sort by

65 publications mentioning mmu-mir-335

Open access articles that are associated with the species Mus musculus and mention the gene name mir-335. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 240
In this study, we first reported upregulation of Hif-1α by administration of anti miR-335 in the late time of cerebral ischemia and displayed that induction of anti miR-335 at 24 hrs post-occlusion could upregulate Hif-1α expression and bring about reduction of infarct volume (Fig 4D). [score:9]
Angpt2, Bnip3, Mmp9, Pai1 and Vegfa mRNA expressions were significantly downregulated in the miR-335 mimic injection samples whereas displayed opposite expression pattern in anti miR-335 injection samples. [score:8]
By regulating Hif-1α expression, miR-335 also indirectly affects the expression of the downstream genes, which are crucial in the maintenance of cell viability and blood brain barrier integrity. [score:7]
We found that Hif-1α was significantly upregulated upon OGD while miR-335 demonstrated significant downregulation. [score:7]
Indirect targets of miR-335 via Hif-1α Having known that Hif-1α is a master transcription factor in hypoxic condition, we were then interested in studying the effects on modulating miR-335 expression on the downstream genes in this eMCAo mo del. [score:6]
On the contrary, during the late time of ischemia where administration of anti miR-335 was found to be beneficial, upregulation of HIF-1α protein was seen and it subsequently increased the expression level of its downstream genes (Fig 5B). [score:6]
Thus, downregulating Hif-1α expression through miR-335 mimics, in the early time of cerebral ischemia could prove to be useful in reducing infarct volume of the eMCAo mo del. [score:6]
The expression level of miR-335 and their target, Hif-1α, in the eMCAo rat brain samples were quantitated using real time PCR. [score:5]
The primary y-axis denotes cell viability whereas the secondary y-axis indicates relative expression of Hif-1α and miR-335; (B) miR-335 expression significantly increased in the presence of miR-335 mimic (p < 0.01) and significantly decreased when cells were transfected with anti miR-335 (p < 0.01) during reperfusion. [score:5]
MiR-335 regulates Hif-1α downstream gene expression indirectlyBenita et al [6] has reported that 81 genes have the potential of being regulated by HIF-1α upon hypoxia in multiple cell types (S1 Table). [score:5]
MiR-335 directly targets Hif-1α As the master transcription factor of hypoxia, HIF-1α has been wi dely studied in different diseases and regarded as one of the major candidate for gene therapy in conditions involving hypoxia related pathology. [score:5]
The left panel demonstrates that miR-335 mimic inhibited Hif-1α mRNA expression and hence reversed Hif-1α downstream genes which resulted in reduced infarct size and edema in the early time of ischemic stroke. [score:5]
Since none of the genes has a binding site for miR-335 at their respective 3'UTRs, the changes in expression of these genes are most likely an indirect effect attributed by the regulation of Hif-1a via miR-335. [score:5]
Therefore, regulating the expression of HIF-1α by using its endogenous regulator, miR-335 could prove beneficial in stroke outcome. [score:5]
Subsequently, we found that administration of miR-335 mimic immediately after eMCAo inhibited Hif-1α expression and consequently reduced the infarct volume by 60% in ischemic stroke mo dels (Fig 4B). [score:5]
Overexpression of miR-335 in primary neuronal cells subjected to OGD significantly reduced Hif-1a expression and subsequently improved cell viability (Fig 3B–3D). [score:5]
The right panel shows that anti miR-335 inhibits miR-335 and therefore releases the respective inhibition on Hif-1α, which then activate its downstream protective genes in the late time of cerebral ischemia and subsequently leading to reduced infarct injury and infarct volume. [score:5]
Infarct volume of treated rats were expressed as a percentage of the vehicle ± SEM, n = 4. (C) Hif-1α mRNA expression significantly decreased in miR-335 mimic injection samples (p value < 0.01) whereas significantly increased when administration of anti miR-335. [score:5]
On the other hand, transfection of miR-335 mimic caused a 133.73 fold increase in miR-335 expression (Fig 3B) with a corresponding decrease in the Hif-1a mRNA expression (Fig 3B). [score:5]
To understand the interaction of miR-335 and Hif-1α in in vitro ischemic mo del, we have demonstrated that modulation of miR-335 expression could affect cell viability in an in vitro ischemic condition and this occurs via regulation of Hif-1a (Fig 3). [score:4]
MiR-335 and miR-93 directly target Hif-1α. [score:4]
Among the other novel predictions, (miR-135a, -203, -335, -338-3p and -93), miR-335 that has two binding sites on the 3'UTR of Hif-1a was found to be the most promising regulator of Hif-1a expression (Fig 2). [score:4]
MiR-335 and miR-93 directly target Hif-1α In order to establish the direct interaction of the six miRNAs, a luciferase reporter assay was performed. [score:4]
Indirect targets of miR-335 via Hif-1α. [score:4]
In this study, we have established that miR-335 can directly modulate Hif-1α gene expression in both in vitro and in vivo cerebral ischemic conditions. [score:4]
MiR-335 regulates Hif-1α downstream gene expression indirectly. [score:4]
Cell viability and Hif-1α expression in primary neuronal culture transfected with anti miR-335 or miR-335 mimic during reperfusion following OGD. [score:3]
In in vivo study, we have also observed that administration of miR-335 mimic could bring about a decrease in expression of Hif-1α and consequently a reduction in infarct volume in the early time of cerebral ischemia whereas administration of anti miR-335 could reduce infarct volume in the late time of cerebral ischemia. [score:3]
MiR-335 directly targets Hif-1α. [score:3]
The primary y-axis denotes relative expression of miR-335 whereas the secondary y-axis signifies the infarct volume; (B) TTC was used to stain coronal brain sections (2 mm thick) of rats injected with 50 pmoles of anti miR-335 or miR-335 mimic after eMCAo. [score:3]
Nonetheless, the expression of miR-335 reduced when introduction of anti miR-335 in the rat brain samples with a corresponding increase in Hif-1α mRNA (Fig 4C). [score:3]
0128432.g005 Fig 5Analyses of Hif-1α and its downstream genes expression in eMCAo rats injected with anti miR-335 and miR-335 mimic in the early and late time of cerebral ischemia. [score:3]
Infarct volume of rats treated with eMCAo + anti miR-335 or miR-335 mimic was expressed as a percentage of the vehicle ± SEM. [score:3]
MiR-335 regulates Hif-1α in primary neuronsHaving seen that miR-335 as a stronger regulator of Hif-1α, we went on to assess its effectiveness in an in vitro setting. [score:3]
of miR-335 mimics significantly increased their corresponding mature miRNA levels with a reduction in Hif-1α mRNA expression (Fig 4C). [score:3]
Changes in Hif-1a expression by the administration of either anti miR-335 or miR-335 mimic in cerebral ischemia were accompanied with the corresponding alteration of the downstream genes Angpt2, Bnip3, Mmp9, Pai1 and Vegfa (Fig 5A and 5B). [score:3]
Loss of the miR-335 and miR-93 recognition sites on the 3’UTR abolished the interactions between the miRNAs and their target (Fig 2C and 2D). [score:3]
0128432.g003 Fig 3Cell viability and Hif-1α expression in primary neuronal culture transfected with anti miR-335 or miR-335 mimic during reperfusion following OGD. [score:3]
Site-directed mutagenesis was performed to further validate the interaction of the newly established regulators, miR-335 and miR-93 with Hif-1α 3’UTR. [score:3]
Analyses of Hif-1α and its downstream genes expression in eMCAo rats injected with anti miR-335 and miR-335 mimic in the early and late time of cerebral ischemia. [score:3]
These results further confirmed miR-335 and miR-93 as direct regulators of Hif-1α and also suggested miR-335 as a stronger modulator than miR-93. [score:3]
Since Angpt2, Bnip3, Mmp9, Pai1 and Vegfa genes are also important key players in cerebral ischemia, it is possible that the overall changes in their expression synergistically contribute in bringing about the beneficial effect of miR-335 in reducing the infarct volume. [score:3]
