sort by

163 publications mentioning mmu-mir-181b-2 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-181b-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 559
Moreover, these changes are independent of potential regulation by MMP-14 expression/activity, which we have previously shown to be upregulated in macrophages on GM-CSF stimulation [10] or through regulation of MMP-14 expression by miR-181b or TIMP-3 (Online Figure I). [score:10]
Here, we demonstrate that miR-181b was overexpressed in symptomatic human atherosclerotic plaques and abdominal aortic aneurysms and correlated with decreased expression of predicted miR-181b targets, tissue inhibitor of metalloproteinase-3, and elastin. [score:9]
Furthermore, recombinant TIMP-3 displayed no additive inhibitory effect on proteolytic activity in plaques from miR-181b inhibitor -treated animals (Figure 2B), indicating that the miR-181b inhibition -associated increase in TIMP-3 expression was responsible for the diminished proteolytic activity observed in plaques from treated mice. [score:9]
Taken together, these findings demonstrate that miR-181b inhibition exerts a dual protective role on AAA progression, through augmenting TIMP-3 expression and directly increasing elastin expression. [score:8]
Inhibition of miR-181b Attenuates Mortality Rates in Timp3 [−/−]/ Apoe [−/−] Mice by Directly Stimulating Elastin Expression in VSMCs and AAAsTo test whether miR-181b inhibition protects from AAA progression through TIMP-3, we used Timp3 [−/−]/ Apoe [−/−] mice. [score:8]
Hence, our findings confirm TIMP-3 as an miR-181b target [13] and demonstrate that miR-181b serves as an important inhibitor of macrophage TIMP-3 protein expression, which is divergently regulated by colony-stimulating factors. [score:8]
Finally, and most importantly, miR-181b inhibition decreases atherosclerotic plaque formation in mouse mo dels, primarily through upregulation of macrophage TIMP-3 expression, whereas in aneurysm mo dels there is an additional effect on elastin production from VSMC that is supported by in vitro studies. [score:8]
MiR-181b Inhibition Stabilizes Atherosclerotic Plaques in Hypercholesterolemic Apoe [−/] [−] MiceGiven the above, we hypothesized that miR-181b inhibition may restore macrophage TIMP-3 expression and prevent the progression of atherosclerosis. [score:7]
A, Representative images and quantification of macrophage tissue inhibitor of metalloproteinase (TIMP)-3 expression as assessed by immunofluorescence staining of brachiocephalic artery plaques from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, n=6 to 8/group, * P<0.05, 2-tailed Student t test, scale bar represents 50 μm and is applicable to both panels. [score:7]
Indeed, using a wild-type elastin-3′-untranslated region reporter expression vector, we observed that the miR-181b inhibitor increased promoter activity (P<0.01; Figure 8I). [score:7]
We present here novel in vivo findings that miR-181b inhibition reduces the progression of established atherosclerotic plaques and AAAs, mediated by increased expression of TIMP-3 in intraplaque and intra-aneurysm macrophages and elastin expression in VSMC. [score:7]
[61] However, effects on atherosclerosis and aneurysm were not assessed, although the authors did demonstrate that miR-181b overexpression in endothelial cells dramatically suppressed TIMP-3 expression. [score:7]
These findings show that miR-181b inhibition exerts protective effects on aneurysm formation/progression at multiple susceptible sites within the aorta, even in the absence of overt inflammation, implying additional beneficial effects of miR-181b inhibition independent of increased TIMP-3 protein expression. [score:7]
30, 36, 49, 50 TIMP-3 augmentation achieved through miR-181b inhibition undoubtedly suppresses the activity of MMPs that target elastin, including MMP-12. [score:7]
To confirm this, we deployed a loss of function strategy in GM-CSF macrophages, revealing that miR-181b inhibition restored TIMP-3 protein expression to comparable levels found in M-CSF macrophages (Figure 1D), whereas the mRNA level was significantly reduced (Figure 1E), implying restored TIMP3 translation. [score:7]
Quantitative polymerase chain reaction analysis of atherosclerotic vessels demonstrated reduced miR-181b expression in mice treated with the locked nucleic acid–miR-181b inhibitor controls (Online Figure VIII), inferring that the miR-181b inhibitor had pervaded the plaque/vessel wall. [score:7]
MiR Inhibition Stabilizes AAAs in Angiotensin II–Infused Apoe [−/−] MiceUsing the angiotensin II (Ang II)–induced mo del of AAA formation in Apoe [−/−] mice fed a high-fat diet, [20] we investigated the potential beneficial effects of miR-181b inhibition on the progression of infrarenal atherosclerotic AAAs by using the protocol described in Online Figure X. Treatment with an miR-181b inhibitor did not alter mean arterial blood pressure levels in response to Ang II infusion (Figure 4A) but significantly reduced the occurrence of AAAs to 48% from 86% in scrambled inhibitor-infused, control mice (Figure 4B). [score:7]
In concert with our previous findings 8– 10 and the in situ zymography in the present study, we predict that the activity of select MMPs, such as MMP-14, is retarded through miR-181b–dependent TIMP-3 upregulation, although TIMP-3 can inhibit the activity of multiple MMPs, ADAMs, and aggrecanases (ADAMTS-4 and -5), the individual roles/activities of which were not determined in the current study. [score:6]
Moreover, we discover that miR-181b regulates macrophage TIMP-3 expression and that while miR-181b increases during the progression of atherosclerotic plaques and aneurysms, TIMP-3 protein expression diminishes. [score:6]
We determined that miR-181b negatively regulates macrophage tissue inhibitor of metalloproteinase-3 expression and vascular smooth muscle cell elastin production, both important factors in maintaining atherosclerotic plaque and aneurysm stability. [score:6]
First, we show that miR-181b mediates the downregulation by GM-CSF of macrophage TIMP-3 protein expression. [score:6]
D, Quantification of miR-181b expression by quantitative polymerase chain reaction (Q-PCR) and (E) tissue inhibitor of metalloproteinase (TIMP)-3 protein expression by immunohistochemistry, n=6 to 8/group, ** P<0.01 compared with scrambled control mice, 2-tailed Student t test. [score:6]
Consistent with a lack of effect on plaque area, miR-181b inhibition failed to modulate plaque components, such as smooth muscle cell, macrophage, and collagen content, or necrotic core size in Timp3 [−] [/−]/ Apoe [−] [/−] mice (Figure 3), in direct contrast to the beneficial effects observed in miR-181b inhibitor -treated Apoe [−/−] mice (Figure 2). [score:6]
This indicates that elastin stabilization by either TIMP-3–directed MMP inhibition or increased elastin synthesis is both afforded by miR-181b inhibition. [score:6]
However, modulation of plaque elastin content and fragmentation suggest TIMP-3–independent effects of miR-181b inhibition, implying that miR-181b may regulate other targets during atherosclerosis that influence elastin content. [score:6]
Figure 3. MicroRNA (miR)-181b inhibition does not affect plaque progression in the absence of tissue inhibitor of metalloproteinase (TIMP)-3. Representative images and quantification of plaque cross-sectional area in elastin van Gieson (EVG)–stained sections of plaques within (A) the aortic root or (B) the brachiocephalic artery of Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, * P<0.05 and ** P<0.01 compared with Timp3 [+/+] Apoe [−/−] control animals, ANOVA, scale bar represents 100 μm and is applicable to all panels. [score:6]
Inhibition of miR-181b Attenuates Mortality Rates in Timp3 [−/−]/ Apoe [−/−] Mice by Directly Stimulating Elastin Expression in VSMCs and AAAs. [score:6]
Wang B Hsu SH Majumder S Kutay H Huang W Jacob ST Ghoshal K TGFbeta -mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. [score:6]
Collectively, these findings support the development of clinically applicable strategies to inhibit miR-181b, thereby maintaining or elevating TIMP-3 and elastin expression, and reducing elastin degradation. [score:6]
To assess whether miR-181b inhibition modulates atherosclerotic plaque progression through TIMP-3, we measured plaque development in Apoe/Timp3 double knockout (Timp3 [−] [/−]/ Apoe [−] [/−]) mice and whether miR-181b inhibition retarded the progression of preexisting lesions, as observed in Apoe knockout mice. [score:6]
Moreover, miR-181b inhibition greatly increased elastin and collagen expression, promoting a fibrotic response and subsequent stabilization of existing plaques and aneurysms. [score:5]
Validation studies in Timp3 [−/−] mice confirmed that the beneficial effects afforded by miR-181b inhibition are largely tissue inhibitor of metalloproteinase-3 dependent, while also revealing an additional protective effect through elevating elastin synthesis. [score:5]
Using the angiotensin II (Ang II)–induced mo del of AAA formation in Apoe [−/−] mice fed a high-fat diet, [20] we investigated the potential beneficial effects of miR-181b inhibition on the progression of infrarenal atherosclerotic AAAs by using the protocol described in Online Figure X. Treatment with an miR-181b inhibitor did not alter mean arterial blood pressure levels in response to Ang II infusion (Figure 4A) but significantly reduced the occurrence of AAAs to 48% from 86% in scrambled inhibitor-infused, control mice (Figure 4B). [score:5]
Other differences noted included the following: decreased AAA severity (Figure 4C), lowered abdominal aortic miR-181b expression by quantitative polymerase chain reaction (40%; Figure 4D), increased TIMP-3 protein expression (Figure 4E), significantly smaller mean maximal abdominal aortic diameters from histology (Figure 4F and 4G), and markedly more elastin (Figure 4G and 4H). [score:5]
However, our in vitro, in vivo, and human pathological experiments demonstrate a dominant role of TIMP-3 in protecting from disease progression subsequent to miR-181b inhibition. [score:5]
J, Representative Western blot and quantification of elastin protein expression in human aortic smooth muscle cells after addition of an miR-181b inhibitor or a scrambled control, n=4. [score:5]
Addition of an miR-181b inhibitor to aortic VSMCs significantly increased elastin protein expression (2.6-fold, P<0.01; Figure 8J). [score:5]
Similar to Apoe [−/−] mice, we observed a significant suppression in plaque progression as observed by a reduction in lesion area of miR-181b inhibitor -treated mice versus controls (by 67%; P<0.05; Online Figure IV), indicating that this effect is not exclusive to the Apoe [−/] [−] mouse mo del. [score:5]
These results demonstrate that administration of an miR-181b inhibitor augments TIMP-3 expression in AAAs, and this is associated with fewer and more stable aneurysms. [score:5]
Together, these data indicate that the majority of the beneficial actions of miR-181b inhibition on existing atherosclerotic plaques are through restoring macrophage TIMP-3 expression, as most effects were abolished in mice with Timp3 deficiency. [score:5]
Third, miR-181b through TIMP-3 downregulation is a key regulator of numerous macrophage functions involved in plaque and aneurysm progression, including increased MMP activity, macrophage invasion and accumulation, proliferation, and apoptosis. [score:5]
Interestingly, elastin content was increased in AAAs of miR-181b inhibitor -treated Timp3 [−/−]/ Apoe [−/−] mice (Figure 8F and 8G), implying that miR-181b modulates elastin expression within AAAs, in part independently from TIMP-3. Using an online database (www. [score:5]
Collectively, these results suggest that inhibition of miR-181b dramatically increases macrophage TIMP-3 expression and thus retards plaque progression and promotes a more stable phenotype. [score:5]
P [CT] refers to the probability of preferentially conserved targeting, demonstrating miR-181b preferentially targets ELN in both species. [score:5]
Taken together, these findings imply a dual beneficial effect of miR-181b inhibition during atherosclerosis and AAAs, namely increased macrophage TIMP-3 protein expression and heightened VSMC elastin production, which could eventually be exploited therapeutically. [score:5]
org), we identified that mature miR-181b can target both mouse and human elastin mRNA at the 3′-untranslated region (Figure 8H). [score:5]
Accordingly, inhibition of miR-181b in multiple mouse mo dels exerts antiatherosclerotic and antianeurysmal effects, predominantly through increasing macrophage TIMP-3 expression and vascular smooth muscle cell elastin levels. [score:5]
Moreover, confirmatory in situ hybridization indicated that the proportion of macrophages expressing miR-181b was significantly higher in unstable plaques compared with stable plaques (P<0.05; Figure 1H and Online Figure III) in direct contrast to TIMP-3 protein expression (Figure 1E). [score:5]
MiR-181b Regulates Macrophage TIMP-3 Expression and Associates With Cardiovascular Disease Progression in Humans. [score:5]
Furthermore, considering that TIMP-3 has been validated as a target of miR-181b, [13] our experiments conducted in Timp3–deficient mice strongly imply that the beneficial effects afforded by miR-181b inhibition are largely TIMP-3 dependent during atherosclerosis in Apoe [−/−] mice, although an additional protective effect is achieved through elevating elastin synthesis during formation of AAAs. [score:5]
Given the above, we hypothesized that miR-181b inhibition may restore macrophage TIMP-3 expression and prevent the progression of atherosclerosis. [score:5]
Inhibition of miR-181b protects against atherosclerosis and aortic aneurysm through increasing expression levels of macrophage TIMP-3 and vascular smooth muscle cell elastin. [score:5]
Furthermore, miR-181b expression in atherosclerotic plaques was inversely related to TIMP-3 protein expression because unstable plaques contained higher miR-181b levels (as assessed by quantitative polymerase chain reaction) than stable plaques (28-fold; P<0.05; Figure 1G). [score:5]
[10] We show here that GM-CSF sustains miR-181b expression during monocyte-to-macrophage differentiation, and TIMP-3 is therefore inhibited. [score:5]
MiR-181b Inhibition Does Not Affect Plaque Progression in the Absence of TIMP-3. MiR Inhibition Stabilizes AAAs in Angiotensin II–Infused Apoe [−/−] Mice. [score:4]
Consistent with the findings in atherosclerotic mice and in line with previous in vitro data showing impaired migration, [8] macrophage content was diminished in AAAs from miR-181b inhibitor -treated mice compared with scrambled control animals (Figure 4L and 4M), associated with marked suppression of macrophage proliferation rates and apoptotic frequencies (87% and 66% respectively; P<0.05; Figure 4L, 4N, and 4O). [score:4]
