on the other hand, lin-4, mir-48, and mir-84 were upregulated in the L4 stage. [score:6]
Development -associated miRNAs in C. elegans (lin-4, mir-48, mir-84, lsy-6, mir-55, and mir-56) and two controls (snoRNA U18 and mir-159a) were detected via CE-SSCP analysis after the dye-labeling reaction. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 11
Similarly, we analyzed ASE soma size lateralities in two different genetic contexts in which both neurons are transformed to the ASEL fate ('2 ASEL'; as assessed by gcy chemoreceptor gene expression), namely in animals carrying loss of function mutation in the ASER inducers cog-1 and in transgenic animals that ectopically express the ASEL-inducer lsy-6 bilaterally in both ASE neurons. [score:5]
We used animals carrying loss-of-function mutations in the ASEL inducers die-1 (a Zn finger transcription factor) and lsy-6 (a miRNA), and transgenic animals in which the ASER-inducer cog-1 (a homeobox gene) is ectopically expressed in both ASE neurons. [score:4]
That is, the '2 ASEL size' phenotype of either cog-1(-) or lsy-6 misexpression is reverted to the '2 ASER size' phenotype in a die-1(-) background. [score:2]
[1 to 20 of 3 sentences]
10
[+] score: 10
In contrast to the highly selective expression and function of the lsy-6 microRNA in a pair of chemosensory neurons, the miR-58 family functions in a large number of cells and tissues to restrict expression of PMK-2 in non-neuronal tissues at all developmental stages. [score:6]
For example, the lsy-6 microRNA regulates the development of left/right asymmetry through the specific repression of its target in one of two ASE chemosensory neurons [29]. [score:4]
[1 to 20 of 2 sentences]
11
[+] score: 10
Specifically, the lsy-6 miRNA targets the cog-1 mRNA, resulting in a shift of marker gene expression in the left ASE to resemble marker gene expression in the right ASE [20]. [score:7]
Three miRNA genes had been mutated in genetic screens, lin-4, let-7, and lsy-6 [2, 4, 20]. [score:1]
To uncover subtle abnormalities in the miRNA mutant strains will require more detailed analyses, as has been performed for lin-4, let-7, lsy-6, mir-48, mir-84, and mir-241. [score:1]
The C. elegans lsy-6 miRNA acts in the asymmetric differentiation of the left and right ASE chemosensory neurons. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 10
Other miRNAs from this paper: cel-let-7, cel-mir-1, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, cel-mir-58b, mmu-let-7j, mmu-let-7k, cel-mir-58c
In ASEL, lsy-6 suppresses cog-1, itself a suppressor of ASEL cell fate (37). [score:4]
The p lim-6::GFP reporter specifically drives expression of GFP in ASEL, enabling quantification of lsy-6 function and associated miRISC components by visualizing ASE cell fate (17, 38, 39)(Supplementary Figure S3). [score:3]
Figure 2. pab-1 and pab-2 genetically cooperate with let-7 and lsy-6 miRNAs. [score:1]
During embryogenesis, the lsy-6 miRNA controls ASE cell fate differentiation into left (ASEL) and right (ASER) asymmetric neurons (37). [score:1]
Worm strains used: N2 Bristol (WT), pab-2 (ok1851), let-7 (n2853), MH2636 (otIs114(Plim-6::GFP, rol-6(d)), lsy-6(ot150)), FD01(pab-2(ok1851), otIs114(Plim-6::GFP, rol-6(d)), lsy-6(ot150)), FD02(pab-2(ok1851), otIs114(Plim-6::GFP, rol-6(d))). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 6
Because lsy-6 is expressed in a small subset of chemosensory neurons [28], and our systematic investigation of neuronal miRISCs did not discriminate between neuronal subtypes, this method may not be sensitive enough identify miRNAs that are expressed in a small subset of neurons. [score:3]
1003592.g004 Figure 4 A. Bar graph representing the relative abundance of miRNAs enriched in the asynchronous neuronal miRISC IP, with a p<0.01 determined by a student's t-test (* except miR-1 and lsy-6). [score:1]
However, our data did not show a statistically significant enrichment of lsy-6, a known neuron-specific miRNA (p<0.15). [score:1]
A. Bar graph representing the relative abundance of miRNAs enriched in the asynchronous neuronal miRISC IP, with a p<0.01 determined by a student's t-test (* except miR-1 and lsy-6). [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 3
While we did not detect 21 of the previously reported miRNAs (we suspect that most of these undetected miRNAs may not actually encode miRNAs at all [23, 29] or may be annotated incorrectly; detailed results are shown in), we did obtain 125 clones of a very rare miRNA, lsy-6, expressed in only one pair of neurons in the C. elegans head [30]. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 2
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In C. elegans, lin-4 and let-7 act in developmental timing, and the microRNA lsy-6 controls neuronal asymmetry [19]. [score:2]
[1 to 20 of 1 sentences]
16
[+] score: 2
Using MosSCI, we constructed two transgenic animals carrying two single copy arrays under the same promoter of alg-1 expressing: 1) GFP fused to the 3'UTR of cog-1 where the lsy-6 microRNA binding site was replaced by 6 copies of RNA Box-B element and; 2) a mCherry-tagged ALG-1 (wt) or ALG-1 (TPmut) protein fused to the λN peptide. [score:2]
[1 to 20 of 1 sentences]