0128432.g004 Fig 4Effects of modulation of expression of miR-335 and Hif-1α mRNA in cerebral ischemia. [score:3]
Having known that Hif-1α is a master transcription factor in hypoxic condition, we were then interested in studying the effects on modulating miR-335 expression on the downstream genes in this eMCAo mo del. [score:3]
Furthermore, Pulkkinen et al [37] also observed that miR-335 expression reduced when hypoxic condition was mediated by lack of O [2] in HUVEC cell line. [score:3]
Effects of modulation of expression of miR-335 and Hif-1α mRNA in cerebral ischemia. [score:3]
miR-335 was differentially expressed upon cerebral ischemia in our eMCAo mo del and it peaked at 24 hrs which corresponded to the maximum infarct volume (Fi 4A). [score:3]
During reperfusion following OGD, anti miR-335 and miR-335 mimic were transfected to primary neurons independently and changes in miRNA and Hif-1α expression were observed after 24 hrs reperfusion. [score:3]
Independent transfection of HeLa cells with anti miR-17/-20a/-335/-93 exhibited an increase in the relative luciferase activity, whereas introduction of miR-17/-20a/-335/-93 mimics resulted in a reduction in luciferase activity suggesting that, apart from miR-17 and miR-20a, miR-335 and miR-93 are also direct regulators of Hif-1α (Fig 2B). [score:3]
Primary neuronal cells were subjected to OGD and the changes in Hif-1α and miR-335 expression were observed. [score:3]
miR-335 mimic and anti miR-335 could regulate downstream genes of Hif-1α, such as Angpt2, Bnip3, Mmp9, Pai1 and Vegfa by modulating Hif-1α to result in beneficial outcome in the early (0 hrs) and late time point (24 hrs) of cerebral ischemia respectively. [score:2]
This suggested that miR-335 is a hypoxia-regulated miRNA. [score:2]
0128432.g006 Fig 6miR-335 mimic and anti miR-335 could regulate downstream genes of Hif-1α, such as Angpt2, Bnip3, Mmp9, Pai1 and Vegfa by modulating Hif-1α to result in beneficial outcome in the early (0 hrs) and late time point (24 hrs) of cerebral ischemia respectively. [score:2]
As miR-335 modulation could directly regulate Hif-1a and improve cell viability during OGD (in vitro), the next attempt was to investigate whether such regulation was reflected in an in vivo setting. [score:2]
It is noteworthy that none of these genes has a binding site for miR-335 at their respective 3'UTRs, yet they are known to be regulated by HIF-1α. [score:2]
Having seen that miR-335 as a stronger regulator of Hif-1α, we went on to assess its effectiveness in an in vitro setting. [score:2]
Cells transfected with miR-335 mimic during reperfusion after OGD showed significantly decreased Hif-1α expression compared to cells subjected to OGD and transfected with vehicle; (C) Neurons subjected to OGD displayed increased apoptosis and degenerated neuritis. [score:2]
We administered anti miR-335 and miR-335 mimic in vivo via ICV injection to ischemic rats immediately following eMCAo. [score:1]
During the early time of ischemia when administration of miR-335 mimic was found to be beneficial, HIF-1α protein levels were found to be low. [score:1]
MiR-335 regulates Hif-1α in cerebral ischemia in a biphasic manner. [score:1]
For anti miR-335 and miR-335 mimic treatment, 4 hrs of OGD time point was selected (as described under results section). [score:1]
MiR-335 regulates Hif-1α in cerebral ischemia in a biphasic mannerAlthough Hif-1α has been implicated as an important player in cerebral ischemia [14], its function in cerebral ischemic condition is still unclear. [score:1]
Since we had observed that administration of miR-335 mimic immediately after eMCAo significantly improved infarct volume, we next attempted to determine miR-335’s effect on the late time of cerebral ischemia. [score:1]
MiR-335 regulates Hif-1α in primary neurons. [score:1]
To assess this, anti miR-335 and miR-335 mimic were administrated independently via ICV injection in eMCAo animals at 24 hrs post-occlusion and brain samples were harvested at 48 hrs (post-occlusion). [score:1]
Administration of miR-335 mimic immediately after occlusion reduced the infarct volume by 60%, while administration of anti miR-335 did not result in any significant changes in infarct volume (Fig 4B). [score:1]
Mechanism of the reduction of infarct volume by miR-335 mimic in the early time and by anti miR-335 in the late time of cerebral ischemia. [score:1]
Furthermore, it was also found that administration of anti miR-335 at 24 hrs post-occlusion could reduce the infarct volume by 40% (Fig 4D). [score:1]
Cells subjected to OGD (and/or anti-miR-335/miR-335 mimic) were stained with Hoechst 33342 and Ethidium Homodimer III (EtHD) dye as described in the manufacturer’s protocol (Biotium, USA. [score:1]
It was observed that infarct volume was reduced by 40% upon administration of anti miR-335 at 24 hrs post-occlusion (Fig 4D). [score:1]
miR-93 was observed to share the same binding site as miR-17 and miR-20a while miR-335 had two binding sites. [score:1]
In primary neurons subjected to OGD, the introduction of anti miR-335 decreased miR-335 level by about 98% (0.02 ± 0.03; Fig 3B) and resulted in an elevation in Hif-1a mRNA (Fig 3B). [score:1]
Neurons cultured in 24-well plates were subjected to 4 hrs OGD followed by transfection with 30 nM anti miR-335 and miR-335 mimic during the reperfusion period. [score:1]
Anti-miR-335 reduces infarct volume in the late time of cerebral ischemia. [score:1]
[1 to 20 of 74 sentences]
2
[+] score: 159
It has been reported that miR-335 suppresses breast cancer metastasis by targeting SOX4 and Tenascin C [24], small cell lung cancer metastasis by targeting IGF1R and RANKL [25], and induces apoptosis of breast cancer cells by regulating ERα, IGF1R, SP1, and ID4 [26]. [score:8]
miR-335 is also involved in the induction of p53 tumor suppressor pathway by targeting Rb-1 [27], and regulates cell proliferation and differentiation of mesenchymal stem cells by targeting RUNX2 [28]. [score:8]
Mest and miR-335 are coordinately expressed during skeletal muscle development and regenerationBoth Mest and miR-335 were highly expressed in tibialis anterior (TA) muscles at postnatal day 0 (P0), and decreased gradually as mice grew up (Fig 1A). [score:6]
Although Mest [+/-] mice have miR-335 genomic locus, the expression of miR-335 was down-regulated in Mest [+/-] mice compared to WT mice (Fig 1E). [score:5]
miR-335 [+/Neo] mice showed normal body weight and expression of Mest while miR-335 [+/-] mice showed reduced body weight and expression of Mest (Figs 2H, 2I, 3D and 3E). [score:5]
Although miR-335 was co-regulated with Mest as a paternally expressed imprinted miRNA, neither body growth nor muscle regeneration was affected by deleting miR-335. [score:4]
Mest and miR-335 are coordinately expressed during skeletal muscle development and regeneration. [score:4]
In addition, while the expression of Mest was decreased in miR-335 [+/-] mice, it was not altered in miR-335 [+/Neo] mice (Fig 2H and 2I), suggesting that the region surrounding the neomycin resistance cassette flanked by loxP sites, but not the miR-335 itself, is involved in transcriptional regulation of Mest. [score:4]
0130436.g001 Fig 1 Mest and miR-335 are coordinately expressed in skeletal muscle during postnatal development and regeneration. [score:4]
Since DMD -null mice undergo repetitive myofiber degeneration and regeneration, we next examined whether Mest and miR-335 were up-regulated either in degenerating or in regenerating phases upon skeletal muscle injury induced by the administration of CTX into TA muscles. [score:4]
Mest and miR-335 are coordinately expressed in skeletal muscle during postnatal development and regeneration. [score:4]
A previous report showed that miR-335 was up-regulated in adductor muscle of mdx mice and skeletal muscle biopsy of DMD patients in common [16]. [score:4]
Although miR-335 genomic locus was left intact in the Mest [+/-] (maternal/paternal) mice, our finding that expression of miR-335 was significantly decreased in those mice lead us to examine which is responsible for the regulation of body size, Mest, miR-335, or both. [score:4]
In this study, we examined whether the Mest (Mesoderm specific transcript) gene, a paternally expressed imprinted gene that regulates body size and miR-335, a microRNA (miRNA) located in intron 2 of Mest, are involved in muscle regeneration. [score:4]