As expected, proteolytic activity was abrogated within plaques from miR-181b inhibitor -treated mice when compared with controls (by 70%; P<0.01; Figure 2B), as ascertained by in situ zymography, and comparable with the inhibitory effect achieved by addition of exogenous TIMP-3 (Figure 2B). [score:4]
To investigate whether miR-181b regulates tissue inhibitor of metalloproteinase-3 expression and affects atherosclerosis and aneurysms. [score:4]
Taken together, our results imply that miR-181b is a critical regulator of macrophage TIMP-3 expression during the progression of atherosclerosis and aortic aneurysms. [score:4]
Addition of Ang II to VSMCs in culture did not modulate miR-181b expression (Online Figure XIII), implying an indirect effect of Ang II, such as in response to hypertension. [score:4]
We also subjected 10-week high-fat–fed low-density lipoprotein receptor knockout mice (Ldlr [−/−]), which have preexisting atherosclerotic lesions within their brachiocephalic arteries (Online Figure IX) to 4-week treatment with the locked nucleic acid–modified miR-181b inhibitor or a scrambled miR to serve as control animals, while being maintained on a high-fat diet (n=6–8 per group, see Online Figure IV). [score:4]
Consistent with this, the lesion compositional changes translated to a decreased plaque vulnerability index [19] in mice receiving miR-181b inhibition compared with scrambled control animals (by 73%; P<0.01; Figure 2C and 2J). [score:4]
In situ zymography demonstrated that plaque proteolytic activity was significantly increased in Timp3 [−/−]/ Apoe [−/−] mice (4.4-fold; P<0.05) compared with controls and was unaffected by miR-181b inhibition (Figure 3I), implying that the effect of miR-181b inhibition on plaque elastin was, in part, independent of altered proteolysis. [score:4]
Hence, the TIMP-3–dependent reduction in proteolytic activity afforded through miR-181b inhibition translated into a retardation of plaque progression when compared with control animals, as observed by a reduction in lesion area (by 45%; P<0.05; Figure 2C and 2D). [score:4]
Further expansion in the average baseline maximal diameter before miR-181b inhibition was significantly decreased by miR-181b inhibition compared with scrambled miR control mice (Figure 6C). [score:4]
K, QPCR of TIMP-3 and miR-181b expression from control human NA aorta and AAA, n=10/group, ** P<0.01, 2-tailed Student t test. [score:3]
To validate our findings in human cardiovascular pathologies, we investigated the expression of miR-181b and its putative target TIMP-3 in human coronary atherosclerotic plaques and AAAs. [score:3]
Furthermore, elevated miR-181b expression occurred in human plaques histologically characterized as stable and correlated with decreased macrophage TIMP-3 expression. [score:3]
A, Kaplan–Meier curves of survival free from aneurysm rupture in control and miR-181b inhibitor -treated Ang II–infused hypercholesterolemic Timp3 [−/−] Apoe [−/−] mice, n=10 to 20/group. [score:3]
Similar favorable outcomes were observed in Ldlr [−/−] mice; aneurysm severity, aortic diameter, and associated vessel expansion were all reduced by miR-181b inhibitor treatment (Figure 6F– 6H and Online Figure XI). [score:3]
Second, macrophage TIMP-3 protein expression is reduced alongside increased miR-181b levels in both advanced human atherosclerotic plaques and AAAs. [score:3]
B, Representative images and quantification of proteolytic activity as assessed by in situ zymography of brachiocephalic plaques from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, incubated with substrate alone or plus 10 nmol/L recombinant TIMP-3, # P<0.05 and represents significant difference from substrate alone; n=6 to 8 per group, ** P<0.01 and denotes significant difference from scrambled control mice, ANOVA, scale bar represents 50 μm and is applicable to all panels. [score:3]
We are aware that miR-181b has many additional predicted targets, which may be involved in the advantageous antiatherosclerotic and antianeurysm effects observed in vivo. [score:3]
Accordingly, the vulnerability index was unaffected in Timp3 [−/−]/ Apoe [−/−] mice by miR-181b inhibition (Figure 3G). [score:3]
These differences were independent of alterations in mRNA expression (Figure 1K), but consistent with the significant change in miR-181b levels we observed (Figure 1K). [score:3]
Therefore, mice with preexisting atherosclerotic lesions within their brachiocephalic arteries were treated with a locked nucleic acid–modified miR-181b inhibitor or a scrambled miR to serve as a control (n=6–8 per group; see Online Figure VI). [score:3]
I, 3′-UTR luciferase reporter activity of human ELN in HeLa cells treated with an miR-181b inhibitor or a scrambled control, n=6. [score:3]
By polarimetry, accumulation of red collagen fibers was greater in AAA tissues from miR-181b inhibitor -treated than control mice, indicating thicker and larger collagen fibrils [21] (Figure 4K). [score:3]
D, Western blot and (E) QPCR of TIMP3 in 7-day GM-CSF–differentiated macrophages after addition of an miR-181b inhibitor (miR-181bi) or a scrambled control (Ctrl), n=4/group, * P<0.05 and ** P<0.05, 2-tailed Student t test. [score:3]
We demonstrate here, for the first time, that miR-181b exacerbates these processes and consequently promotes inflammatory cardiovascular diseases. [score:3]
Inhibition of miR-181b favorably altered the composition of atherosclerotic plaques and AAAs consistent with improved stability. [score:3]
Considering that vessel wall vascular smooth muscle cells (VSMCs) are the predominant source of elastin production, the effect of miR-181b inhibition on this was assessed. [score:3]
A, miR-181b inhibition did not alter blood pressure levels. [score:3]
A, Quantification and associated representative images of aneurysm severity (increasing severity from stage I to stage IV as described by Raffort et al [12]) in scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice with preexisting AAAs, using Fisher exact test, n=6 to 7/group. [score:3]
MiR-181b Inhibition Mitigates the Progression of Preexisting AAAs in Apoe [−/−] or Ldlr [−/−] MiceTo explore the therapeutic potential of miR-181b inhibition, we next investigated its ability to retard the progression of preexisting AAAs. [score:3]
As expected, miR-181b inhibition resulted in a significant increase in intraplaque TIMP-3–positive macrophages (by 90%; P<0.05; Figure 2A). [score:3]
TIMP-3 deficiency promotes atherosclerosis and aortic aneurysm formation and reduces the beneficial effects of miR-181b inhibition. [score:3]
Thus, miR-181b inhibition may have a protective role in other vascular pathologies, particularly aneurysms. [score:3]
G, Representative images of elastin van Gieson–stained histological cross-sections of AAAs from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, demonstrating the differences in vessel diameter and elastin content (black), scale bar in ii represents 100 μm and is applicable to panels i, ii, and iv–x. [score:3]
H, Conserved miR-181b–binding sites of the 3′-untranslated region (3′-UTR) of human (hsa) and murine (mmu) elastin (ELN). [score:3]
Body weights were comparable between scrambled control (29.7±1.1 g) and miR-181b inhibitor -treated mice (30.2±1.3 g), indicating that locked nucleic acid–miR treatment was well tolerated, and no significant effect on lipid profiles was observed (Online Figure VII). [score:3]
Mean maximal diameter of descending thoracic aortas in miR-181b inhibitor -treated mice was significantly smaller than those of controls (31%, P<0.05; Figure 5A and 5B). [score:3]
G, QPCR of miR-181b expression from stable and unstable coronary atherosclerotic plaques, n=10/group, * P<0.05, 2-tailed Student t test. [score:3]
Furthermore, increased elastin content associated with miR-181b inhibition was accompanied by a more stable composition of atherosclerotic plaques and aneurysms, including greater collagen accumulation and enhanced smooth muscle cell to macrophage ratio. [score:3]
Collectively, miR-181b inhibition resulted in alterations in plaque composition that have been previously taken as markers of increased plaque stability. [score:3]
Our findings suggest that the management of miR-181b and its target genes provides therapeutic potential for limiting the progression of atherosclerosis and aneurysms and protecting them from rupture. [score:3]
Such inhibition of miR-181b could serve as a therapeutic approach in reversing the advancement of atherosclerosis and aortic aneurysms and avoiding the associated acute clinical syndromes. [score:3]
Nonetheless, our current findings demonstrate that restoration of TIMP-3 levels achieved through miR-181b inhibition retards the progression of atherosclerotic plaques and aneurysms at multiple vascular beds and in different mouse strains. [score:3]
MiR-181b Inhibition Regulates Matrix Composition at Other Aneurysmal Sites and Is Protective in an Additional Mouse Mo del. [score:3]
AAAs from miR-181b inhibitor -treated Apoe [−/−] mice were notably less dilated than those from controls (Figure 6A and 6B). [score:3]
Quantification of (C) vessel diameter, (D) collagen content, (E) elastin breaks, (F) elastin content, and (G) representative images of elastin van Gieson–stained AAAs from control and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 7/group, scale bar in i represents 200 μm and is applicable to panels i and ii, scale bar in ii represents 100 μm and is applicable to panels iii and iv. [score:3]
Contrary to our expectations, inhibition of miR-181b significantly reduced death rates (from 55% to 25%, P<0.01; Figure 8A) after >14 days of Ang II infusion. [score:3]
These findings demonstrate that TIMP-3 is protective toward atherosclerosis and aneurysm formation and that targeting miR-181b may provide a novel strategy for limiting the progression of atherosclerotic plaques and aortic aneurysms. [score:3]
F, Quantification and associated representative images of aneurysm severity (increasing severity from stage I to stage IV as described by Raffort et al [12]) in scrambled control and miR-181b inhibitor -treated Ldlr [−/−] mice with preexisting AAAs, using Fisher exact test, n=6 to 7/group. [score:3]
H, Representative images and quantification of TIMP-3 protein expression by IHC and miR-181b by in situ hybridization (ISH) from stable and unstable coronary atherosclerotic plaques, n=10/group, * P<0.05, 2-tailed Student t test. [score:3]
In contrast to Apoe [−] [/−] mice (Figure 2D), miR-181b inhibition failed to retard plaque progression at either vascular site, in Timp3 [−] [/−]/ Apoe [−] [/−] mice (Figure 3A and 3B). [score:3]
To test whether miR-181b inhibition protects from AAA progression through TIMP-3, we used Timp3 [−/−]/ Apoe [−/−] mice. [score:3]
Moreover, miR-181b inhibitor significantly increased elastin content, as (Figure 6D and Online Figure VI) and reduced the frequency of elastin fragmentation (Figure 6E and Online Figure VI). [score:3]
Hence, miR-181b inhibition can also prevent the progression of preexisting AAAs, while increasing the elastin content of advanced AAAs. [score:3]
B, Quantification and associated representative images of aneurysm severity in control and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 7/group. [score:3]
J, Quantification and associated representative images of aneurysm severity (increasing severity from stage I to stage IV as described by Raffort et al [12]) in scrambled control and miR-181b inhibitor -treated Ldlr [−/−] mice, using Fisher exact test, n=6 to 8/group, * P<0.05. [score:3]
MiR-181b Inhibition Mitigates the Progression of Preexisting AAAs in Apoe [−/−] or Ldlr [−/−] Mice. [score:2]
Elucidating novel pathogenetic factors, such as miR-181b, is therefore paramount for the development of efficient new therapies. [score:2]
C, Representative images and quantification of (D) plaque cross-sectional area in elastin van Gieson (EVG)–stained sections, (E) ratio of total lesional vascular smooth muscle cells (VSMC) and macrophages (Mac) assessed by immunohistochemistry, (F) lesional collagen content assessed by picrosirius red staining, (G) lesional necrotic core area, (H) lesional proliferation percentage determined by immunohistochemistry for proliferating cell nuclear antigen (PCNA), (I) lesional apoptosis percentage determined by immunohistochemistry for cleaved caspase-3 (CC3), (J) the plaque vulnerability index (necrotic core area+macrophage content/VSMC+collagen content), (K) lesional elastin content assessed by EVG staining, in brachiocephalic plaques from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, n=6 to 8/group, * P<0.05 and ** P<0.01 compared with scrambled control mice, 2-tailed Student t test, scale bar in ii represents 100 μm and is applicable to panels i and ii, scale bar in iii represents 100 μm and is applicable to panels iii–viii, scale bar in ix represents 50 μm and is applicable to panels ix–xii. [score:2]
Moreover, and in line with our previous in vitro data, [8] intraplaque macrophage proliferation rates and apoptotic frequencies were reduced (88% and 68%, respectively; P<0.01; Figure 2C, 2H, and 2I) in brachiocephalic plaques from miR-181b inhibitor -treated mice compared with scrambled control animals. [score:2]
It has recently been reported that miR-181b can regulate nuclear factor-κB–mediated activation of endothelial cells and ensuing vascular inflammation. [score:2]
AAA severity was significantly reduced in miR-181b inhibitor -treated mice (Figure 5J) compared with scrambled control animals, which exhibited marked aneurysm formation. [score:2]
Quantification of (G) vessel diameter, (H) vessel expansion, (I) elastin content, and (J) elastin breaks in scrambled control and miR-181b inhibitor -treated Ldlr [−/−] mice with preexisting AAAs, n=6 to 7/group, * P<0.05 and ** P<0.01 compared with scrambled control mice, 2-tailed Student t test. [score:2]
Prominent breaks and fragmentation of the elastic lamellae, key features of AAAs, were abrogated in miR-181b inhibitor -treated compared with control animals (Figure 4I) in association with increased collagen accumulation (by 88%; Figure 4J and 4K). [score:2]
In the ascending thoracic aortas, miR-181b inhibitor -treated mice had decreased vessel expansion compared with controls (by 28%, P<0.05; Figure 5F and 5G), which was associated with increased elastin content and reduced elastin fragmentation (Figure 5H and 5I and Online Figure XI). [score:2]
K, Representative picrosirius red staining viewed under white light and linearly polarized light to show fibrillar collagen in AAAs of scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice (scale bar in i represents 200 μm and is applicable to all panels), and associated qualitative analysis of new (green) and old (red) fibrillar collagen fiber content, n=6 to 8/group, * P<0.001 compared with scrambled control mice, Fisher exact test. [score:2]