Thus, these results indicate that miR-335 is a paternally expressed imprinted miRNA. [score:3]
miR-335 [+/-] mice exhibited mild growth defects (Fig 3E), which is likely due to decreased expression of Mest in miR-335 [+/-] mice (Fig 2H). [score:3]
Expression of Mest and that of miR-335 are normalized to Gapdh and snoRNA-202, respectively. [score:3]
We found the up-regulation of Mest as well as miR-335 in TA muscles of 3 months old DMD–null compared with that of wild type (WT) mice (Fig 1B). [score:3]
These results suggest that decreased expression of Mest in miR-335 [+/-] mice, but not the deletion of miR-335 itself, causes reduced body weight. [score:3]
Similarly, miR-335 [+/-] (maternal/paternal) mice obtained by crossing male miR-335 [+/-] mice with female WT mice scarcely expressed miR-335 in skeletal muscle (Fig 2F). [score:3]
Both Mest and miR-335 were highly expressed in tibialis anterior (TA) muscles at postnatal day 0 (P0), and decreased gradually as mice grew up (Fig 1A). [score:3]
Based on these results, we concluded that Mest, but not miR-335, is involved in regulation of body size during development. [score:3]
To construct a miR-335 targeting vector, we inserted a floxed neomycin-resistance cassette (fNeo) into the miR-335 genomic locus using multisite Gateway system (Invitrogen). [score:3]
miR-335 is a paternally expressed imprinted gene. [score:3]
In contrast, expression of Pax7 was affected in miR-335 [+/Neo] mice. [score:3]
Thus, Mest and miR-335 are expressed coordinately during skeletal muscle growth and regeneration, and in the pathological condition of DMD. [score:3]
qRT-PCR analysis revealed that miR-335 [+/Neo] (maternal/paternal) mice obtained by crossing male miR-335 [+/Neo] mice with female WT mice scarcely expressed miR-335 in skeletal muscle (Fig 2E). [score:3]
The miR-335 targeting vector was linearized and introduced into TT2 ES cells by electroporation [30]. [score:3]
On the contrary, miR-335 [-/+] (maternal/paternal) mice obtained by crossing male WT mice with female miR-335 [+/-] mice expressed miR-335 in skeletal muscle comparable to WT mice (Fig 2G). [score:3]
In addition, although miR-335 [+/Neo] mice show no significant difference in number of Pax7 -positive muscle satellite cells per myofiber, the expression of Pax7 was decreased (Fig 6A and 6B). [score:3]
Interestingly, however, quantitative RT-PCR (qRT-PCR) analyses revealed that expression of miR-335 was significantly lower in Mest [+/-] than in WT mice (Fig 1E). [score:3]
Expression of Mest mRNA and that of miR-335 are normalized to Gapdh and snoRNA-202, respectively. [score:3]
We sought to determine whether miR-335 was co-regulated with Mest during postnatal development and skeletal muscle regeneration. [score:3]
For analyses of miR-335 expression, reverse transcription was performed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacture’s instructions. [score:3]
miR-335 mutant mice revealed that Mest, but not miR-335, is responsible for the control of body and muscle sizes and for the regulation of muscle growth during regeneration. [score:2]
In this study, we could not assign any roles to miR-335 in skeletal muscle development and regeneration in vivo. [score:2]
Data of miR-335 knockout mice is available on the following site: (Accession No. [score:2]
In (D), a analysis to distinguish alleles for WT (+/+), miR-335 [+/-] (+/-), and miR-335 [-/-] mice (-/-) was shown. [score:1]
miR-335 [+/Neo] mice (Accession No. [score:1]
However, more precise analyses need to be performed in order to know whether proliferation and differentiation of muscle satellite cells during muscle regeneration are affected in Mest [+/-] and miR-335 [+/Neo] mice. [score:1]
First, we generated three independent constructs of pENTR-fNeo, pENTR-5’, and pENTR-3’ with the latter two containing miR-335 genomic sequences. [score:1]
When Mest -deficient mice were generated previously, miR-335 had not been identified in the Mest locus [2]. [score:1]
The miR-335 sequence was replaced with a neomycin resistance cassette flanked by loxP sites (Fig 2A). [score:1]
For pENTR-5’ sequence of miR-335, the 8.0 kb of 5’ arm was retrieved from BAC DNA RP24-211G11 (CHORI) by using amplified DNA derived from pDONR P4-P1R. [score:1]
miR-335 [+/-] mice (+/-) were generated by crossing male miR-335 [+/Neo] mice with female CAG- cre transgenic mice. [score:1]
Mest but not miR-335 affects body growth. [score:1]
In contrast, there was no significant difference in muscle growth during regeneration induced by CTX between WT and miR-335 [+/Neo] mice and in growth of Dystrophin -deficient muscle between DMD -null and miR-335 [+/Neo] ; DMD -null mice (Fig 4A–4D). [score:1]
Removal of the neomycin resistance cassette by mating male miR-335 [+/Neo] mice to female CAG- cre transgenic mice resulted in the deletion of short flanking sequences together with the neomycin cassette (miR-335 [+/-] mice) (Fig 2C and 2D). [score:1]
0130436.g002 Fig 2(A) Design of constructs used for generation of miR-335 deficient mice. [score:1]
Thus, roles and functions of miR-335 likely vary in different contexts. [score:1]
The established mice, miR-335 [+/Neo], were crossed with CAG- cre transgenic mice to delete neomycin resistance cassette (miR-335 [+/-], Fig 2A). [score:1]
The miR-335 genomic locus was replaced by a floxed neomycin-resistance cassette (loxP-Neo-loxP) to obtain miR-335 [+/Neo] mice. [score:1]
Both Mest and miR-335 were remarkably activated in the regenerating phase but not in the degenerating phase (Fig 1C). [score:1]
We investigated whether miR-335 is also paternally expressed. [score:1]
For ENTR-3’ sequence of miR-335, the 2.5 kb of 3’ arm was amplified from BAC DNA RP24-211G11 by and cloned into the pDONR P2R-P3 using BP Clonase II enzyme. [score:1]
Generation of miR-335 deficient mice. [score:1]
Because the Mest includes miR-335 in its second intron, we examined a possibility whether miR-335 is also involved in body and skeletal muscle growth and in muscle regeneration. [score:1]
Thus, it was necessary to analyze miR-335 deficient mice to conclude that the Mest gene, not miR-335, is responsible for control of body growth. [score:1]
Therefore, these result suggest that Mest but not miR-335 is involved in skeletal muscle growth during regeneration. [score:1]
Analyses of miR-335 -deficient mice we generated would elucidate physiological or pathological significance of miR-335 in vivo. [score:1]
To distinguish roles of Mest from those of miR-335, we generated miR-335 deficient mice by homologous recombination in embryonic stem (ES) cells. [score:1]
The Mest mutant mice had been established by deleting exons 3–8 and part of exon 9 previously [2], which left the miR-335 genomic locus locating within the intron 2 of the Mest gene intact (Fig 1D). [score:1]
[1 to 20 of 62 sentences]
3
[+] score: 126
The data -driven integration of target prediction and paired mRNA/miRNA expression profiling data revealed that i) the quantity of predicted miRNA-mRNA relations was reduced, ii) miRNA targets with a function in cell cycle and axon guidance were enriched, iii) differential regulation of anti-differentiation miR-155-5p and miR-29b-3p as well as pro-differentiation miR-335-3p, miR-335-5p, miR-322-3p, and miR-322-5p seemed to be of primary importance during skeletal myoblast differentiation compared to the other miRNAs, iv) the abundance of targets and affected biological processes was miRNA specific, and v) subsets of miRNAs may collectively regulate gene expression. [score:12]
In contrast to clusters containing upregulated promyogenic genes, clusters with down-regulated genes in early or late myogenic differentiation were enriched for miR-335-3p, -206-3p, -322-5p, -335-5p, -351-5p, -322-3p, -133a-3p, -133b-3p, -532-5p and miR-532-3p targets (Fig 3C and S4C Table). [score:9]
In addition, we corroborated the expression of myoblast differentiation promoting miRNAs, such as miR-322-3p, miR-322-5p, miR-335-3p, and miR-335-5p, which were among the miRNAs showing the highest number of inversely associated targets and transcription factors as well as the highest degree of cooperative target regulation. [score:8]
Furthermore, we showed that inter alia miR-335-3p, miR-335-5p, miR-332-3p, and miR-332-5p were downregulated by TNF-α treatment whereas IGF1 had no significant impact on expression levels of these miRNAs. [score:6]