Finally, miR-181b inhibition significantly augmented elastin content within plaques compared with scrambled control animals (2.6-fold; P<0.01; Figure 2C and 2K). [score:2]
I, Representative images and quantification of proteolytic activity as assessed by in situ zymography of brachiocephalic plaques from Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, * P<0.05 compared with Timp3 [+/+] Apoe [−/−] control animals, ANOVA, scale bar represents 50 μm and is applicable to all panels. [score:2]
We demonstrate here that elastin stabilization is also achieved through a direct effect of miR-181b on elastin protein synthesis. [score:2]
Surprisingly, although plaque elastin content was, as expected, decreased in Timp3 [−/−]/ Apoe [−/−] mice (by 43%; P<0.05) compared with Timp3 [+/+]/ Apoe [−/−] control mice (Figure 3H), elastin content was restored to levels comparable with control animals, by miR-181b inhibitor treatment of Timp3 [−/−]/ Apoe [−/−] mice (Figure 3H). [score:2]
Quantification of (B) vessel diameter, (C) vessel expansion, (D) elastin content, and (E) elastin breaks in scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice with preexisting AAAs, n=6 to 7/group, * P<0.05 and *** P=0.0007 compared with scrambled control mice, 2-tailed Student t test. [score:2]
L, Representative images and quantification of (M) macrophage content (N) proliferation percentage determined by immunohistochemistry for proliferating cell nuclear antigen (PCNA), and (O) apoptosis percentage determined by immunohistochemistry for cleaved caspase-3 (CC3), in AAAs from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, n=6 to 8/group, * P<0.05 compared with scrambled control mice, 2-tailed Student t test, scale bar in i represents 100 μm and is applicable to all panels. [score:2]
A, Representative images and quantification of elastin van Gieson–stained histological cross-sections of descending thoracic aortas (TAs) from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice demonstrating the differences in (B) vessel diameter and (C) elastin content (black), n=6 to 8/group, * P<0.05 compared with scrambled control mice, 2-tailed Student t test scale bar in i represents 200 μm and is applicable to both panels. [score:2]
F, Representative images and quantification of elastin van Gieson–stained histological cross-sections of ascending TAs from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, demonstrating the differences in (G) vessel diameter and (H) elastin content (black), n=6 to 8/group, * P<0.05 compared with scrambled control mice, 2-tailed Student t test scale bar in i represents 200 μm and is applicable to both panels. [score:2]
MiR-181b Inhibition Stabilizes Atherosclerotic Plaques in Hypercholesterolemic Apoe [−/] [−] Mice. [score:2]
Moreover, whereas it was observed that elastin fragmentation was more prevalent within brachiocephalic arteries from Timp3 [−/−]/ Apoe [−/−] mice (6.8-fold; P<0.0010) compared with Timp3 [+/+]/ Apoe [−/−] control mice (Figure 3J), miR-181b inhibition reduced the number of elastin breaks in Timp3 [−/−]/ Apoe [−/−] mice (by 66%; P<0.05), although still significantly greater in number than Timp3 [+/+]/ Apoe [−/−] control mice (Figure 3J). [score:2]
[22] We therefore investigated whether miR-181b inhibition prevents aneurysm formation within the ascending and descending thoracic aortae in our Ang II–infused, Apoe [−/−] mouse mo del. [score:1]
C, QPCR of miR-181b in human macrophages differentiated in the presence of M-CSF or GM-CSF, n=6/group, ** P<0.01, 2-tailed Student t test. [score:1]
Systemic delivery of anti-miR-181b in angiotensin II–infused Apoe [−/−] and Ldlr [−/−] mice attenuated aneurysm formation and progression within the ascending, thoracic, and abdominal aorta. [score:1]
To investigate whether the beneficial effects of miR-181b inhibition extended beyond Apoe [−/−] mice, we assessed AAA formation in Ang II–infused, high-fat–fed Ldlr [−/−] mice. [score:1]
To explore the therapeutic potential of miR-181b inhibition, we next investigated its ability to retard the progression of preexisting AAAs. [score:1]
Sun X Icli B Wara AK Belkin N He S Kobzik L Hunninghake GM Vera MP Blackwell TS Baron RM Feinberg MW MICU Registry MicroRNA-181b regulates NF-κB -mediated vascular inflammation. [score:1]
Quantification of (C) smooth muscle cell (SMC), (D) macrophage, (E) collagen content, (F) necrotic core area, (G) plaque vulnerability index (necrotic core area+macrophage content/vascular smooth muscle cell+collagen content), and (H) elastin content, in brachiocephalic plaques from Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, * P<0.05, *** P=0.00013, and ### P=0.00938 compared with Timp3 [+/+] Apoe [−/−] control animals and # P<0.05 compared with Timp3 [−/−] Apoe [−/−] mice, ANOVA. [score:1]
J, Representative images and quantification of elastin breaks assessed by EVG staining of brachiocephalic plaques from Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, *** P=0.0010 compared with Timp3 [+/+] Apoe [−/−] control animals and # P<0.05 compared with Timp3 [−/−] Apoe [−/−] mice, ANOVA. [score:1]
[59] All of this evidence supports the concept that GM-CSF plays a major part in atherosclerosis and AAAs, in part by sustaining miR-181b levels. [score:1]
[1 to 20 of 140 sentences]
2
[+] score: 342
However, western blot analysis showed that overexpression of miR-181b remarkably suppressed CYLD expression in SFCs and that inhibition of miR-181b increased CYLD expression in SFCs (Fig.   6g), indicating that miR-181b regulates CYLD in SFCs at the post-transcriptional level. [score:12]
The expression of p-STAT3 protein was significantly increased after transfection with the miR-181b mimic, whereas its expression was suppressed by miR-181b inhibitors (Fig.   4f). [score:9]
Moreover, qPCR analysis showed that overexpression or inhibition of miR-181b had no effect on the CYLD mRNA expression level (Fig.   6f). [score:7]
Taken together, these results demonstrate that miR-181b regulates CYLD expression by directly targeting its 3′-UTR. [score:7]
h qPCR analysis for expression levels of mature miR-181b, pri-miR-181b in SFCs treated with vector expressing STAT3. [score:5]
However, the miR-181b mimic increased the p-STAT3 expression level suppressed by JSI-124 (Fig.   5c, lane 3 and lane 4). [score:5]
g of CYLD expression in SFCs treated with miR-181b mimic or miR-181b inhibitor. [score:5]
Increased expression levels of p-STAT3 induced by the miR-181b mimic were reversed by the STAT3 inhibitor JSI-124 (Fig.   5c, lane 2 and lane 3). [score:5]
Concordantly, forced expression of STAT3 increased the expression levels of primary-miR-181b and mature miR-181b (Fig.   3h). [score:5]
Error bars represent mean ± SDAnalysis using publicly available algorithms (TargetScan and microRNA) predicted CYLD as a target of miR-181b in Eca109 SFCs (Fig.   6c). [score:5]
In addition, forced STAT3 expression remarkably reversed apoptosis induced by the inhibitor of miR-181b in SFCs (Fig.   5d). [score:5]
c mRNA expression levels of ABCB1, ABCG2, and MRP1 in SFCs treated with miR-181b mimic or miR-181b inhibitor. [score:5]
Error bars represent mean ± SD Analysis using publicly available algorithms (TargetScan and microRNA) predicted CYLD as a target of miR-181b in Eca109 SFCs (Fig.   6c). [score:5]
To explore whether this effect was related to the miR-181b expression level, miR-181b expression was analyzed. [score:5]
Error bars represent mean ± SD According to previous studies [36, 46], the 3′-untranslated region (UTR) of CYLD was identified as a target of miR-181b. [score:5]
Consistently, the expression level of miR-181b was also decreased after the addition of JSI-124, which is a pharmacological inhibitor of STAT3. [score:5]
a Flow cytometry apoptosis analysis of SFCs treated with p-STAT3 inhibitor JSI-124 and miR-181b inhibitor. [score:5]
qPCR analysis showed that forced STAT3 expression increased miR-181b expression (Fig.   5e). [score:5]
In contrast, overexpression of STAT3 strongly enhanced the expression level of miR-181b (Fig.   3d). [score:5]
STAT3 and miR-181b control each other’s expression in a positive feedback loop that regulates SFCs via CYLD pathway. [score:4]
To further explore whether miR-181b regulates proliferation and colony formation, we performed in vitro gain-of-function analyses by overexpression of miR-181b with a lentiviral vector containing GFP in SFCs. [score:4]
To determine whether CYLD is direct target of miR-181b, we engineered the 3′-UTR fragments, in which wild-type and mutant binding sites were inserted into the region immediately downstream of the luciferase reporter gene (Fig.   6d). [score:4]
These results suggest that the reduction in CYLD is regulated at the post-transcriptional level and that the CYLD 3′-UTR is a target of miR-181b in Eca109 SFCs. [score:4]
These data further support the notion that there is a positive and mutual regulation between STAT3 and miR-181b and that CYLD is a target of miR-181b. [score:4]
CYLD is a direct and functional target of miR-181b. [score:4]
Fig. 6CYLD is identified as a direct and functional target of miR-181b. [score:4]
Our study to determine the biological role of miR-181b in SFCs identified CYLD as a downstream target. [score:3]
c Bioinformatics analysis conservation of CYLD 3′–UTR among different species and CYLD 3′-UTR is a target of miR-181b. [score:3]
To determine whether STAT3 influences miR-181 expression, we constructed a 2-kb fragment upstream of the human miR-181b stem-loop and inserted the fragment into the luciferase reporter plasmid pGL4.11. [score:3]
Luciferase assays indicated that CYLD was a direct and functional target of miR-181b. [score:3]
d qPCR analysis of miR-181b expression in SFCs treated with JSI-124 and with or without STAT3. [score:3]
d Colony formation detection of SFCs treated with miR-181b or miR-181b inhibitor in soft agar. [score:3]
Additionally, miR-181b was expressed more significantly in papillary thyroid carcinoma than in counterpart normal tissue [34, 35]. [score:3]
miR-181b transfection increased NF-κB activity, while inhibition of miR-181b decreased this activity (Fig.   6h). [score:3]
qPCR were performed to examine expression level of stemness factors, mesenchymal markers, ATP -binding cassette (ABC) transporters, STAT3, miR-181b, CYLD. [score:3]
Third, both STAT3 and miR-181b inhibition sensitized SFCs to apoptosis. [score:3]
However, it was unknown whether the CYLD 3′-UTR is a target of miR-181b in SFCs. [score:3]
e qPCR analysis of miR-181b expression levels in SFCs treated with IL-6. f Bioinformatics analysis of predicted binding sites for STAT3 at the promoter of miR-181b. [score:3]
Additionally, STAT3 increased miR-181b expression level in our study. [score:3]
In this study, the miR-181b mimic also increased IL-6 expression level. [score:3]
Spearman analysis were employed to analyzed the relationship between STAT3 and miR-181b, miR-181b and CYLD To address whether the above observations in SFC are relevant to human cancer, we examine the relationship between STAT3 and miR-181b expression levels in human ESCC specimens. [score:3]
Interestingly, the CD24 expression level showed no obvious alterations after transfection with the miR-181b mimic (Fig.   4b). [score:3]
Our studies demonstrated STAT3 depletion reduced the expression level of miR-181b in SFCs (Fig.   3d). [score:3]
Mutual regulation between STAT3 and miR-181b is essential for SFCs to regulate proliferation and the resistance to apoptosis. [score:3]
f qPCR analysis of CYLD in SFCs treated with miR-181b mimic or miR-181b inhibitor. [score:3]
s revealed that CYLD is a target of miR-181b. [score:3]
showed that miR-181b increased p-STAT3 expression. [score:3]
c miR-181b and CYLD expression levels in esophageal cancer, with each data point representing an individual sample. [score:3]
These results further suggest that CYLD is a target of miR-181b. [score:3]
b qPCR analysis of CD44 and CD24 in SFCs treated with miR-181b mimic or miR-181b inhibitor. [score:3]
The miR-181b mimic, miR-181b inhibitor, and NC cells were purchased from RIBOBIO (Guangzhou, China). [score:3]
SFCs were dissociated with trypsin, transiently transfected with vector pcDNA3.1 STAT3, and treated with 10 μM JSI-124 for 4 h. e qPCR analysis of miR-181b in SFCs treated with miR-181b inhibitor and pcDNA3.1 STAT3 vector. [score:3]
d Flow cytometry to determine apoptosis of SFCs treated with miR-181b inhibitor and vector pcDNA3.1 STAT3. [score:3]
There is a positive correlation between STAT3 and miR-181b expression levels in the cancer specimens (r = 0.683) (Fig.   7b). [score:3]
This study provides insight into the mechanisms underlying the reciprocal regulation between STAT3 and miR-181b to regulate the proliferation of esophageal cancer cells with cancer stem-like cells properties via the CYLD pathway. [score:3]
In contrast, colony formation was remarkably suppressed when miR-181b was silenced (Fig.   4e), suggesting that miR-181b promotes the proliferation and colony formation of SFCs. [score:3]
f of p-STAT3 and STAT3 in SFCs treated with miR-181b mimic or with miR-181b inhibitor and JSI-124. [score:3]
b STAT3 and miR-181b expression levels in esophageal cancer, with each data point representing an individual sample. [score:3]
h NF-κB activity detection in SFCs treated with miR-181b mimic or miR-181b inhibitor. [score:3]
Spearman analysis were employed to analyzed the relationship between STAT3 and miR-181b, miR-181b and CYLDTo address whether the above observations in SFC are relevant to human cancer, we examine the relationship between STAT3 and miR-181b expression levels in human ESCC specimens. [score:3]
In our study, potential targets of miR-181b were analyzed using different algorithms. [score:3]
We found that ectopic expression of miR-181b significantly increased colony size and the number of cells in the colonies (Fig.   4e). [score:3]
SFCs were dissociated with trypsin and were transduced with miR-181b mimic or miR-181b inhibitor conjugated with FAM. [score:3]
These observations indicate that reciprocal regulation between STAT3 and miR-181b is critical for regulating the proliferation of SFCs. [score:3]
In contrast, the effect was reversed by miR-181b inhibitors (Fig.   4d). [score:3]
i IL-6 activity detection in SFCs treated with miR-181b mimic or miR-181b inhibitor. [score:3]
We found that mutual regulation between STAT3 and miR-181b is essential for regulating the proliferation and resistance of SFCs. [score:3]
Error bars represent mean ± SDTo evaluate whether miR-181b regulates STAT3 expression, we conducted western blot analysis to detect STAT3. [score:2]
Reciprocal regulation between STAT3 and miR-181b is required for proliferation and anti-apoptosis. [score:2]
miR-181b regulates colony formation of SFCs via p-STAT3. [score:2]
Moreover, STAT3 could bind to the promoter of miR-181b, suggesting that STAT3 is a direct transcriptional activator of miR-181b. [score:2]
After determining the molecular mechanism by which STAT3 promotes the expression of miR-181b, we performed a luciferase reporter assay. [score:2]
Thus, mutual regulation between STAT3 and miR-181b confers resistance to apoptosis in SFCs. [score:2]
Collectively, these results suggest that STAT3 regulates SFCs proliferation and increases colony formation of SFCs by trans-activating miR-181b. [score:2]
Mutations were generated at the three predicted miR-181b binding sites located in the CYLD 3′-UTR. [score:2]
1: Summary of the supplementary informarion of reciprocal activation between STAT3 and miR-181b regulates the proliferation of esophageal cancer stem-like cells via the CYLD pathway. [score:2]
Additionally, we found that reciprocal activation between STAT3 and miR-181b regulated SFCs proliferation. [score:2]
However, the regulatory relationship in esophageal cancer stem-like cells between STAT3 and miR-181b remains unclear. [score:2]
Moreover, STAT3 directly activated miR-181b transcription in SFCs and miR-181b then potentiated p-STAT3 activity. [score:2]
Recent studies have demonstrated that miR-181b plays an important role in regulating cellular growth, invasion, and apoptosis in different cancers, including gastric adenocarcinomas, chronic lymphocytic leukemia, ovarian cancer, and cervical cancer [32, 33]. [score:2]
In addition, when the E-box sequence was mutated, luciferase activity was abrogated (Fig.   3g), indicating that the E-box sequence is necessary for STAT3 regulation of miR-181b and that STAT3 binds to the promoter of miR181b. [score:2]
STAT3 trans-activates the transcription of miR-181b, whereas miR-181b positively regulates p-STAT3. [score:2]
Collectively, these studies demonstrate that miR-181b regulates the proliferation of SFCs through CYLD pathway. [score:2]
s showed that miR-181b transfection significantly repressed the luciferase activity of the CYLD 3′-UTR, whereas mutations in the binding sites did not decreased the luciferase activity (Fig.   6e). [score:2]
Consistent with the results of previous studies [40, 44], inhibition of STAT3 by JSI-124 or depletion of miR-181b with the inhibitor induced apoptosis compared with that measured in NC cells (Fig.   5a). [score:2]
The mutual regulation between STAT3 and miR-181b in SFCs was required for proliferation and apoptosis resistance. [score:2]
miR-181b regulates the SFC proliferation through CYLD pathway. [score:2]
We found that the expression level of miR-181b in Eca109 SFCs increased significantly compared with in the parental cells (Fig.   4a). [score:2]
Collectively, miR-181b positively regulates p-STAT3 in SFCs. [score:2]
Error bars represent mean ± SD To evaluate whether miR-181b regulates STAT3 expression, we conducted western blot analysis to detect STAT3. [score:2]
Schematic representation of the 1650-bp regulatory region upstream of the human miR-181b-stem-loop. [score:2]
The corresponding mutant constructs were created by mutating the seed regions of the miR-181b -binding sites. [score:1]
To further assess the effect miR-181b targeting CYLD, the activities of NF-κB and IL-6 were measured. [score:1]
The sequence containing the pre-miR-181b was cloned into the pGCSIL-GFP lentiviral. [score:1]
To construct a luciferase reporter vector, the wild-type 3′-UTR of CYLD, containing three putative binding sites for miR-181b, was PCR-amplified using genomic cDNA from SFCs as templates. [score:1]
The E-box motifs were predicted at-1650 bp relative to the transcription start site of the human miR-181b stem-loop. [score:1]
The miR-181b mimic and siRNA were used with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. [score:1]
a qPCR analysis of miR-181b in Eca109 parental cells and SFCs. [score:1]
The miR-181b mimic increased the number of SFC colonies formed (Fig.   4d). [score:1]
c of SFCs treated with JSI-124 and miR-181b mimic. [score:1]
a Soft agar experiment was employed analyze the relationship between miR-181b and CYLD. [score:1]
These results demonstrate that STAT3 trans-activates the transcription of miR-181b. [score:1]
In addition, we found an inverse correlation between miR-181b and CYLD (r = -0.867) (Fig.   7c). [score:1]
es of wild-type and mutant reporter plasmids cotransfected with miR-181b or NC into SFCs dissociated with trypsin. [score:1]
Fig. 5Reciprocal interaction between STAT3 and miR-181b conferred resistance to apoptosis. [score:1]
Second, miR-181b increased the number of colonies of SFCs. [score:1]
Esophageal cancer stem-like cells Sphere formation cells STAT3 miR-181b Proliferation CYLD Esophageal cancer includes two major pathological types: esophageal adenocarcinomas and esophageal squamous cell carcinoma (ESCC). [score:1]
Our results demonstrated that exogenous miR-181b increased NF-κB activity. [score:1]
Moreover, SFCs transfected with the miR-181b mimic increased ABCB1, ABCG2, and MRP1 levels by more than two-fold (Fig.   4c). [score:1]
Error bars represent mean ± SD miR-181b modulates drug resistance in gastric and lung cancer cells and promotes tumorigenicity in hepatocellular carcinoma [44, 45]. [score:1]
STAT3 increased sphere formation through miR-181b pathway. [score:1]
The colonies efficiencies of SFCs was decreased by siCYLD, which was reversed by miR-181b (Fig.   7a). [score:1]
In addition, a miR-181b mimic led to a significant mRNA increase in CD44 (Fig.   4b). [score:1]
Through bioinformatics analysis using rVista 2.0, we identified a conserved E-box motif (CANNTG) at 1650 bp relative to the transcription start site (+1) of the human miR-181b stem-loop (Fig.   3f). [score:1]
In addition, STAT3 activation of miR-181b is important for cellular transformation [36]. [score:1]
Spearman analysis were employed to analyzed the relationship between STAT3 and miR-181b, miR-181b and CYLD. [score:1]
b Apoptosis analysis of SFCs treated with JSI-124 and miR-181b mimic by flow cytometry. [score:1]
Finally, in clinical human ESCC there is a positive relationship between STAT3 and miR-181b and miR-181b is inversely association with CYLD. [score:1]
Moreover, the 3′-UTR sequences of CYLD were found to be highly conserved among different species and showed three possible binding sites for miR-181b (Fig.   6c, D). [score:1]
miR-181b mimic transfection significantly protected SFCs from apoptosis induced by interruption of STAT3 activation with JSI-124 (Fig.   5b). [score:1]
Next, we tested the function of miR-181b in colony formation in soft agar. [score:1]
SFCs were transiently transfected with miR-181b mimic and treated with 10 μM JSI-124. [score:1]
Fig. 3STAT3 trans-activates miR-181b transcription. [score:1]
Reciprocal activation between STAT3 and miR-181b is critical for resistance of SFCs to apoptosis. [score:1]
[1 to 20 of 124 sentences]
3
[+] score: 333
SW480 cells were infected with a control lentivirus or a miR-181b overexpression lentivirus, transfected with a PDCD4 overexpression plasmid, or co -transfected with a miR-181b overexpression lentivirus and a PDCD4 overexpression plasmid. [score:9]
We infected SW480 cells with a control lentivirus or a miR-181b overexpression lentivirus, transfected cells with a PDCD4 overexpression plasmid, or co -transfected with a miR-181b overexpression lentivirus and a PDCD4 overexpression plasmid. [score:9]
SW480 cells were infected with a control lentivirus or a lentivirus to overexpress miR-181b, or transfected with a PDCD4 overexpression plasmid, or co -transfected with a miR-181b overexpression lentivirus and a PDCD4 overexpression plasmid. [score:9]
However, because a single miRNA can target multiple genes and multiple miRNAs can target a single gene, miR-181b may have multiple different targets in addition to PDCD4, and PDCD4 may be regulated by different miRNAs in addition to miR-181b. [score:8]
Moreover, tumors with both miR-181b and PDCD4 overexpression exhibited significantly higher PDCD4 levels compared to tumors overexpressing miR-181b alone (Fig.   5D and 5E), suggesting that PDCD4 overexpression rescued miR-181b -mediated PDCD4 suppression. [score:8]
Therefore, modulation of PDCD4 by miR-181b may explain why miR-181b is aberrantly overexpressed and PDCD4 is weakly expressed in CRC tissues and why miR-181b upregulation can promote cell growth and CRC formation. [score:8]
Thus, restoration of PDCD4 expression can reverse miR-181b -induced cell proliferation and migration and miR-181b -suppressed cell apoptosis, suggesting that targeting of PDCD4 is one mechanism by which miR-181b exerts its oncomiR function. [score:7]
As anticipated, PDCD4 protein expression significantly decreased upon miR-181b overexpression, whereas treatment with the miR-181b inhibitor increased PDCD4 protein levels in SW480 cells (Fig.   3B and 3C). [score:7]
These findings add new clues to understanding the role of STAT3 in CRC: activation of IL-6/STAT3 suppressed PDCD4 by upregulating miR-181b, and therefore promoting the development of CRC. [score:7]
Likewise, tumors from the miR-181b -overexpressing group expressed decreased PDCD4 protein levels compared to tumors from the control group, whereas tumors from the PDCD4 -overexpressing group showed elevated PDCD4 protein levels (Fig.   5D and 5E). [score:6]
Conversely, miR-181b has been found to be frequently downregulated in CRC samples due to higher hypermethylation and exert tumor-suppressive effects (Zhao et al., 2016). [score:6]
In this study, we found that miR-181b, as an IL-6/STAT3-activated miRNA, directly targets PDCD4 to promote CRC cell proliferation and migration and to inhibit apoptosis in vitro and accelerate tumor growth in vivo. [score:6]
For miR-181b knockdown experiments, 200 pmol of miR-181b inhibitor or control inhibitor were added to each well. [score:6]
In this study, we showed that miR-181b was upregulated in CRC tissues and promoted cell proliferation and migration and suppressed cell apoptosis in vitro and accelerated tumor growth in vivo. [score:6]
miR-181b knockdown was achieved by transfecting CRC cells with miR-181b inhibitor, a chemically modified antisense oligonucleotide designed to target mature miR-181b. [score:6]
Such fold change is biologically and physiological relevant, because the altered miR-181b also inhibited PDCD4 expression in SW480 cells (Fig. S2B and S2C). [score:5]
Firefly luciferase reporters containing the wild-type (WT) or mutant (MUT) form of human PDCD4 3′-UTR were cotransfected into SW480 cells along with control mimic, miR-181b mimic, control inhibitor or miR-181b inhibitor. [score:5]
Because restoration of PDCD4 expression attenuated the growth-promoting effects of miR-181b, targeting of PDCD4 may be a mechanism by which miR-181b exerts its oncomiR function. [score:5]
Synthetic miR-181b mimic and inhibitor and scrambled negative control RNAs (control mimic and inhibitor) were purchased from GenePharma (Shanghai, China). [score:5]
miR-181b promotes CRC cell proliferation and migration and suppresses apoptosis by targeting PDCD4. [score:5]
Immunohistochemical staining also revealed lower PDCD4 levels in tumors from mice implanted with miR-181b -overexpressing cells, whereas tumors from the PDCD4 -overexpressing mice showed increased PDCD4 protein levels (Fig.   5F and 5G). [score:5]
If PDCD4 is truly a miR-181b target, the alteration of STAT3 levels would simultaneously affect PDCD4 expression through miR-181b. [score:5]
As anticipated, STAT3 siRNA and Stattic reduced miR-181b expression in CRC cells, while IL-6 treatment increased miR-181b expression (Fig.   3F). [score:5]
As shown in Supplemental Fig.  2A, the expression levels of mature miR-181b were found to be 3–4-fold higher than the basal levels when SW480 cells were infected with miR-181b overexpression lentivirus. [score:5]
miR-181b directly regulates PDCD4 expression at the post-transcriptional level. [score:5]
Likewise, PDCD4 overexpression attenuated the pro-proliferative effects of miR-181b overexpression (Fig.   5F and 5H). [score:5]
We transfected SW480 cells with miR-181b mimic or PDCD4 overexpression plasmid or co -transfected with miR-181b mimic and PDCD4 overexpression plasmid. [score:5]
As expected, miR-181b overexpression resulted in an approximately 70% reduction in luciferase reporter activity compared to cells transfected with control mimic, whereas miR-181b inhibition resulted in a 30% increase in reporter activity compared to cells transfected with the control inhibitor (Fig.   3E). [score:5]
Furthermore, overexpression of miR-181b by lentivirus also promoted cell proliferation and migration and inhibited cell apoptosis in SW480 cells (Fig. S2D–H), to the same degree as those obtained by using miR-181b mimic. [score:5]
We hypothesized that miR-181b promotes the CRC oncogenic process by inhibiting PDCD4 expression. [score:5]
Because a single miRNA can target hundreds of genes (Bartel, 2004), it is necessary to determine whether the effects of miR-181b on CRC cells are derived from miR-181b -mediated PDCD4 suppression. [score:5]
We searched for miRNAs that could target PDCD4 and experimentally validated miR-181b as a direct regulator of PDCD4. [score:5]
For the luciferase reporter assays, SW480 cells were cultured in 24-well plates, and each well was co -transfected with 0.2 µg of firefly luciferase reporter plasmid, 0.2 µg of β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (50 pmol) of miR-181b mimic, miR-181b inhibitor or the scrambled negative control RNAs using Lipofectamine 2000 (Invitrogen). [score:4]
We further examined the inverse correlation between miR-181b and PDCD4 by evaluating PDCD4 expression levels in human CRC cells after miR-181b overexpression or knockdown. [score:4]
Tumors from the miR-181b -overexpressing group showed a significant increase in mature miR-181b expression compared to tumors from the control group (Fig.   5C). [score:4]
Consistent with these results, miR-181 has also been reported to be upregulated in various human cancer types, including CRC (Nakajima et al., 2006; Xi et al., 2006; Schetter et al., 2008; Degagne et al., 2014; Liu et al., 2014), hepatocellular cancer (Wang et al., 2010a), breast cancer (Mansueto et al., 2010) and ovarian cancer (Parikh et al., 2014). [score:4]
H&E staining of xenograft tissues showed increased cell mitosis in the miR-181b lentivirus group and decreased mitosis in the PDCD4 plasmid group, whereas xenografts with both miR-181b and PDCD4 overexpression exhibited less cell mitosis compared to xenografts with miR-181b overexpression (Fig.   5F). [score:4]
Xenograft tumors from miR-181b -overexpressing group exhibited a significant increase in size and weight compared to the control group, whereas the sizes and weight of tumors in the group implanted with PDCD4 -overexpressing cells dramatically decreased (Fig.   5A and 5B). [score:4]