Genes targeted by miR-335-3p predominate the cluster of down-regulated genes in early or later differentiation (Fig 3C and S4C Table). [score:6]
Finally, clustering genes which were down-regulated in later myoblast differentiation were enriched for miR-335-3p, -206-3p, -322-3p, -322-5p, -351-5p, and miR-503-5p targets (Fig 3D and S4D Table) which were associated with, for example, nuclear factor like 2, breast cancer 1 and 2 (early onset), tumor protein p53, cell division cycle 25C (S5G Table). [score:6]
In addition, we revealed that miR-335-5p had the highest number of potential targets and the highest number of targeted transcription factors. [score:5]
Furthermore, miR-335-5p target enrichment analysis revealed cyclin dependent kinase inhibitor 1 and cyclin A2 associated genes (S6E Table). [score:5]
Furthermore, it had been shown that miR-335-5p was up-regulated following myoblast differentiation [51] and that miR-335-5p was induced in mdx mice and DMD patients as well as newly formed myofibers during postischemic regeneration [51] and primary muscle disorders [52, 12]. [score:4]
Our study suggests that miR-335-3p was involved in target regulation of cell division related genes as well as fibroblast growth factor or TGF-β signaling. [score:4]
Moreover, regulation of cell motility was mainly targeted by miR-335-3p and miR-206-3p (S5 Fig). [score:4]
We hypothesize that miR-335-3p and miR-335-5p played a significant role in post-transcriptional regulation of gene expression in differentiating myoblasts and TNF-α response. [score:4]
Similarly, our data revealed involvement of miR-335-5p in cyclin dependent kinase inhibitor and cyclin A2 regulation. [score:4]
In contrast to anti-myogenic miR-155-5p and miR-29b-3p, the pro-myogenic miR-322-3p, miR-322-5p, miR-335-3p, and miR-335-5p were involved in down-regulation of, for example, cell cycle or growth related pathways. [score:4]
A study by Dmitriev et al. [37], which used integrative analysis of mRNA and miRNA expression data during human myoblast differentiation, did not identify differential regulation of miR-335 or miR-322 (miR-424 in human). [score:4]
Interestingly, our data revealed enrichment of TGF-β associated targets for miR-335-3p. [score:3]
Besides, miR-335-5p was a pro-apoptotic and antimitogenic factor [57] in the brain and induced cell cycle arrest in human cancer cells [58] or suppressed cell proliferation in prostate cancer [59]. [score:3]
Thereby, we enlarged the list of highly potential targets of miRNAs implicated in skeletal myoblast differentiation foremost miR-155, miR-206, miR-322-3p/-5p, miR-335-3p/-5p, miR-351, and miR-532-3p/-5p. [score:3]
Furthermore, miR-335-5p had been reported as tumor suppressor [54, 55] or tumor promoter [56]. [score:3]
MiR-335-3p, miR-322-5p, and miR-322-3p had the highest number of targeted and inversely associated genes and transcription factors (Fig 4A and 4B). [score:3]
Moreover, this is the first study identifying a predominant functional role of miR-335-3p in skeletal myoblast differentiation on the basis of simultaneous analysis of miRNA and mRNA expression data. [score:3]
However, other studies indicated that miR-335-5p targeted genes in the TGF-β non-canonical pathways in neuroblastoma cells [53]. [score:3]
MiRNAs which mainly participated in collective gene targeting were miR-335-3p, miR-322-5p, and miR-322-3p (Fig 5C). [score:3]
Thus, we conclude, based on our target enrichment analysis and known functions within other cell types, that miR-335-5p might play a role in cell cycle withdrawal during myoblast cell differentiation. [score:3]
In summary, we presented several new inversely associated genes of for example miR-335-3p, miR-335-5p, miR-322-3p, and miR-322-5p with emphasis on the regulation of the cell cycle-related pathways. [score:2]
MiR-335-3p was differentially expressed in myogenic progenitor cell differentiation [50]. [score:2]
Particularly, miR-335-3p, miR-322-5p, and miR-322-3p predominated collective regulation of genes including transcription factors. [score:2]
MiR-322-5p, miR-335-3p, and miR-322-3p were primarily involved in the concerted regulation of transcription factors (Figs 5D and 6A). [score:2]
MiR-335-3p targets were associated with e. g. cell division cycle 2, fibroblast growth factor, and TGF-β signal transduction (S6D Table). [score:2]
MiR-335-5p was likely functionally relevant as the cyclin A2 pathway was the top enriched pathway when analyzing all investigated inversely associated miRNA targets. [score:1]
Thus, we provide new evidence for a significant role of miR-335-3p in myoblast differentiation. [score:1]
There has been little evidence in the literature about the biological implications of miR-335-3p and miR-335-5p in myoblast differentiation or its response to TNF-α or IGF1, respectively. [score:1]
S6 TableEnrichment analysis of signal transduction pathway associations of (A) miR-206-3p, (B) miR-322-3p, (C) miR-322-5p, (D) miR-335-3p, (E) miR-335-5p, (F) miR-351-5p, (G) miR-503-5p, (H) miR-133a-3p/miR-133b-3p, (I) miR-155-5p. [score:1]
[1 to 20 of 33 sentences]
4
[+] score: 46
Other miRNAs from this paper: hsa-mir-129-2, mmu-mir-129-2, hsa-mir-335
Instead, our study suggests one possible epigenetic modification mechanism for SOX4 expression in pancreatic cancer via repressed expression level of miR-129-2 and miR-335, which would otherwise target SOX4 transcript at its 3′ UTR for degradation [17], [50]. [score:7]
We clearly demonstrate that the level of miR-129-2 expression or of miR-335 is inversely correlated with SOX4 expression in most patients with pancreatic cancer in a statistically significant way. [score:5]
Expression of SOX4 in pancreatic cancers correlates with poor survival, and is strongly associated with co-repressed expression of microRNA-129-2 and microRNA-335. [score:5]
Intriguingly, re-introduction of miR-129-2 into PDAC cell lines had mild suppressive effect on the level of SOX4 mRNA (Fig. 5C), suggesting functional redundancy with other microRNAs such as miR-335. [score:3]
Moreover, the repressed expression of miR-335 in pancreatic carcinoma samples was positively correlated with the decreased level of miR-129-2 (Fig. 5B, right plot), indicating a concomitant repression of miR-129-2 and miR-335 in pancreatic cancers. [score:3]
Co-repressed miR-129-2 and miR-335 are associated with expression of SOX4, which correlates with shorter survival in patients with pancreatic cancer. [score:3]
Accordingly, we examined the expression levels of miR-129-2, miR-335, and SOX4 in twenty-three paired human pancreatic tumors and normal tissues. [score:3]
Right plot: the expression level of miR-335 in pancreatic carcinoma samples is positively correlated with the level of miR-129-2 in a linear regression way. [score:3]
Elevation of SOX4 expression associated with repressed miR-129-2 or miR-335 is reported in gastric-, endometrial-, and breast cancers [17]– [19]. [score:3]
It would be interesting to investigate whether collaborative interaction between suppressed miR-129-2 and suppressed miR-335 in pancreatic epithelial cells could achieve robust induction of SOX4 in initiating or maintaining PDAC tumorigenesis. [score:3]
Pearson correlation analysis further demonstrated that the relative expression level of SOX4 in pancreatic carcinomas (normalized with the value derived from non-tumor tissues) was inversely correlated with that of miR-129-2 and miR-335, respectively, in a statistically significant way (Pearson correlation coefficient R = −0.4991, P = 0.0154 for LogmiR-129-2 vs logSOX4; R = −0.724, P = 0.0005 for logmiR-335 vs logSOX4) (Fig. 5B, left and central plot). [score:3]
The SOX4 transcript is a target of both miR-129-2 and miR-335. [score:3]
The elevation of SOX4 has been reported to be a consequence of miR-129-2 repression in endometrial, gastric, and bladder cancer [17], [18], [51], [52], or as a consequence of miR-335 repression in metastatic breast cancer [50], suggesting the miR-129-2/SOX4 or miR-335/SOX4 regulatory axis as a general strategy for tumor formation or progression. [score:2]
[1 to 20 of 13 sentences]
5
[+] score: 42