Fig.   3A demonstrates efficient miR-181b overexpression or knockdown in SW480 cells. [score:4]
The results again verify that miR-181b regulates PDCD4 expression and consequently affects cell proliferation, migration and apoptosis. [score:4]
miR-181b overexpression or knockdown only slightly affected PDCD4 mRNA levels (Fig.   3D). [score:4]
Thus, it is possible that targeting of miR-181b could control CRC development and ameliorate the symptoms, as shown by other groups (Krutzfeldt et al., 2005; Kota et al., 2009; Ma et al., 2010). [score:4]
The mutated luciferase reporter was not affected by miR-181b overexpression or knockdown (Fig.   3E). [score:4]
For example, PDCD4 is regulated by miR-21 (Li et al., 2014) and miR-183 (Yang et al., 2014), and miR-181b can simultaneously target WIF-1 (Ji et al., 2014) and CYLD (Iliopoulos et al., 2010). [score:4]
We subsequently investigated whether overexpression of miR-181b-resistant PDCD4 (PDCD4 ORF) was sufficient to rescue PDCD4 suppression by miR-181b and attenuated the pro-proliferation, pro-migration and anti-apoptotic effects of miR-181b on CRC cells. [score:3]
SW480 cells transfected with miR-181b mimic exhibited increased proliferation and migration; in contrast, miR-181b inhibition had the opposite effect on cell proliferation and migration (Fig.   4A, 4C and 4D). [score:3]
There was perfect base-pairing between the seed region (the core sequence that encompasses the first 2–8 bases of the mature miRNA) and the cognate target, and the miR-181b binding sequence in the PDCD4 3′-UTR was highly conserved across species (Fig.   2A). [score:3]
miR-181b promotes CRC growth in vivo by targeting PDCD4. [score:3]
Additionally, PDCD4 overexpression attenuated the growth-promoting effects of miR-181b (Fig.   5A and 5B), suggesting that miR-181b promotes tumor growth by silencing PDCD4. [score:3]
miR-181b overexpression was achieved by transfecting CRC cells with a miR-181b mimic, a synthetic double-stranded RNA oligonucleotide mimicking the miR-181b precursor. [score:3]
These results are consistent with the in vitro findings, which firmly validated the oncomiR role of miR-181b in CRC tumorigenesis through targeting of PDCD4. [score:3]
We transfected the resulting plasmid into SW480 cells along with the miR-181b mimic, miR-181b inhibitor or scrambled negative control RNAs. [score:3]
In summary, this study identified for the first time that miR-181b can target PDCD4 to promote CRC tumorigenesis. [score:3]
Figure 2Identification of PDCD4 as a miR-181b target. [score:3]
For miR-181b overexpression experiments, 200 pmol of miR-181b mimic or control mimic were added to each well. [score:3]
Future research on miR-181b and PDCD4 will provide us more knowledge about CRC and pave new approaches for molecular therapeutics for this disease. [score:3]
In this study, we showed that STAT3 suppressed PDCD4 through miR-181b activation. [score:3]
miR-181b was reported to be significantly overexpressed in CRC (Nakajima et al., 2006; Xi et al., 2006; Schetter et al., 2008; Degagne et al., 2014; Liu et al., 2014) and is associated with the poor prognosis of CRC patients (Schetter et al., 2008), indicating that miR-181b may be involved in the pathogenesis of CRC as an oncogene. [score:3]
A 300-bp fragment containing the miR-181b genomic sequence was obtained by PCR amplification of human DNA and cloned into a lentiviral expression vector. [score:3]
Identification of PDCD4 as a miR-181b target. [score:3]
Thus, whether miR-181b functions as an oncogene or a tumor suppressor is dependent on the cell and tumor types, and miR-181b may exert different functions under different circumstances. [score:3]
The percentage of apoptotic cells was significantly lower in SW480 cells transfected with miR-181b mimic and higher in cells transfected with miR-181b inhibitor compared to control cells (Fig.   4F and 4G). [score:2]
Therefore, we considered PDCD4 to be a miR-181b target based on computational prediction and the inverse correlation between miR-181b and PDCD4 protein levels in human CRC tissues. [score:2]
Thus, the molecular mechanism underlying the contribution of miR-181b to CRC development and progression needs to be fully elucidated. [score:2]
Although PDCD4, miR-181b and IL6/STAT3 signaling pathway are tightly associated with CRC carcinogenesis, it is necessary to explore their relationship and uncover the regulatory network constituted by them. [score:2]
As expected, cells co -transfected with the miR-181b mimic and PDCD4 overexpression plasmid showed significantly lower proliferation rates (Fig.   4B) and migration capabilities (Fig.   4C and 4E) and higher apoptosis rates (Fig.   4H and 4I) compared to cells transfected with miR-181b mimic alone. [score:2]
Thus, this study delineates a novel regulatory network employing IL-6/STAT3, miR-181b and PDCD4 as an integrated feedback loop to fine-tune cell function in colorectal cells. [score:2]
One interesting example is that STAT3 directly activates transcription of miR-21 and miR-181b during the transformation process (Iliopoulos et al., 2010). [score:2]
We next constructed a mutant plasmid by introducing point mutations into the miR-181b binding site in the PDCD4 3′-UTR to eliminate miR-181b binding ability. [score:2]
It is necessary to find out the upstream regulator of miR-181b in CRC. [score:2]
Thus, miR-181b and PDCD4 have opposing effects on cell proliferation, migration and apoptosis in CRC. [score:1]
We identified miRNAs in the miR-181 family as the top candidates. [score:1]
We measured miR-181b levels in the same 14 pairs of CRC tissues and corresponding normal tissues and found that the miR-181b levels were consistently higher in CRC tissues (Fig.   2B), which was consistent with the idea that miRNA levels are inversely correlated to the levels of their targets. [score:1]
A 378-bp fragment of the PDCD4 3′-UTR containing the presumed miR-181b binding site was amplified by PCR with human genomic DNA as a template. [score:1]
miR-181b promotes CRC growth in vivo by targeting PDCD4Finally, we investigated the effects of miR-181b and PDCD4 on the growth of CRC xenografts in mice. [score:1]
The predicted interaction between miR-181b and PDCD4 3′-UTR is illustrated in Fig.   2A. [score:1]
Thus, we used miR-181b for further experimentation. [score:1]
Figure 4Effects of miR-181b and PDCD4 on CRC cell proliferation, migration and apoptosis. [score:1]
Thus, we constructed a lentivirus to produce functional intracellular miR-181b via the endogenous miRNA processing pathway. [score:1]
During the CRC oncogenic process, miR-181 can promote tumor growth and metastasis (Ji et al., 2014) and is tightly associated with a poor prognosis (Nishimura et al., 2012) and the chemoresponse of CRC patients (Nakajima et al., 2006). [score:1]
It has been previously reported that the CRC-related transcription factor STAT3 (Morikawa et al., 2011; Pradhan et al., 2012) can activate miR-181b (Iliopoulos et al., 2010; Degagne et al., 2014). [score:1]
For comparison, the luciferase activity in the control cells was set as 1. (F) Quantitative RT-PCR analysis of miR-181b levels in SW480 cells treated with control siRNA, STAT3 siRNA, DMSO, Stattic or IL-6. (G and H) Western blot analysis of PDCD4 protein levels in SW480 cells treated with control siRNA, STAT3 siRNA, DMSO, Stattic or IL-6. G: representative images; H: quantitative analysis. [score:1]
There are four miR-181 family members (miR-181a/b/c/d) encoded by three independent transcripts on three separate chromosomes. [score:1]
More research emphasis is required to characterize the feasibility of targeting miR-181b in CRC therapy and to develop simplified and cost-effective manipulation methods. [score:1]
Overall the findings of ours and others highlight distinguishing characteristics of miR-181b in both promoting and suppressing colorectal tumorigenesis. [score:1]
microRNA colorectal cancer miR-181b PDCD4 Colorectal cancer (CRC) is a major worldwide health problem due to its high prevalence and mortality rate. [score:1]
We further illustrated the inverse correlation between miR-181b and PDCD4 protein levels (Fig.   2C) and the disparity between the miR-181b and PDCD4 mRNA levels (Fig.   2D) using Pearson’s correlation scatter plots. [score:1]
The percentage of Ki-67 -positive tumor cells was increased in the group implanted with miR-181b lentivirus and decreased in the group implanted with PDCD4 plasmid (Fig.   5F and 5H). [score:1]
For miR-181a/b, the minimum free energy value of the hybrid between miR-181b and the conserved binding site on the PDCD4 3′-UTR is -17.4 kcal/mol and is lower than that of miR-181a (−16.2 kcal/mol), suggesting that miR-181b may bind more tightly to PDCD4 3′-UTR than miR-181a. [score:1]
Among the miRNAs correlated with tumorigenesis, miR-181b is one of the most important. [score:1]
To test binding specificity, sequences that interacted with the miR-181b seed sequence were mutated from GAATGT to CTTACA, and the synthetic PDCD4 3′-UTR mutant fragment was inserted into an equivalent reporter plasmid. [score:1]
The miR-181b seed region and the seed sequence of its binding site in the PDCD4 3′-UTR are indicated in red. [score:1]
Figure 5Effects of miR-181b and PDCD4 on the growth of CRC cell xenografted tumors in mice. [score:1]
[1 to 20 of 93 sentences]
4
[+] score: 239
The data showed that OGD treatment causes the same gene expression trend of neuronal cell as MCAO mice, in which showed upregulation of MEG3 (Figure 1D), downregulation of miR-181b (Figure 1E), and upregulation of 12/15-LOX in a time -dependent manner (Figure 1F). [score:12]
that support this proposal are that miR-181b is upregulated with the MEG3 knockdown under hypoxia condition; and in normal condition, expression of miR-181b is suppressed by MEG3 overexpression. [score:11]
Accordingly, MEG3 overexpression brings about inhibitory expression of miR-181b (Figure 2E) and enhances expression of 12/15-LOX mRNA and protein (Figure 2F). [score:9]
Based on the above data suggesting a link between abnormal miR-181b level and 12/15-LOX expression, we further test whether miR-181b manipulation by siRNA knockdown or recombination plasmid transfection may directly regulate 12/15-LOX expression. [score:8]
We observed that the MEG3 is gradually upregulated, whereas miR-181b is gradually downregulated in both brain and HT22 cell with increasing time of hypoxia. [score:7]
The data showed that miR-181b was upregulated and expression of 12/15-LOX mRNA and protein was suppressed in animals with si-MEG3 injection compared with si-NC (Figures 5D,E). [score:7]
12/15-LOX also serves as a target gene for miR-181b and its expression is inhibited via gene being integrated by miR-181b as shown in Figure 4A. [score:7]
We observed that co-overexpression of MEG3 and miR-181b contributes to inhibitory effect of MEG3 on 12/15-LOX expression (Figure 3E), as well as abrogates pro-apoptosis action of MEG3 (Figure 3F). [score:7]
Figure 4B showed that fluorescence activity of 12/15-LOX is reduced by miR-181b overexpression; accordingly, relative expression of 12/15-LOX is suppressed. [score:7]
Moreover, miR-181 is showed to be involved in synaptic plasticity and memory processing of Alzheimer's disease mice via targeting functional gene expression (Rodriguez-Ortiz et al., 2014). [score:7]
In particular, hypoxia-stimulated downregulation of miR-181b and upregulation of 12/15-LOX was partly recovered (Figures 2B,C). [score:7]
The data showed that, at 6, 12, and 24 h post mo del establishment, relative expression level of MEG3 is increased in a time -dependent manner (Figure 1A), whereas miR-181b is time -dependently downregulated (Figure 1B). [score:6]
In addition, our data showed that the physical abnormal 12/15-LOX expression is positively affected by genetic silencing or activation of lncRNA MEG3, whereas negatively regulated by aberrant expression of miR-181b. [score:6]
We further investigated the effect miR-181b inhibitor on 12/15-LOX transcriptional activity and expression in Figure 4C, which showed knock down of miR-181b contributes enhancement of fluorescence activity of 12/15-LOX, as well as promotes 12/15-LOX expression (Figure 4C). [score:6]
Downregulation of miR-181b in mouse brain following ischemic stroke induces neuroprotection against ischemic injury through targeting heat shock protein A5 and ubiquitin carboxyl-terminal hydrolase isozyme L1. [score:6]
Specially, 12/15-LOX is consequently downregulated by miR-181b overexpression under hypoxia condition (Figure 3B). [score:6]
Relative expression of (D) MEG, (B) miR-181b, and (E) 12/15-LOX, and (F) 12/15-LOX protein expression were determined. [score:5]
On the contrary, RNA interference of miR-181b by miR-181b inhibitor culture under normal culture conditions effectively promotes expressions of HT22 cell apoptosis (Figure 3C) and 12/15-LOX (Figure 3D). [score:5]
We also found that 12/15-LOX overexpression abrogated anti-apoptosis action of miR-181b overexpression (data not shown). [score:5]
MiR-181b-5p downregulates NOVA1 to suppress proliferation, migration and invasion and promote apoptosis in astrocytoma. [score:5]
After a series of 6, 12, and 24 h animal establishment, quantitative RT-PCR was performed to determine the relative expression of (A) MEG3, (B) miR-181b, and (C) 12/15-LOX mRNA; (C) representative blots of 12/15-LOX protein expression by. [score:5]
Relative expression of MEG3 and 12/15-LOX mRNA was normalized to GAPDH, and relative expression of miR-181b was normalized to U6. [score:5]
The present data showed that knockdown of MEG3 or miR-181b overexpression can separately attenuate hypoxia-caused HT22 cell apoptosis. [score:4]
Upregulation of miR-181 decreases c-Fos and SIRT-1 in the hippocampus of 3xTg-AD mice. [score:4]
Considering the establishment that downregulation of miR-181b of neuronal cell in response to hypoxia, the exploration to determine whether miR-181b may also play a role in the progress of hypoxia -induced neuronal cell apoptosis is particularly important. [score:4]
For miR-181b knockdown, HT22 cells were transfected with MISSION® Synthetic microRNA Inhibitor (Sigma-Aldrich) for miR-181b with negative control (NC) as control. [score:4]
Figure 4 Manipulation of cellular miR-181b regulates12/15-LOX expression in HT22 cell. [score:4]
miR-181b regulates 12/15-LOX expression in HT22 cell. [score:4]
Moreover, downregulation of miR-181b can protect middle cerebral artery occlusion (MCAO) -induced ischemic injury of mice brain (Peng et al., 2013). [score:4]
In addition, accumulated studies have demonstrated that miR-181b plays multifunctional roles in brain disease. [score:3]
This contradictory effect of miR-181b with previous study (Peng et al., 2013) may be by reason of experiments with different neural cell lines and distinction of target gene for miR-181b. [score:3]
Examination of (D) relative expression of miR-181b and (E) 12/15-LOX in infract site. [score:3]
The amount of firefly luciferase activity was presented as the increase or decrease (n-fold) relative to the value for the sample lacking the miR-181b or overexpressing miR-181b. [score:3]
Expression level of (B) miR-181b and (C) 12/15-LOX mRNA and protein were determined. [score:3]
Previously, the MEG3 and miR-181b works have been confirmed to be involved in cerebral disease. [score:3]
This data suggested the expressional negative correlation between MEG3 and miR-181b in response to brain hypoxia. [score:3]
To be noted, study has pointed out that MEG3 serves as a competing endogenous RNA for miR-181 in other disease mo del. [score:3]
HT22 cells were co -transfected with miR-181b mimic or miR-181b inhibitor or negative control and pGL3-12/15-LOX luciferase construct. [score:3]
For miR-181b overexpression, the cells were transfected with miRIDIAN Mimics for miR-181b (Dharmacon) as compared with pre -negative control (pre-NC). [score:2]
miR-181 regulates GRP78 and influences outcome from cerebral ischemia in vitro and in vivo. [score:2]
Primers for MEG3, 12/15-LOX mRNA, miR-181b are as follows: MEG3: 5′-CTGCCCATCTACACCTCACG-3′ (sense) and 5′-CTCTCCGCCGTCTGCG CTAGGGGCT-3′ (antisense) 12/15-LOX: 5′-ACCCCACCGCCGATTTT-3′ (sense) and 5′- AGCTTCGGACCCAGCATTT-3′ (antisense) miR-181b: 5′-CAGACATCTCTGCCTCACA-3′(sense) and 5′-TTGCGGTTCTGTCTTCAGC-3′ (antisense) Cells were lysed in RIPA buffer containing mixture proteinase inhibitor. [score:2]
MiR-181 suppressed proliferation, migration, and invasion of astrocytoma and was proved to be involved in neuroinflammatory responses of astrocytes (Hutchison et al., 2013; Zhi et al., 2014). [score:2]
Basing on our data and online reference, we proposed that MEG3 might function as a regulator for miR-181 in ischemic neuron. [score:2]
As indicated in above data, both MEG3 and miR-181b function as the key regulators for hypoxia -induced HT22 cell apoptosis. [score:2]
This data suggested the critical role of MEG3 and miR-181b in the development of ischemic apoptosis of neuron. [score:2]
We analyzed the cell apoptosis in miR-181b mimic transfected cells in Figure 3A, where showed that miR-181b overexpression significantly reduced cell apoptosis percentage as compared with pre -negative control treatment. [score:2]
Evidence for miR-181 involvement in neuroinflammatory responses of astrocytes. [score:1]
MiR-181b is a multifunction miRNA in brain. [score:1]
Interestingly, our data support this by showing that 12/15-LOX is the responsive functional protein for MEG3/miR-181b. [score:1]
Meanwhile, during cerebral pathological injury, 12/15-LOX is the responsive protein for this lncRNA MEG3/miR-181b axis. [score:1]
These data suggested that 12/15-LOX serves as a final responder for MEG3/miR-181b and mediates hypoxia -induced apoptosis of neuron. [score:1]
Interestingly, MEG3 has been recognized as a competing endogenous RNA for miR-181 in other experiments (Peng et al., 2015). [score:1]
In summary, our present study is for the first time to demonstrate that lncRNA MEG3 functions as a competing endogenous RNA for miR-181b and this interaction plays an important role in ischemia-caused neuronal cell apoptosis. [score:1]
In present study, we were the first to determine the functional interaction between MEG3 and miR-181b in cerebral hypoxia injury. [score:1]
Cells were then co -treated with pcDNA-MEG3 and miR-181b mimic. [score:1]
Functional interaction of MEG3 and miR-181b affects hypoxia -induced HT22 cell apoptosis. [score:1]
By predicating in bioinformatics software, we observed that complementary sequences of miR-181b in 12/15-LOX 3′-UTR (Figure 4A). [score:1]
Our data described a global time dependent analysis of the levels of hippocampal MEG3 and miR-181b during cerebral ischemia and in OGD-cultured hippocampal HT22 cell line in periods of 6, 12, and 24 h post hypoxia condition. [score:1]
As for brain ischemia, miR-181 contributes to astrocyte, a neuroprotective cell for brain ischemia (Ouyang et al., 2014), cell apoptosis in ischemic injury brain and in vitro glucose deprivation cultured astrocyte (Ouyang et al., 2012). [score:1]
HT22 cells were pre -treated with miR-181b mimic or pre-NC before exposed to glucose deprivation. [score:1]
We observed that miR-181b effectively reverses pro-apoptosis action of MEG3 in HT22 cells and this data suggested the possible neuroprotective action of miR-181b. [score:1]
Furthermore, the functional interaction of MEG3 and miR-181b is reflected in experienced pcDNA-MEG3 and miR-181b co -transfected HT22 cell. [score:1]
Figure 3 Functional interaction of MEG3 and miR-181b mediates HT22 cell apoptosis. [score:1]
Also cells were transfected with pcDNA-MEG3 or pcDNA empty plasmid for 24 h. (D) Cell apoptosis, expression level of (E) miR-181b and (F) 12/15-LOX mRNA and protein were evaluated. [score:1]
To confirm the downstream miR-181b/12/15-LOX pathway of MEG3, we next determined miR-181b and 12/15-LOX in infract position. [score:1]
[1 to 20 of 65 sentences]
5
[+] score: 169
miR-181 overexpression down-regulates endogenous MADD expression. [score:8]
These findings show that miR-181a and miR-181b can suppress the endogenous levels of DENN/MADD while only miR-181b inhibitor can increase DENN/MADD expression. [score:7]
Studies on human glioma and glioma cell lines have shown decreased expression of miR-181 family members together with apoptosis induction and tumor growth inhibition following miRNA overexpression [41, 42]. [score:7]
Furthermore, miR-181b inhibitor was effective in up -regulating DENN/MADD expression. [score:6]
ANOVA, Tukey post hoc (**p≤0.01 relative to negative control) We next studied the effect of miR-181a and miR-181b expression on endogenous mRNA expression and protein level of DENN/MADD using L929 mouse fibroblast cell line. [score:5]
These finding verify the interaction between miR-181b mature miRNA sequences with MADD’s 3'UTR, and raise the possibility that increased miRNA expression can lead to reduced MADD expression in cells. [score:5]
Transfection efficiency was assessed by expression analysis of microRNAs in transfected cells with miR-181a and miR-181b and also by monitoring green fluorescent protein (GFP) expression using fluorescence microscope. [score:5]
Aberrant expression of miR-181 in neurodegenerative disease like multiple sclerosis has also been reported in previous studies [15, 17]. [score:5]
Bioinformatics analysis using miRNA target prediction algorithms (including TargetScan) has shown that the 3’ UTR of the DENN/MADD molecule might include a potential binding site for miR-181a and miR-181b both in human and mouse. [score:5]
Overall, these data point to the possibility that mir-181b overexpression can enhance cell death induced by TNF-α, an effect which might be mediated through suppression of TNF signaling adaptor molecules. [score:5]
We next analyzed the impact of enhanced miR-181a and miR-181b expression on TNF -induced mitochondrial membrane potential alterations, Bcl2 family member expression levels and eventually cell death in L929 cells exposed to TNF-α. [score:5]
Additionally, extensive increase of miR-181a and miR-181b expression levels confirmed efficiency of microRNAs over expression (S2B and S2C Fig). [score:5]
Considering the role of Bcl2 family members in regulating the mitochondrial membrane potential, we next analyzed the expression of pro-apoptotic Bax and anti-apoptotic Bcl-2 molecules following miR-181a and miR-181b transfection. [score:4]
miR-181 upregulation enhances TNF -induced apoptosis. [score:4]
Among the microRNAs which are predicted to target DENN/MADD, we focused on miR-181 family members because of their implication in regulating apoptosis pathways and their broad conservation across species. [score:4]
D) Bax/Bcl-2 ratio following overexpression of miR-181a and miR-181b. [score:3]
Transfection of cells with miR-181b led to further suppression of TMRE fluorescence, indicating the enhancement of TNF -induced mitochondrial changes (Fig 4B and 4C). [score:3]
miR-181b overexpression decreases cell mitochondrial membrane potential. [score:3]
L929 cells were transfected with miR-181a or miR-181b mimics or inhibitors sequences as described in Materials and Methods. [score:3]
L929 cells were transfected with miR-181a, miR-181b mimics, inhibitors and negative control (50nM) for 24 or 48 hours. [score:3]
0174368.g003 Fig 3 L929 cells were transfected with miR-181a, miR-181b mimics, inhibitors and negative control (50nM) for 24 or 48 hours. [score:3]
B) miR-181a, C) miR-181b expression levels after transfection with miR-181a and miR-181b mimics are shown. [score:3]
B) The miR-181a and miR-181b sequence alignments with their predicted target site in 3’UTR of MADD mRNA are presented. [score:3]
To examine whether miR-181a or miR-181b expression might affect mitochondrial membrane potential following TNF treatment, we performed flow cytometric analysis on L929 cells transfected with miRNA or control sequences using TMRE dye, which labels active mitochondria inside the cells. [score:3]
DENN/MADD transcripts are targeted by miR-181. [score:3]
Other studies on astrocytes have shown increased resistance to apoptosis following miR-181 reduction likely through altered expression of Bcl-2 family members. [score:3]
Cultured L929 cells transfected with miR-181a and miR-181b mimics, inhibitors or negative control sequences (50nM) were treated with TNF-α (50 ng/mL) for 12 h. A) Representative flow cytometry graphs after double staining with Annexin V-FITC and propidium iodide. [score:3]
0174368.g005 Fig 5Cultured L929 cells transfected with miR-181a and miR-181b mimics, inhibitors or negative control sequences (50nM) were treated with TNF-α (50 ng/mL) for 12 h. A) Representative flow cytometry graphs after double staining with Annexin V-FITC and propidium iodide. [score:3]
Gene ontology analysis on the putative targets of miR-181 also indicates the involvement of this microRNA in cellular death processes (S4 Fig). [score:3]
We finally investigated whether overexpression or inhibition of miR-181a or miR-181b might affect TNF-α induced apoptosis in L929 cells. [score:3]
Protein levels of DENN/MADD changed significantly in transfected cells, decreasing in the presence of miR-181a and miR -181b mimics and increasing after transfection with miR-181b inhibitor (Fig 3B). [score:3]
On the contrary, miR-181b inhibition reduced the cell death following TNF-α treatment. [score:3]
Suppression of DENN/MADD could explain the resulting enhancement in TNF mediated apoptosis, however, the possibility remains that miR-181 might also affect other apoptosis mediators downstream of TNF receptor and its adaptor molecules. [score:3]
DENN/MADD is a target gene for miR-181b. [score:3]
miRNA transfection studies were then carried out to determine the effect of miR-181a and miR-181b overexpression on endogenous DENN/MADD levels in L929 cells, a murine fibroblast cell line which is sensitive to TNF -induced apoptosis. [score:3]
Quantitative analysis of Bax and Bcl-2 mRNA expression was also performed post TNF- α treatment (30 minutes) using Real time PCR A) TMRE histogram of untreated and TNF-α treated cells B) Representative flow cytometry plots of transfected cells with miRNA mimics following TNF-α exposure C) Geo mean fluorescent intensity of transfected cells with miR-181a and miR-181b mimics and negative control. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
In silico analysis of target mRNAs for miR-181a, miR-181b. [score:3]
In this study, we explored the potential interactions between miR-181a or miR-181b miRNA species with DENN/MADD adaptor molecule, and their subsequent effects on TNF -mediated cell death. [score:1]
Homology between miRNA binding site at 3’UTR of MADD between human and mouse D) miR-181a and miR-181b mature miRNA sequences homology in human and mouse. [score:1]
0174368.g004 Fig 4Following transfection of L929 cells with miR-181a, miR-181b mimics and negative control miRNA mimic (50nM) for 24 hours, cells were treated by TNF-α (50ng/ml) for 3 hours and then stained with TMRE. [score:1]
We also provide experimental findings indicating alteration of mitochondrial membrane potential in L929 cells following miR-181 mimic transfection. [score:1]
miR-181 repress DENN/MADD mRNA levels in L929 cells. [score:1]
miR-181 family of miRNAs is a broadly conserved group of miRNAs and its members have been revealed to influence different aspects of cell biology, including cell proliferation, differentiation and death [18– 23]. [score:1]
Transfection with miR-181b significantly enhanced the rate of apoptosis induced by TNF-α after 12 hours of treatment, as detected by PI/Annexin V double positive cells. [score:1]
Cells were first transfected with 50nM of oligonucleotides (including miR-181a and miR-181b mimics, anti-miR-181a and anti-miR-181b, negative control for 24 hours and then exposed to TNF-α (50ng/ml). [score:1]
Bioinformatics analyses show the conserved sequence of miR-181a and miR-181b between human and mouse and a potential conserved binding site on the 3’ UTR of DENN/MADD (Fig 1). [score:1]
While Bax/Bcl-2 ratio was significantly increased following miR-181b transfection, the ratio did not show a significant difference for miR-181a transfection (Fig 4D). [score:1]
Following transfection of L929 cells with miR-181a, miR-181b mimics and negative control miRNA mimic (50nM) for 24 hours, cells were treated by TNF-α (50ng/ml) for 3 hours and then stained with TMRE. [score:1]
Co-transfection of HEK293T cells with vectors encoding the 3'UTR of DENN/MADD ligated to the Renilla luciferase with microRNA mimic sequences and negative control sequence showed significant decrease of luciferase activity in cells transfected with miR-181 b mimic sequences. [score:1]
Melting curve plots for actin, DENN/MADD, Bcl-2, Bax, Snord68, miR-181a and miR-181b genes. [score:1]
Experiments were performed to verify the interaction between miR-181a or miR-181b with the 3' UTR of DENN/MADD. [score:1]
miR-181b increases TNF-α -induced apoptosis. [score:1]
Psicheck vector containing the 3'UTR of MADD mRNA was co -transfected along with miR-181a or miR-181b mimic sequences or negative control into HEK293T cells. [score:1]
miR-181a and miR-181b mimicsand negative control were purchased from Qiagen. [score:1]
In the current study, we show experimental evidence pointing to the regulation of DENN/MADD by miRNA-181 through luciferase assays and transfection experiments. [score:1]
miR-181b decreases mitochondrial membrane potential. [score:1]
Enhanced TNF-α induced apoptosis was observed in miR-181b -transfected cells, while miR-181b antagomir sequences reduced apoptosis. [score:1]