Analyses of miRNA-335-5p expression in iWAT of 6–7 day old mice, at a time when fat accretion is rapid and Mest is highly expressed [16], showed comparable levels of miR-335 for all genotypes (Fig 1E) with no evidence for dysregulation of miR-335 in mice with inactivated Mest. [score:6]
The regulation of miR-335 is complex with some studies suggesting that it is a paternally expressed imprinted microRNA that is co-regulated with Mest whereas others suggest that it can be regulated via its own promoter [48, 64]. [score:6]
Analyses of inguinal (iWAT) WAT of 6–7 day old mice, a developmental time period when fat mass is rapidly expanding and WAT Mest is highly expressed [16], showed no differences in miR-335 expression in mice with intact (WT and Mest [m KO]) versus inactivated (Mest [g KO] and Mest [p KO]) Mest (Fig 1E). [score:6]
Normal miR-335 expression in mice with a targeted allele of Mest suggests that phenotypic differences primarily result from loss of MEST function. [score:5]
Since the Mest locus harbors a microRNA (miR-335), which has also been implicated in adipogenesis and lipid metabolism [47, 48], within an intronic sequence between exons 2 and 3 of Mest transcript variant 2 (TV2), an analyses was performed to determine whether the close proximity of a loxP site (Fig 1D) from the targeting vector aberrantly affects expression of miR-335. [score:5]
Since it is plausible that perturbed miR-335 function could modify ATE in our mouse mo del, it was necessary to determine whether miR-335 is dysregulated in mice with targeted Mest. [score:4]
A microRNA (miR-335) suggested to have a role in the regulation of lipid metabolism, adipogenesis, adipose tissue inflammation and chondrogenesis [47, 48, 63] is located within the 2 [nd] intron of Mest TV2 (Fig 1D) and only ~595 bp upstream (5’) from the loxP/NEO cassette used to generate the targeted Mest allele. [score:4]
Relative abundance of miR-335 was quantified using the 2 [-ΔΔCT] method using snoRNA202 for normalization of expression. [score:3]
Levels of Mest and miR-335 expression are presented as the mean ± SEM. [score:3]
[1 to 20 of 9 sentences]
6
[+] score: 34
Other miRNAs from this paper: hsa-mir-335
Our results about the reduced expression of miR-335-5p in SMA cells during differentiation are novel and important, as they indicate a possible role for this miRNA in SMA disease in humans, specifically in cells which are committed towards motor neurons. [score:5]
In this study, we analyze the molecular and phenotypic characteristics, in terms of gene expression and cell cycle proliferation, of SMA and wild type hiPSCs during their differentiation towards early motor neurons, and we confirm the under expression of miR-335-5p in SMA cells, associated to a reduced expression of early MN markers. [score:5]
This suggests a possible correlation between miR-335-5p expression and the ability of hiPSCs to enter the early stages of differentiation towards motor neurons. [score:3]
In particular, miR-335-5p results downregulated more than two-fold in SMA samples compared to WT ones after 14 days of differentiation, and even more strongly reduced after 22 days (Figure 3). [score:3]
In fact, human iPSCs before differentiation do not show any differences in miR-335-5p expression, which become evident during EBs differentiation. [score:3]
To further corroborate these data and considering our previous results [8], we also evaluated the expression of miR-335-5p in hiPSCs and followed it up along the in vitro differentiation steps from hiPSCs to EBs, at the same time points where we observed the differential expression of early MN markers. [score:3]
We have recently shown that miR-335-5p, already identified to control self-renewal or differentiation of mESCs [7], is differentially expressed in SMN∆7 SMA versus wild type (WT) neural progenitor cells derived from E13.5 mice spinal cords, and probably correlated to the increased proliferation activity observed in SMA cells [8]. [score:3]
RT-qPCR revealed that, while miR-335-5p expression does not differ between SMA and WT hiPSCs, a significant difference is evident at both 14 and 22 days of differentiation. [score:3]
In particular, miR-335-5p, associated with self-renewal, resulted as underexpressed in the SMA mo del of murine neural precursors. [score:3]
All primer sequences for molecular analyses are reported in Table 1. For miRNA expression, total RNA extracted as reported above, was reverse transcribed using the miR-335 and snRNA U6 Taqman assays (Life Technologies Corporation). [score:1]
All primer sequences for molecular analyses are reported in Table 1. For miRNA expression, total RNA extracted as reported above, was reverse transcribed using the miR-335 and snRNA U6 Taqman assays (Life Technologies Corporation). [score:1]
These observations deserve further deepening in order to unravel if miR-335-5p reduction not only marks the differentiation of SMA neural precursors, but most importantly if it is causally related to their pathological phenotype. [score:1]
[1 to 20 of 12 sentences]
7
[+] score: 32
A recent study by Tome et al [90] supports this view since they found miR-335-5p down-regulation was required to permit MSC differentiation toward the osteogenic or adipogenic lineage; over -expression of this miRNA inhibited MSC differentiation. [score:8]
While miR-335* has not been reported in cartilage until now, one previous study has shown down-regulation of the miR-335-5p strand in de-differentiated chondrocytes [89]. [score:4]
In addition to miR-335 and miR-138, there are a number of other differentially-expressed miRNAs identified in the present study that will be worth pursuing in the context of cartilage biology; some of these are generally not well-reported in the literature and their functional roles in normal tissue development and homeostasis are unknown so far (e. g. miRs- 301, 502, 532, 660, 1244, 1247, 1290, 1291). [score:4]
miR-335-5p and the less abundant 3p strand (miR-335*) showed significantly high fold changes in differential expression patterns in our studies (Tables 2, 3, 4 ). [score:3]
It will be interesting to determine how modulation of miR-335/335* expression affects chondrocyte differentiation. [score:3]
Unpublished observations in our laboratory have shown a sharp decrease in miR-335-5p expression during TGF-β3 induced chondrocyte differentiation of human MSCs. [score:3]
Although expression levels of miR-335* were generally lower than miR-335-5p, detection of this “minor” strand suggests that it may be functional in the context of cartilage biology. [score:3]
These findings suggest a potential role for the 5p strand of miR-335 in regulating genes to maintain a more progenitor phenotype. [score:2]
However, another study reported opposite effects of miR-335-5p in regulating osteogenesis [91], but this may be explained by the fact that cell lines were used here as opposed to primary MSCs. [score:2]
[1 to 20 of 9 sentences]
8
[+] score: 27
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
miR-335 is a paternally expressed imprinted microRNA located in the second intron of its MEST host gene [40, 41]. [score:3]
This ‘extended VCR’ contains a remarkable concentration of predicted binding sites for microRNAs, including miR-335-3p [38], miR-376a [26] and miR-493 [39]. [score:1]
miR-335 is well conserved in armadillo and elephant MEST genes but absent from the MEST genes of opossum and platypus. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 26
Both miR-335-5p and miR-574-3p have been reported to be important in bone and cartilage development and differentiation through the regulation of the Wnt pathway and SOX9 expression, respectively 21, 22. [score:5]
The miRNA pattern of expression remained similar to previous experiments with increased levels of mir-214, miR-335-5p, and miR-574-3p in the diseased state. [score:5]
MicroRNA 205-5p was decreased 2.68-fold (95% CI 2.17–2.89) in diseased mice compared to controls, whereas miR-214 and miR-335-5p were increased 2.37- (95% CI 1.81–2.93) and 2.69-fold (95% CI 2.12–3.26), respectively, in diseased mice. [score:4]
Our studies revealed plasma miR-205-5p was downregulated in GEMM mice with OS compared to wild-type littermate controls, whereas levels of miR-214 and miR-335-5p were significantly higher in GEMM mice. [score:3]
Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1). [score:3]
As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells. [score:1]