[1 to 20 of 58 sentences]
6
[+] score: 167
Finally, miR-181b has a pathogenic role in CLL: it is down-regulated in human CLL [39, 40] and its down-regulation has been associated with disease progression [38, 52]. [score:9]
The down-regulation of non-phosphorylated Akt protein was induced by miR-181b, but not anti-TCL1 siRNA, suggesting that either a direct or an indirect targeting by miR-181b had occurred. [score:8]
Here, we explored how the enforced expression of miR-181b, which is down-regulated in human CLL [39, 40] and has been associated with disease progression [38, 52], could affect the viability of leukemic cells developing in the Eμ-TCL1 mo del. [score:8]
Overall, the pathways affected by miR-181b are highly relevant for CLL pathogenesis, and the simultaneous inhibition of Akt and MAPK pathways, together with the repression of anti-apoptotic proteins such as TCL1, Bcl2 and Mcl1, appears to represent a wide and highly effective panel of targets for achieving a strong therapeutic effect, as shown by the fact that several of these pathways are targeted by some of the newly available drugs against CLL [71]. [score:7]
However, the simple down-regulation of TCL1, achieved through the use of anti-TCL1 siRNA, did not achieve the level of apoptosis induced by miR-181b in EHEB cells and mouse leukemic cells derived from the TCL1-tg mouse, indicating the existence of relevant targets other than TCL1 that are important in mediating biological effects. [score:6]
Our results showed that miR-181b could down-regulate TCL1 in malignant B-cell lines with high expression of endogenous TCL1. [score:6]
In addition, because of the known role of Tcl1 in Akt activation [55], miR-181b and anti-TCL1 siRNA were both likely responsible for the down-regulation of p-Akt, which was in turn responsible for the reduction of p-Bad. [score:4]
Having identified miR-181b as the most consistent regulator of TCL1 expression among those tested, we assessed its effects on cell viability. [score:4]
We confirmed this hypothesis by showing the ability of miR-181b to down-regulate TCL1 protein similarly to anti-TCL1 siRNA in TCL1-tg leukemic splenocytes (Figure 1D). [score:4]
As shown earlier, miR-181b could efficiently down-regulate TCL1 protein similarly to anti-TCL1 siRNA. [score:4]
This finding suggested that the biological effects of miR-181b were mediated by mechanisms other than, or in addition to, TCL1 down-regulation. [score:4]
miR-181b down-regulates TCL1 and reduces viability in human and mouse malignant B cells. [score:4]
Indeed, miR-181b shares the down-regulation of TCL1 with anti-TCL1 siRNA, but the effects on MCL1, BCL2, Akt and p-Erk were mainly or only induced by miR-181b. [score:4]
miR-181b induced a 60-70% reduction in Akt and phospho-Akt levels; conversely, anti-TCL1-siRNA did not affect Akt levels and we detected only a slight p-Akt reduction, which was likely due to the down-regulation of TCL1, a well-known activator of Akt [55]. [score:4]
B. showing the TCL1 down-regulation following miR-181b transfection (in RAJI cells, the shown lanes were from the same blot, but not originally next to each other). [score:4]
miR-181 and miR-29 could down-regulate TCL1, Mcl1, Bcl2 and Bcl2L11 [46- 48]. [score:4]
ERK1/2 was not directly targeted by miR-181b, as shown by the unaffected level of non-phosphorylated ERK, but the cross-talk between Ras/MEK/ERK and PI3K/AKT pathways, reported in many tumors [68- 70], suggested that the down-modulation of Akt could also influence Erk phosphorylation. [score:4]
Similarly to CLL patients [46], an inverse correlation between miR-181b expression and TCL1 protein levels was observed in TCL1-tg leukemic splenocytes (Supplementary Figure S4C), suggesting the existence of miR-181b regulation of TCL1 protein in these cells as well. [score:4]
It was previously demonstrated that miR-29b and miR-181b could down-modulate TCL1 protein expression in HEK293 cells [46], but the same results have not been yet reported in B cells. [score:3]
Thus, in vitro results in both mouse and human cells showed that enforced miR-181b expression exerts a broad range of actions, affecting proliferative, survival and apoptotic factors, and indicated the appropriateness of the TCL1-tg mouse mo del for testing miR-181b as a therapeutic agent against mouse leukemic cells in vivo. [score:3]
The results of in vivo experiments did not attain leukemia regression, but significantly slowed the disease, thus demonstrating an in vivo anti-leukemic activity of miR-181b that was clearly detectable after 3 weeks of treatment. [score:3]
The use of miR-181b against leukemia that develops in the Eμ-TCL1 mouse mo del may present a potential drawback, as it may be argued that the anti-leukemic effect of miR-181b is effective only against the leukemic cells of this mo del because they are driven by TCL1, which is a miR-181b target. [score:3]
Viability and apoptotic effects following mir-181b enforced expression in human RAJI and EHEB cells and in mouse TCL1-tg leukemic splenocytes. [score:3]
In the first case, after miR-181b restoration, molecular analyses revealed a broad pattern of inhibition on important pathways involved in CLL. [score:3]
We next analyzed the expression of miR-181b and TCL1 protein levels in cells isolated from the spleen of individual 12- to 16-months old TCL1-tg mice with overt leukemia (Supplementary Figure S4A-B). [score:3]
From our analyses, miR-181b appeared to be the strongest TCL1 inhibitor among members of the miR-181 or miR-29 families. [score:3]
Mean values of six independent experiments were expressed as the ratio of miR-181b (black) versus control transfected cells and compared with those obtained by using anti-TCL1 siRNA (gray) (* P < 0.05 ** P < 0.01). [score:2]
In the second case, improved efficiency and specificity in the delivery approach might enhance miR-181b anti-leukemic activity. [score:1]
Figure 1 A. RAJI (black bars) and EHEB (gray bars) cells were transfected with miR-181b. [score:1]
In addition, miR-181b was similarly effective in mice transplanted with leukemic cells with either high or low Tcl1 levels. [score:1]
Here, we found that PEI significantly improves the delivery of miR-181b to the spleen in comparison with mimic alone, but margins of progress may still exist. [score:1]
We quantified protein levels by Western blotting in mouse leukemic splenocytes transfected with miR-181b or anti-TCL1 siRNA (Figure 2A). [score:1]
Akt and MAPK pathways were also analyzed after miR-181b or anti-TCL1 siRNA transfection. [score:1]
Conversely, Mcl-1 and Bcl2, two anti-apoptotic factors, were both down-modulated by miR-181b (about 70% and 50%, respectively), whereas anti-TCL1 siRNA induced only a slight reduction in MCL1 (about 20%) and had no effect on BCL2. [score:1]
Moreover, miR-181b was able to modulate the MAPK pathway through a marked down-modulation of phosphorylated active ERK1/2, a key factor in promoting proliferation signals through the MAPK pathway, which contributes to leukemia and is involved in drug resistance [65- 67]. [score:1]
D. TCL1 Western blot analysis of splenocytes after 72 h of transfection with anti-TCL1 siRNA or miR-181b or control (ctrl). [score:1]
Thus, compared with anti-TCL1-siRNA, miR-181b has a wider capacity to regulate proteins implicated in cell survival, which could explain the major effects of the miRNA on cell apoptosis and viability in TCL1-tg mouse leukemic cells. [score:1]
The densitometric ratio miR-181b/ctrl is shown at right. [score:1]
A. Immunoblotting analysis of Mcl1, Bcl2, phospho-Akt (p-Akt), Akt, phospho-ERK1/2 (p-ERK1/2), ERK1/2, IkBα, and PARP (cleaved form, cPARP) in leukemic splenocytes after transfection with miR-181b or anti-TCL1 siRNA or negative control (ctrl). [score:1]
A. RAJI (black bars) and EHEB (gray bars) cells were transfected with miR-181b. [score:1]
In RAJI cells, miR-181b induced a 1.5- and 1.6-fold increase in early and late apoptosis, respectively. [score:1]
We also found a marked reduction of phospho-ERK (65%), despite there being an increase in ERK protein in miR-181b transfected cells. [score:1]
miR-181b slows leukemia in the CLL mouse mo del. [score:1]
Hence, these arguments make it conceivable that the therapeutic effects observed following the restoration of miR-181b represent a general mechanism that is not limited to the leukemic cells of the Eμ-TCL1 mo del. [score:1]
At this stage, mice were randomized into three groups (average LE in each group = 0.1): 9 mice were treated with miR-181b, 9 mice were treated with scrambled negative control and 15 mice were left untreated. [score:1]
A reduction of normal B population is notable in peripheral blood in the presence of high LE, which was due to the replacement of normal with malignant cells [30], rather than to detection failure or side-effects related to miR-181b treatment (Supplementary Figure S6). [score:1]
miR-181b modulates key factors involved in CLL. [score:1]
Prior to administration, miR-181b or negative control mimics (Axolabs, Germany) were assembled in a complex with in vivo jetPEI (Polyplus-Transfection SA, France), using a nitrogen-to-phosphate ratio of 8, as recommended by the manufacturer. [score:1]
These findings, in line with other studies in which synergistic activity of miR-181b with fludarabine was observed in human primary CLL cells [63], add novel additional evidence for a potential role of miR-181b as a therapeutic agent in CLL. [score:1]
The images show clear differences between miR-181b -treated mice and controls. [score:1]
miR-181b modulates several pathways involved in CLL. [score:1]
Specificity of miR-181b activity was further confirmed by anti-miR-181b, which induced an increment in the TCL1 protein level (Supplementary Figure S2). [score:1]
In accordance with preliminary analyses (Supplementary Figure S5), mice were treated with 80 μg of miR-181b twice a week for three consecutive weeks. [score:1]
B. Representative plots of pre-treatment leukemia onset and post-treatment untreated mice, negative control (ctrl) or miR-181b -treated mice. [score:1]
The densitometric ratio between miR181b (black bars) or anti-TCL1 siRNA (gray bars) and the respective control (dashed line) is shown at right. [score:1]
The differences in delta LE values between miR-181b -treated and untreated mice or between miR-181b -treated and negative control -treated mice were both statistically significant (P = 0.005 and P = 0.04, respectively), whereas the differences between negative control -treated and untreated mice were not significant (P = 0.30). [score:1]
Notably, however, miR-181b reduced cell viability and increased apoptosis to a much higher extent than did anti-TCL1 siRNA (Figure 1C). [score:1]
B. Kaplan-Meier survival curves for the three groups, miR-181b -treated (solid line), negative control (neg ctrl) -treated (dashed line) or untreated mice (dotted line) were also assessed. [score:1]
miR-181b reduced the viability of mouse malignant cells to 50% of that of controls (P < 0.01) and resulted in a 1.5-fold increase in apoptosis (P < 0.05). [score:1]
The disparity in delta LE values between miR-181b -treated mice and negative control -treated or untreated animals is statistically significant (* P < 0.01; ** P < 0.05). [score:1]
Figure 2 A. Immunoblotting analysis of Mcl1, Bcl2, phospho-Akt (p-Akt), Akt, phospho-ERK1/2 (p-ERK1/2), ERK1/2, IkBα, and PARP (cleaved form, cPARP) in leukemic splenocytes after transfection with miR-181b or anti-TCL1 siRNA or negative control (ctrl). [score:1]
Following transfection of miRNA mimics of the miR-181 and miR-29 families, we assessed the TCL1 protein level. [score:1]
The miR-181b group shows significantly better survival (median survival 117 days) than the negative control group (median survival 91 days; P = 0.037) and the untreated group (median survival 92 days; P = 0.004). [score:1]
A clear reduction of the leukemic cell fraction was detectable in the samples derived from mice treated with miR-181b mimics (representative plots are shown in Figure 3B). [score:1]
The i. p. injections were administered twice a week for 3 weeks, using 80 μg of miR-181b each. [score:1]
Moreover, in EHEB cells, an Epstein-Barr virus-immortalized cell line established from a CLL patient [54], miR-181b induced a pronounced reduction of TCL1 protein (> 80%) accompanied by a significant increase in apoptosis (2.5- and 1.8-fold increase in early and late apoptosis, respectively) and a reduction in the proportion of live cells. [score:1]
Notably, response to miR-181b treatment was comparable in leukemias derived from the two donors (F3 and F15), despite the different Tcl1 and miR-181b endogenous levels (Supplementary Figure S4A-B). [score:1]
As illustrated in Figure 4A, the median delta LE was 0.14 after miR-181b treatment, whereas it was 0.70 in the control group and 0.75 in the untreated mice. [score:1]
The activation of apoptosis was confirmed by analysis of Poly (ADP-ribose) polymerase (PARP): a 70% reduction of the intact form and the appearance of the 85-kD fragment of cleaved PARP were seen only in the miR-181b transfected cells. [score:1]
These data indicate that miR-181b is efficient in reducing leukemic cell expansion, resulting in prolonged survival. [score:1]
As mentioned earlier, multiple survival pathways were affected by miR-181b, but not by anti-TCL1 siRNA, which may explain the different actions on apoptosis and viability. [score:1]
Administration of miR-181b to TCL1-tg mice induces delay in leukemic expansion (LE) and increases survival. [score:1]
After averaging all data, miR-181b emerged as being the most consistent in reducing TCL1 protein levels (P < 0.0005) (Supplementary Figure S1C). [score:1]
This was not the case: miR-181b induced stronger apoptosis than did anti-TCL1 siRNA. [score:1]
Survival in the miR-181b treated group was significantly increased for both untreated (P = 0.004) and negative control -treated (P = 0.037) groups. [score:1]
At least two explanations can be suggested for the lack of leukemia regression induced by miR-181b as a single agent: (i) The miRNA could not induce death of leukemic cells because it was incompletely effective; and (ii) the approach was incomplete and a number of leukemic cells escaped delivery. [score:1]
[1 to 20 of 76 sentences]
7
[+] score: 133
Since the expression of miR-181a is downregulated and Sirt1 expression is upregulated in muscle during ageing, and miR-181 negatively regulates myotube size, we suggest that age-related changes in miR-181a and its target gene(s) expression may act as a failing compensatory mechanism intended to preventing loss of muscle mass and potentially function. [score:16]
The expression of SIRT1 protein, but not mRNA in C2C12 myotubes was downregulated following overexpression of miR-181 and upregulated following inhibition of miR-181 function (Fig.   4d–f). [score:13]