The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p. [score:1]
Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis. [score:1]
While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS. [score:1]
Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 26
PJ up-regulates genes involved in cell adhesion such as E-cadherin, intercellular adhesion molecule 1 (ICAM1) and myristoylated alanine-rich protein kinase C (MARCKS) and down-regulates genes involved in cell migration such as type I collagen, tenascin C and chimerin 1. In addition, anti-invasive microRNAs such as miR-335 (predicted targets include COL1A1, TNC, SOX4), miR-205 (predicted targets include CHN1, PRKCE), miR-200 (predicted targets include ZEB1, ZEB2), and miR-126 (predicted targets include SLC45A3), are up-regulated, whereas pro-invasive microRNA such as miR-21 (predicted targets include MARCKS, PDCD4, TPM1) and miR-373 (predicted targets include CD44), are down-regulated. [score:25]
Furthermore, we found that L + E + P increases several well-known anti-invasive miRNAs, such as miR-200c and miR-335, while decreasing several oncogenic miRNAs, such as miR-21 and miR-29b. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 24
Analysis of global profiles of miRNA expression in skeletal muscle with microarray shows that expression of 4 miRNAs (miR-29a, miR-29b, miR-29c and miR-150) are up-regulated [23], whereas expression of 11 miRNAs (miR-379, miR-127, miR299-5p, miR-434-3p, miR-335, miR130a, miR-19b, miR-451, miR-148a, miR-199a and miR-152) are down-regulated in skeletal muscle of type 2 diabetic rats [23]. [score:13]
For example, it has been shown that expression of 4 miRNAs (miR-29a, miR-29b, miR-29c and miR-150) is up-regulated [23], whereas expression of 11 miRNAs (miR-379, miR-127, miR299-5p, miR-434-3p, miR-335, miR130a, miR-19b, miR-451, miR-148a, miR-199a and miR-152) is down-regulated in skeletal muscle of type 2 diabetic rats [23]. [score:11]
[1 to 20 of 2 sentences]
12
[+] score: 20
We found Npas4 (downregulated 2-fold) to be a predicted target of the most upregulated miRNA miR-335-5p (2.76-fold upregulation in Adar2 [−/−] brain). [score:12]
For instance, we can detect a strong downregulation of Npas4 mRNA correlating with miR-335-5p upregulation. [score:7]
The highest change in abundance was 2.76-fold up for miR-335-5p and −2.59-fold down for miR-497* (Table 1). [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 20
The consensus DE miRs whose expression is anti-correlated with their DE predicted targets (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7b-5p/mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p) are designated as candidate key regulatory miRs (miRhubs), which may represent major control points in the network-level neutrophil response to S. pneumoniae. [score:6]
A complementary approach using miRHub analysis 37, 38 identified candidate key regulatory miRs based on conserved target sites in DE mRNAs, of which 10 individual miRs are differentially expressed (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7a-5p/ mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p; see Fig.   6 and Supplementary Tables  8 and 9). [score:6]
Fourteen individual miRs belonging to six miR families (miR-125a-5p/125b-5p/351/670/4319, let-7, miR-126-3p, miR-205/205ab, miR-335/335-5p and miR-23abc/23b-3p) were downregulated during pneumonia (Supplementary Table  11). [score:4]
Ten individual miRs out of the 14 miRs belonging to five of the six miR families (miR-125a-5p/125b-5p/351/670/4319, let-7, miR-126-3p, miR-335/335-5p and miR-23abc/23b-3p) were consensus DE miRs, i. e., they were significantly downregulated at least 2-fold during S. pneumoniae pneumonia using both LVS and RMA normalization (Fig.   6 and Supplementary Table  11). [score:4]
[1 to 20 of 4 sentences]
14
[+] score: 17
The invasion of MDA-MB-231 and BT-20 cells is diminished by over -expression of c-Met -targeting miR-335 [7]. [score:5]
It is also shown that TCDD and MCDF down-regulate SOX4 in MDA-MB-231 and BT474 by inducing miR-335 [25]. [score:4]
Zhang and colleagues [25] suggest that both TCDD and MCDF induce miR-335 targeting the pro-metastatic mediator SRY-related HMG-box4 (SOX4). [score:3]
For example, TCDD and MCDF induce SOX4 -targeting miR-335 in MDA-MB-231 and BT474 cells in vitro [25]. [score:3]
These effects are abrogated by Ahr knockdown and mitigated by miR-335 antisense in Ahr agonists -treated cells. [score:2]
[1 to 20 of 5 sentences]
15
[+] score: 15
Primers targeting mmu-miR-335-5p (target sequence UCAAGAGCAAUAACGAAAAAUGU), mmu-miR-34a (target sequence UGGCAGUGUCUUAGCUGGUUGU), mmu-miR-21 (target sequence UAGCUUAUCAGACUGAUGUUGA) and mmu-miR-26a (target sequence UUCAAGUAAUCCAGGAUAGGCU) were used. [score:10]
Three microRNAs had decreased expression in the bleomycin treated lungs (miR-26a, miR-151-3p and miR-676) while eight microRNAs had increased expression in the bleomycin treated lungs (miR-146b, miR-199a-5p, miR-21, miR-34a, miR-335-5p, miR-207, miR-301a and miR-449a). [score:5]
[1 to 20 of 2 sentences]
16
[+] score: 15
In particular, miR-31 and miR-34c were not modulated (Figures 1B,C); miR-206 was up-regulated (Figure 1D) and miR-449 and miR-335 were down-regulated (Figures 1E,F) in the diaphragm of 4-week-old mdx mice. [score:7]
In contrast, mIGF-1 overexpression modulated regenerative miR-449 and miR-206 (Figures 2C,D) but not miR-335 expression (Figure 2B). [score:5]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
miR-335 orchestrates cell proliferation, migration and differentiation in human mesenchymal stem cells. [score:1]
miR-335 and miR-449 are potent mediators of cell differentiation (Lizé et al., 2011; Tomé et al., 2011), whereas miR-494 has been proven critical for the myocytes’ adaptation and survival during hypoxia/ischemia (Han et al., 2011). [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 14
Among the up regulated miRNAs in STHdh [Q111]/Hdh [Q111] cells, expressions of miR-214, miR-299 and miR-335 were also up regulated in three of the four cell mo dels and expression of miR-199a was increased in two cell mo dels. [score:7]
Other miRNAs which showed a consistent expression pattern across the mo dels were miR-100, miR-214, miR-299, miR-335, miR-34a and miR-148a. [score:3]
miR-145, miR-148a, miR-190 and miR-335 however showed different expression pattern in and HD cell mo del [33]. [score:3]
, miR-145, miR-190 and miR-335) remained unchanged in. [score:1]
[1 to 20 of 4 sentences]
18
[+] score: 14
For example, the SAhRM MCDF acts as an AhR agonist to inhibit growth and/or metastasis of ER -negative breast tumors in animal mo dels, and this was associated with induction of microRNA-335 and the subsequent suppression of the pro-metastatic SOX4 gene [26]. [score:5]
In contrast to the effects observed for MCDF [26], omeprazole did not induce miR-335 expression in MDA-MB-231 (data not shown), but significantly decreased expression of the pro-metastatic genes MMP-9 and CXCR4 (Figure  5A,B) and similar results were observed in MCF-7 and MDA-MB-468 cells (Figure  4C). [score:5]
Subsequent studies showed that MCDF also blocked growth of ER -negative breast cancer cells [25] and inhibited metastasis of triple negative MDA-MB-231 breast cancer cells to the lung by inducing the antimetastatic microRNA-335 (miR-335) [26]. [score:3]
6-MCDF: 6-methyl-1,3,8-trichlorodibenzofuran; AHR: Aryl hydrocarbon receptor; AhREs: Aryl hydrocarbon response elements; ARNT: Aryl hydrocarbon receptor nuclear translocator; ChIP: Chromatin immunoprecipitation; DMEM: Dulbecco’s modified Eagle’s medium; DMSO: Dimethyl sulfoxide; DREs: Dioxin response elements; ER: Estrogen receptor; FBS: Fetal bovine serum; miR-335: MicroRNA-335; RNAi: RNA interference; SAhRMs: Selective aryl hydrocarbon receptor modulators; TCDD: 2,3,7,8-tetrachlorodibenzo- p-dioxin. [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 12
miRNAs can act as tumor suppressors (e. g. miR-15a and miR-16-1 [4]), oncogenes (e. g. miR-155 [5], [6] and miR-21 [7], [8], [9], [10]) and as promoters (e. g. miR-10b, miR-182 and miR-29a [11], [12], [13]) or suppressors (e. g. miR-335 and miR-126 [14]) of metastasis. [score:5]
On the other hand, miR-335 and miR-126 inhibited metastatic development [14]. [score:4]
In our study, some of these miRNAs (miR-10b, miR-373, miR-520c and miR-29a) were not probed in our microarrays and others (miR-21, miR-126 and miR-335) showed no significant differences in expression amongst the 4 isogenic cell lines. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 12
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
The miR146b-5p [61] and miR-335 [62] miRNAs have been shown to be metastasis suppressors in breast and colon cancers, facilitating the metastatic phenotype at reduced levels [63]. [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 12
Additionally, several miRNAs that are known to exhibit tumour suppressive functions, like miR-30a-5p, miR-31, miR-335, miR-382 and miR-503, were downregulated in the p53R172H cells upon reprograming to iPS cells. [score:6]
Furthermore, a high number of miRNAs that were downregulated in p53 compromised iPS cells convey tumour suppressive functions, that is, miR-30a-5p, [55] miR-31, 56, 57 miR-335, [58] miR-382 [59] and miR-503. [score:6]
[1 to 20 of 2 sentences]
22
[+] score: 11
Further, an up-regulated expression level of miRNA-335 was determined in murine liver and white adipose tissue. [score:6]
Nakanishi N. Nakagawa Y. Tokushige N. Aoki N. Matsuzaka T. Ishii K. Yahagi N. Kobayashi K. Yatoh S. Takahashi A. The up-regulation of microRNA-335 is associated with lipid metabolism in liver and white adipose tissue of genetically obese mice Biochem. [score:4]
miRNA-335 is involved in increased body, liver and white adipose tissue weight and in heightened cholesterol- and hepatic triglyceride levels [58]. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 11
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
The following miRNAs were found to be up-regulated in WAT after HFD feeding: mmu-miR-342-3p, mmu-miR-222, mmu-miR-221, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-647* and mmu-miR-379. [score:4]
[1 to 20 of 2 sentences]
24
[+] score: 11
MiR-335 has been shown to be expressed in lung [43], miR-31 in colon [20], and miR-106 in megakaryocytes [44]. [score:3]
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
Additionally, retinal preference/specificity was determined for miR-9*, miR-335, miR-31, miR-106, miR-129-3p, miR-691 and miR-26b by microarray analysis, and expression levels of miR-129-3p, miR-335 and miR-31 were also validated using qPCR. [score:3]
For example, miR-9*, miR-335, miR-31, miR-106b, miR-129-3p, miR-691, and miR-26b exhibited a relatively high level of expression in the retina when compared with the brain or the mouse platform. [score:2]
[1 to 20 of 4 sentences]
25
[+] score: 10
Thus, both miR-335 and miR-582 were down-regulated at 7 dpi; while miR-21 was up-regulated, miR-34b and miR-542 were down-regulated at 15 dpi. [score:10]
[1 to 20 of 1 sentences]
26
[+] score: 9
By targeting and inhibiting dickkopf-related protein 1, an antagonist of Wnt signaling, miR-335-5p was revealed to enhance bone formation and regeneration [43]. [score:5]
Zhang J. Tu Q. Bonewald L. F. He X. Stein G. Lian J. Chen J. Effects of mir-335-5p in modulating osteogenic differentiation by specifically downregulating wnt antagonist DKK1 J. Bone Miner. [score:4]
[1 to 20 of 2 sentences]
27
[+] score: 8
In contrast, in the expression of miR-21 and miR-335 peaked later on day 8, decreasing slightly thereafter, resulting in higher expression (Figure  4B). [score:5]
Furthermore, expression of miRNAs miR-21 and miR-335 associated with elevated chemoresistance [42- 44] was increasing in 2D culture until day 4 and then constantly decreasing until day 10. [score:3]
[1 to 20 of 2 sentences]
28
[+] score: 8
Other miRNAs involved in regulating lipid homeostasis including miR-29 [82], miR-106 [83], and miR-335 [84] were differentially expressed in Scap [Δ/Δ] vs. [score:4]
Several miRs associated with the regulation of lipid metabolism were differentially expressed in Scap [Δ/Δ] lungs at E18.5, including miR-122, miR-33, miR-29, miR-106 and miR-335 (Table 6). [score:4]
[1 to 20 of 2 sentences]
29
[+] score: 7
miRNA RQ Validated target genes Biological process Role in disease miR-31-3p 4.5 RhoA Proliferation and migration Cancer 53 miR-691 3.4 No data No data No data miR-700-3p 3.1 No data No data No data miR-29a-5p 3.1 No data No data Cancer 54 miR-501-3p 3 Gria1 Neuro-transmision No data 55 miR-338-3p* 2.7 Aatk, Atp5g1, CoxIV Axonal guidance, apoptosis, mitochondrial function Cancer, neurodegeneration 42, 56 miR-139-3p 2.7 MMP11 Extracellular matrix organization Cancer 57 miR-34a-5p* 2.5 Bcl-2, Notch1, Map2k1, Sirt1 Apoptosis, mitochondrial function, oxidative stress response Cancer, Alzheimer, cardiomyopathy 29, 30, 34, 43, 44 miR-335-3p 2.1 Ank3 No data No data 58 miR-1949 1.7 Rb1 Cell cycle control Cancer 59 miR-326-3p 0.5 Bcl-xl, Notch1/2 Apoptosis, proliferation Cancer 60, 61 miR-671-5p 0.3 Smarcb1 Proliferation Cancer 62 miR-503-3p 0.2 No data No data No data miR-350* 0.2 p38, Jnk Apoptosis Cardiac hypertrophy 32 [*]miRNAs selected for further studies. [score:5]
Of note, miR-34a-5p and miR-338-3p were included among these miRNAs, as well as others (miR-29a-5p, miR-31-3p, miR-326 and miR-335-3p) also found dysregulated in liver samples of the PA mouse mo del (Table  1). [score:2]
[1 to 20 of 2 sentences]
30
[+] score: 7
Indeed, it was recently shown that the predicted targets of a number of miRNAs overexpressed in the pancreatic islets of the type 2 diabetes mo del, Goto-Kakizaki rat, were shown to be enriched for genes with central roles in exocytosis, including Syntaxin -binding protein 1 (Stxbp1) shown experimentally to be a target of rno-miR-335 [22]. [score:7]
[1 to 20 of 1 sentences]
31
[+] score: 7
Of note is miR-335, found to be down-regulated in the adult brain following late-gestation ethanol exposure, and shown to be ethanol-sensitive in NSCs and regulates NSC differentiation (Sathyan et al., 2007; Mantha et al., 2014). [score:5]
This study reported the potential interplay of miR-9, miR-21, miR-153, and miR-335 miRNAs and their mRNA, illustrating the delicate yet sensitive balance between antagonistic biological cues that may ultimately determine cellular apoptosis or survival and adaptation following ethanol insult. [score:1]
Other studies have implicated specific miRNAs depending on cell type or ethanol treatment paradigm and our results have replicated some of these same molecules, including miR-335 [identified by Sathyan et al. (2007)] and miR-10b [identified by Mantha et al. (2014) and Wang et al. (2009)]. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 6
It has been reported that miR-335-5p activated Wnt signaling and promoted osteogenic differentiation by downregulating Dickkopf-related protein 1 (DKK1), an inhibitor of Wnt signaling [31]. [score:6]
[1 to 20 of 1 sentences]
33
[+] score: 6
Inflammation and obesity associated miR-335 and miR-223 [22, 23] had higher expression in VAT than in BAT in HFD fed mice in our study. [score:3]
MiR-335-3p, miR-223-3p, miR-340-5p, miR-298-5p and miR-224-5p had higher expression in SAT and VAT than in BAT (Supplementary Table 4). [score:3]
[1 to 20 of 2 sentences]
34
[+] score: 6
Seven of the 15 miRNA selected from the OpenArray were removed from the verification due to a lack of validated targets and this will be further developed in the discussion (Table  1, miR-16*, miR-21*, miR-297a*, miR-335*, miR -328, miR-685, and miR-1949. [score:3]
NI MV OpenArray RT-qPCR hsa-miR-328 − 2.5* ± 0.93Not tested [a] hsa-miR-335* − 3.0* ± 1.13Not tested [a] mmu-miR-16* 2.8** ± 0.65Not tested [a] mmu-miR-21* 5.0** ± 0.88Not tested [a] mmu-miR-297a* 5.8* ± 1.60Not tested [a] mmu-miR-685 3.0* ± 1.00Not tested [a] mmu-miR-1949 5.0* ± 1.69Not tested [a] hsa-miR-590-5p Unique to NINot validated [b] rno-miR-450 Unique to CMNot validated [b] mmu-miR-10b 2.7* ± 0.85Not validated [b] hsa-miR-146a 3.2** ± 0.68 7.2* ± 2.74 hsa-miR-150 1.8* ± 0.64 2.7 (ns) ± 2.26 hsa-miR-205 2.3* ± 0.75 − 0.5 (ns) ± 1.89 hsa-miR-486 2.3*** ± 0.18 4.7 (ns) ± 1. 45 mmu-miR-193b − 2.7** ± 0.62 − 7.5* ± 0 62 mmu-miR-215 2.1* ± 0.554.6 (ns) ± 99.39 [c] mmu-miR-467a − 2.0* ± 0.69 − 5.6 (ns) ± 0.96 The list of significantly differentially expressed miRNA in CM vs NI MV from the was compared with the results obtained by. [score:2]
The database was searched with the full names of each murine miRNA as per the ThermoFisher Scientific product information and miRBase version 21: mmu-miR-16-1-3p, mmu-miR-21a-3p, mmu-miR-146a-5p, mmu-miR-150-5p, mmu-miR-193b-3p, mmu-miR-205-5p, mmu-miR-215-5p, mmu-miR-297a-3p, mmu-miR-328-3p, mmu-miR-335-3p, mmu-miR-467a-5p, mmu-miR-486a-5p, mmu-miR-685, mmu-miR-1949, and rno-miR-10b-5p. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 5
The array uncovered the induction of 117 miRNAs with the signal intensity ≥500 (the fluorescence amount of each miRNA probe is measured by a photo multiplier tube or charge-coupled device and signal scaled across the range of detection for the platform) in GA muscle (Table 1, Fig. 1A and 1B), including the highly downregulated miRNAs (≥1.5-fold) miR-194-5p, miR-101b-3p, miR-148a-3p, miR-199b-5p, miR-335-5p, miR-127-3p, miR-379-5p, miR-541-5p, miR-382-5p, miR-329-3p, miR-299-5p and miR-434-3p, and the highly up-regulated miRNAs (≥1.5 fold), miR-146b-5p and miR-146a-5p (Fig. 1C). [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
miR-335 can also inhibit HSC migration by decreasing the tenascin-C (TNC) expression [9]. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 5
The up-regulation of microRNA-335 is associated with lipid metabolism in liver and white adipose tissue of genetically obese mice. [score:4]
Additional studies provide evidence for the involvement of mir-335 in lipid metabolism of the liver and the adipose tissue of ob/ob and db/db mice (Nakanishi et al., 2009). [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 5
Five out of the 35 DEMs in the network have targets involved in all four of the pathophysiological processes (miR-238-3p, miR-149-5p, miR-143-3p, miR-145-5p and miR-486-5p); an additional six DEMs target genes involved in three of the four processes (miR-138-5p, miR-9-5p, miR-26a-5pmiR-185-5p, miR-200b-3p and miR-335-5p). [score:5]
[1 to 20 of 1 sentences]
39
[+] score: 4
Importantly, the “transcriptional misregulation in cancer” pathway is affected by most of our differentially expressed miRNAs (miR-136-5p, miR-196a-5p, miR-196b-5p, miR-376a-3p, miR-335-5p, and miR-206-3p) significantly (p<0.001) (Figure 3A). [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
miR-223 and miR-335 are specifically regulated by hyperglycemia, and are crucial regulator of inflammatory response and systemic insulin resistance [40– 42]. [score:3]
In them, 7 miRNAs (miR-378d, miR-29c-3p, miR-20a-5p, miR-335-5p, miR-22-3p, miR-21a-5p and miR-223-3p) had been shown to be related with diabetes or glucose metabolism. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 3
Hsa-miR-15a-5p, hsa-miR-16-5p, hsa-miR-30c, hsa-miR-451a, hsa-miR-191-5p, hsa-miR-486-5p and hsa-miR-335-3p for instance have been described to be aberrantly expressed in metastatic neuroblastoma tumors 23. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
For example, miR-10b promotes breast tumor metastasis, while miR-335 and miR-126 suppress the metastasis [9], [10]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
miR-335-5p + +miR-335 was highly expressed in pediatric acute myeloid leukemia [54]. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
Recently, a substantial number of deregulated miRNAs including miR-106b-25 cluster, miR-21, miR-218, miR-7, and miR-335 have been identified as modulators of cell growth, apoptosis, migration, or invasion in gastric cancer development [11]– [15]. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
The trend was similar for miR-335 expression with a peak induction at Day 3 followed by decline (Figure 3c). [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
The remaining four miRNAs were either not detected in this new set of mice (miR-335-5p) or did not show a significant change of the expression levels (miR-140-5p, miR-195a-5p and miR-140-3p) (Fig.   2A). [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
miR-431, miR-714, miR-744, miR-877, miR-130b, miR-21, miR-323-3p, miR-325, miR-409-3p, miR-154*, and miR-681 were significantly increased 4 days post-sciatic nerve crush in pre-conditioned DRGs, while miR-190, miR-1, miR-33, miR-32, miR-153, miR-335-5p, miR-193, and miR-488 showed significantly decreased expression. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
In addition, miR-335 was found to play an important role in oocyte meiotic maturation 42 and miR-135A regulates early embryonic development 43. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
MicroRNAs that targeted these hubs included miR-34a-5p, miR-17-5p, miR-181a-5p, miR-16-5p for Bcl2 in the AMY (except for miR-16-5p, these microRNAs are involved with immune response [66]), and miR-335-5p for Bcl2 in the PFC (identified in the time-point and cluster based pairings). [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
In addition, miR-335, miR-206 and miR-126 have been identified as suppressors of breast cancer metastasis [33]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 2
In addition to miR-33a/b, miR-122, miR-370, miR-335, miR-378/378*, miR-27 and miR-125a-5p have been implicated in regulating cholesterol homeostasis, fatty acid metabolism and lipogenesis [9]. [score:2]
[1 to 20 of 1 sentences]
53
[+] score: 2
mir-335 family members mir-335-3p and mir-335-5p, two of the most significantly regulated miRNAs, belong to cluster 32(C32) and cluster 41(C41), suggesting that they may be mainly driven by spontaneous differentiation (Figure 3D). [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 2
showed that expression levels of miR-335, miR-10b, miR-944, miR-301a, miR-18b, miR-204, miR-130b, and miR-188-5p were similar in both assays (Fig. 1B). [score:2]
[1 to 20 of 1 sentences]
55
[+] score: 1
Several miRNAs - miR-10b, miR-373, miR-520c, miR-335 and miR-206 - appear to promote late stages of mammary tumor progression by impacting critical steps in the metastatic cascade such as epithelial-to-mesenchymal transition (EMT), apoptosis, and angiogenesis [6]. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
35E-0215mmu-miR-29a-5pmir-290.297.563.17E-051.34E-036mmu-miR-30d-5pmir-300.269.683.57E-063.79E-0439mmu-miR-30e-5pmir-300.2610.871.18E-031.92E-0243mmu-miR-30e-3pmir-300.298.171.61E-032.38E-0276mmu-miR-30b-5pmir-300.2511.791.12E-029.39E-029mmu-miR-320-3pmir-3200.267.491.07E-056.88E-0471mmu-miR-330-5pmir-3300.157.709.69E-038.70E-0230mmu-miR-335-5pmir-3350.2310.514.00E-048. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
Other miRNAs from this paper: hsa-mir-370, hsa-mir-335, mmu-mir-370, mmu-mir-433, hsa-mir-433
One, rs47500792, is in a putative binding site for mmu-miR335-3p, and the other two, rs47154027 and rs46439487, are adjacent SNPs that are in a putative binding site for mmu-miR370. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Alterations in miR-126-5p and miR-335-3p were not confirmed. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
Other miRNAs from this paper: mmu-mir-125b-2, mmu-mir-126a, mmu-mir-125b-1, mmu-mir-126b
0744271.59−1.933.07mmu-miR-4110.0135250.0747680.046183.41−1.625.53mmu-miR-125b-3p0.0026120.001555−1.682.08mmu-miR-2950.0000970.0008070.0002392.46−3.388.32mmu-miR-2184.63820833.58083223.4331665.05−1.437.24mmu-miR-335–5p0.0324721.2557210.2406197.41−5.2238.67mmu-miR-101a0. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Lin X. Wu L. Zhang Z. Yang R. Guan Q. Hou X. Wu Q. MiR-335-5p Promotes Chondrogenesis in Mouse Mesenchymal Stem Cells and Is Regulated Through Two Positive Feedback LoopsJ. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
More recently, patients whose breast tumors showed reduced miR-126, miR-206, or miR-335 were found to have reduced survival, regardless of ERα or ErbB2 status [18]. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-125b-2, mmu-mir-125b-1
Cui XS Sun SC Kang YK Kim NH Involvement of microRNA-335-5p in cytoskeleton dynamics in mouse oocytesReprod. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
These include miR-720, let-7b, miR-29a, miR-30d, and miR-335-5p (Fig. 2B, Supplement Table 2). [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Accumulating evidence demonstrates the close correlation of invasive capacity and metastasis with miRNAs, such as miR-124 in nasopharyngeal carcinoma [33], miR-153 in CRC [34] and miR-335 in lung cancer [35]. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Four miRNAs were identified: miR-218-1, miR-678, mir-719 and miR-335 (Table 1). [score:1]
[1 to 20 of 1 sentences]