We did not detect significant changes in p21 mRNA expression following manipulation of miR-181a levels, however p21 expression was downregulated following SIRT1 upregulation in C2C12 myotubes indicating that SIRT1 may play additional, miR-181-independent function in muscle, such as regulating cell senescence (Fig. S5). [score:12]
Error bars show SEM, *p < 0.05 (compared to control), n = 4The effect of changes in miR-181 and SIRT1 expression on the expression of p21, a cell cycle regulator associated with senescence and upregulated in muscle of older mice, was examined (Table  2; Fig. S5). [score:8]
Error bars show SEM; *p < 0.05 (compared with control or scrambled control as indicated); n = 3To validate Sirt1 as a physiologically relevant miR-181 target gene in muscle, the expression of Sirt1 transcript and protein was examined in C2C12 myotubes following miR-181 overexpression or inhibition using miRNA mimic or antimiR (AM181), respectively (Fig.   4c, d). [score:8]
Error bars show SEM, *p < 0.05 (compared to control), n = 4 The effect of changes in miR-181 and SIRT1 expression on the expression of p21, a cell cycle regulator associated with senescence and upregulated in muscle of older mice, was examined (Table  2; Fig. S5). [score:8]
Error bars show SEM; *p < 0.05 (compared with control or scrambled control as indicated); n = 3 To validate Sirt1 as a physiologically relevant miR-181 target gene in muscle, the expression of Sirt1 transcript and protein was examined in C2C12 myotubes following miR-181 overexpression or inhibition using miRNA mimic or antimiR (AM181), respectively (Fig.   4c, d). [score:8]
We have validated Sirt1 as a physiologically relevant direct miR-181a target in C2C12 myotubes (Fig.   4) and showed that miR-181 regulates myotube size through Sirt1, and potentially other target genes (Fig.   5). [score:7]
Mutation of the putative target site in the 3′UTR rendered the reporter construct insensitive to miR-181, indicating that interaction with the target site is required for the response (Fig.   4b, c). [score:6]
Co-transfection of SIRT1 overexpression construct together with miR-181 mimic rescued the miR-181 -induced phenotype, indicating the importance of Sirt1 as miR-181 target gene in controlling myotube size (Fig.   5). [score:5]
Error bars show SEM; n = 4–7; *p < 0.05 miR-181a directly regulates the expression of Sirt1The 3′UTR of Sirt1 has one putative miR-181 binding site conserved between human and mouse (Fig.   4a). [score:5]
Expression of miR-181 and its target gene, Sirt1, was manipulated in C2C12 myotubes; following transfections myotubes were stained for myosin heavy chain: MF20 - green; DAPI-blue. [score:5]
C2C12 myotubes were transfected with miR-181 mimic or inhibitor (AM) or SIRT1 overexpression construct. [score:5]
The GFP reporter containing wild type Sirt1 3′UTR was efficiently regulated by miR-181 but not by miR-24; a microRNA not predicted to target Sirt1 (negative control) (Fig.   4b, c). [score:4]
d, e Endogenous SIRT1 protein but not mRNA expression is regulated by miR-181 in C2C12 myotubes, as shown by representative Western blot or qPCR, respectively. [score:4]
Predicted target genes of miR-181 were initially chosen based on the global profiling data. [score:3]
Supplementary material 4 (TIFF 2558 kb)Fig. S5 miR-181 does not control the expression of p21, a marker of senescence. [score:3]
The 3′UTR region of Sirt1 with a wild type (WT) or mutated miR-181 target site (mutant) were synthesised using GeneArt service (Invitrogen) and cloned into a GFP TOPO vector (Invitrogen). [score:3]
Myotubes were transfected with either 100 nM miRNA-181, 100 nM antimiR-181 or 2.5 µg SIRT1 overexpression vector (Addgene, 1791) (Brunet et al. 2004) using Lipofectamine 2000™. [score:3]
Supplementary material 3 (TIFF 16208 kb)Fig. S4 a miR-181 expression can be modulated in C2C12 myotubes. [score:3]
To establish whether miR-181 directly interacts with the Sirt1 3′UTR, we generated a reporter construct containing a fragment of the Sirt1 3′UTR downstream of a GFP reporter (“wild type”). [score:2]
“Mutant” reporter contained a mutated miR-181 binding site. [score:1]
Error bars show SEM; n = 4–7; *p < 0.05 The 3′UTR of Sirt1 has one putative miR-181 binding site conserved between human and mouse (Fig.   4a). [score:1]
[1 to 20 of 23 sentences]
8
[+] score: 129
[10] (Fig 2A) Chronic down-regulation of miR-181b expression with age was associated with activation of TGF-β signaling in the VSMCs (Fig 6D, 6E, 6F, 6G and 6H). [score:6]
Although the vascular stiffness phenotype was reversed following treatment with the TGF-β neutralizer, losartan,(2, 9, 27) losartan did not alter miR-181b expression in the VSMCs, suggesting that reversal of vascular stiffness by losartan was due to inhibition of TGF-β signaling downstream of miR-181b. [score:5]
[39] We have also demonstrated in this study that TGF-β can be the direct target of miR-181b in the VSMCs, where miR-181b binds directly to the 3'-UTR of TGF-βi. [score:5]
Even though losartan is currently in widespread clinical use for the management of hypertension and stroke, miR-181b could potentially be a new or additive therapeutic target for intervention, targeting the TGF-β cascade independent of Angiotensin II. [score:5]
Using both TargetScan and DIANA-microT, we have predicted that position 71–77 of TGF-βi 3'-UTR can be a target of miR-181b (Fig 6H, upper panel). [score:5]
[7, 8] From human plasma samples, it has been shown that in coronary artery disease, the circulating level of miR-181b expression is significantly lower compared to healthy controls. [score:4]
This indicates that miR-181b is associated with direct inhibition of TGF-β signaling independent of Angiotensin II. [score:4]
[54– 57] However, our result have also shown that miR-181b can directly target the 3’-UTR of TGF-βi (Fig 6H and 6I). [score:4]
[9] The miR-181 family has also been reported to play an essential role in early NKT cell development by targeting 3'-UTR of PTEN in the thymus. [score:4]
To test whether Losartan has any direct effect on miR-181b expression in the aortic VSMCs, relative miR-181b expression was evaluated in VSMCs treated or not treated with Losartan (10 μM) for 48 hours. [score:4]
[7, 47– 49] It has been validated that miR-181b regulates NFκB signaling by targeting importin-α3. [score:4]
Activin and TGFbeta regulate expression of the microRNA-181 family to promote cell migration and invasion in breast cancer cells. [score:4]
There was a decrease in miR-181b expression with increase in age (4 weeks: 72.39± 12.30, 20 weeks: 49.10± 5.75, 40 weeks 10.42±1.86, p<0.01). [score:3]
[26] miRNA181b could be a potential therapeutic target in modulating vascular stiffness along with the treatment of hypertension. [score:3]
[50, 51] Systemic administration of miR-181b reduced downstream NF-κB signaling by targeting importin-α3 in the vascular endothelium. [score:3]
[6, 7] In the ApoE -deficient mouse mo del, delivering miR-181b was found to protect against vascular inflammation by directly binding at the 3'-UTR of importin-α3, a key regulator of the NF-κB signaling pathway. [score:3]
[13] C, Relative expression of miR-181a and miR-181b at 4 weeks, 20 weeks and 40 weeks of age in WT mice aorta (n = 3–4). [score:3]
[47] Recently, miR-181b has been shown to target caspase recruitment domain family member 10 (Card10) in ECs to prevent thrombin -mediated endothelial activation and arterial thrombosis. [score:3]
[30– 32] For example, patients with coronary artery disease have reduced circulating levels of miR-181b, suggesting the potential role of miR-181b in the pathogenesis of arterial inflammation. [score:3]
qPCR data showed a significant decrease in miR-181b expression in the aorta of the older mice. [score:3]
Fig C. Effect of losartan on miR-181b expression. [score:3]
To see the temporal changes in miR-181a and miR-181b expression, WT mice aorta at different ages (4 weeks, 20 weeks, 40 weeks) were tested for miR-181a and miR-181b by qPCR. [score:3]
Several studies have suggested that TGF-β induces miR-181 expression. [score:3]
miR-181b expression after losartan treatment (10u [score:3]
We have validated the miR-181a and miR-181b expression in the aorta of the miR-181a1/b1 [-/-] (a/b KO) mouse mo del using qPCR (Fig 1A and 1B). [score:3]
[7, 8] Accumulating evidence indicates that miR-181 modulates vascular function by targeting multiple key cell signaling pathways, including NF-κB signaling in the vascular endothelium as well as the PI-kinase pathway. [score:3]
[59] The present study shows a role of miR-181b in regulating TGF-β signaling, in the smooth muscle cells, which modulates vascular stiffness. [score:2]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
Better understanding of the role of miR-181 in the development of vascular stiffness and systolic hypertension may lead to novel therapeutic approaches in the future. [score:2]
[1, 5] Many miRNAs contribute to vascular dysfunction, but among these, miR-145 and miR-181b have been found to be key regulators of vascular inflammation in ApoE signaling pathways. [score:2]
miR-181 and metabolic regulation in the immune system. [score:2]
A luciferase reporter assay confirmed miR-181b targets TGF-βi (TGF-β induced) in the aortic VSMCs. [score:2]
Several studies have pointed out the important role of miR-181b in VECs. [score:1]
As the role of miR-181b in VECs is a very well studied topic, and vascular stiffness is mainly due to functional changes of VSMCs, we focused our study on the underlying mechanism involving miR-181b in VSMCs rather than VECs. [score:1]
This suggests that miR-181b may have a role in a feedback loop of TGF-β signaling. [score:1]
In theory, the entire miR-181 family can bind to the same 3'-UTR region of TGF-β ligand. [score:1]
[7, 47] Thus loss of miR-181b can activate NFκB signaling in VECs. [score:1]
0174108.g001 Fig 1 A, B, qPCR of miR-181a and miR-181b in the aortic tissue. [score:1]
This is due to 99.9% homology between the sequences (miR-181a and miR-181c; miR-181b and miR-181d). [score:1]
Green color represents FITC tagged at the 3'-end of miR-181b. [score:1]
[7, 40, 41] The mature sequence of miR-181a1 and miR-181a2, and miR-181b1 and miR-181b2 are identical, but they are encoded from two different genomic loci: the miR-181a1 and miR-181b1 cluster is located on chromosome 1, and the miR-181a2 and miR-181b2 cluster is located on chromosome 9. [42] To test the baseline vascular function of miR-181 family in vivo, we used mice deficient for the miR-181a1-miR-181b1 cluster. [score:1]
This may suggest that the role of miR-181b in the feedback loop of the TGF-β cascade is upstream of the TGF-β receptor. [score:1]
Decreased miR-181b with aging plays a critical role in ECM remo deling by removing the brake on the TGF-β, pSMAD2/3 pathway. [score:1]
Rat aortic vascular smooth muscle cells (A7r5) were co -transfected with TGF-βi or mutated TGF-βi reporter construct, along with miR-181b or scramble sequence. [score:1]
Among the six mature family members, miR-181 a1, a2, b1, b2, c, and d, it has been found that miR-181a1 and miR-181b1 are the most prevalent in the aorta of mice. [score:1]
1.25 X 10 [6] rat aortic vascular smooth muscle cells (A7r5) were transfected with 50 ng of TGF-βi 3'-UTR reporter construct (GeneCopoeia, Rockville, MD, USA) or with mutated TGF-βi reporter construct (mutagenesis at positions 72,74,76 and 77 from “A to C”, “A to C”, “G to C”, and “U to A”, respectively) with dual luciferase, firefly and renilla, which were then co -transfected with either scramble sequence or by mature miR-181b (GE-Dharmacon, Lafayette, CO, USA), using an electroporator (Neon Transfection System, Thermo Fisher, Carlsbad, CA, USA) following 1475 mV for 20 ms and 2 pulses. [score:1]
[7, 8, 10, 33] However, there is no evidence showing the role of miR-181 in baseline vascular function. [score:1]
[11] However, the role of the miR-181 family in overall vascular function, including endothelial function and vascular stiffness, remains unknown. [score:1]
miR-181b but not miR-181a decreases with age. [score:1]
[10] Together, these results suggest that the miR-181 family is an important modulator of vascular inflammation. [score:1]
Here we tested whether the miR-181 family can influence the pathogenesis of hypertension and vascular stiffening. [score:1]
I, Luciferase activity of 3'-UTR of TGF-βi in rat aortic VSMCs (A7r5) co -transfected with TGF-βi or mutated TGF-βi reporter construct, along with miR-181b or scramble sequence. [score:1]
The critical role for the miR-181 family in vascular inflammation has been documented. [score:1]
[1 to 20 of 53 sentences]
9
[+] score: 120
The results showed that miR-181 overexpression significantly decreased the luciferase activity, and mutations in the miR-181 binding site from the DAX-1 3′-UTR abolished this effect, suggesting that miR-181 directly inhibited DAX-1 expression by targeting the 3′-UTR (Fig. 4B). [score:11]
miR-181 targets the DAX-1 3′-untranslated region (3′-UTR) and downregulates its expression. [score:10]
They demonstrate that miR-181 overexpression causes the upregulation of AR target genes, suggesting that the proliferative role of miR-181, at least in part, may be dependent on androgen signaling. [score:8]
In the present study, elevated expression levels of AR target genes and proteins, including prostate-specific antigen, cyclin -dependent kinase (CDK) 1 and CDK2, was observed in LNCaP cells overexpressing miR-181 (Fig. 5). [score:7]
Therefore, these results suggest that miR-181 may negatively regulate DAX-1 expression at the translational level in LNCaP cells. [score:6]
In order to understand the underlying mechanism, potential targets of miR-181 were determined using TargetScan software. [score:5]
Previous studies have demonstrated that the upregulation of hepatic miR-181 promotes the growth, clonogenic survival, migration and invasion of hepatocellular carcinoma cells (7, 8). [score:4]
It was found that miR-181 is significantly upregulated in cancer tissues compared with that in normal adjacent tissues, as shown in Fig. 1. Since miR-181 was found to be upregulated in prostate cancer tissues, the effect of miR-181 on prostate cancer cell growth was investigated. [score:4]
Furthermore, in the present study DAX-1 was identified as a direct target of miR-181 in prostate cancer cells. [score:4]
miR-181 is upregulated in prostate cancer tissues. [score:4]
In addition, miR-181 overexpression was observed to promote the growth of LNCaP tumors in nude mice. [score:3]
The results suggest that miR-181 may be a potential therapeutic target for the treatment of prostate cancer in the future. [score:3]
The expression of miR-181 was analyzed in prostate cancer tissues and adjacent normal tissues using qPCR. [score:3]
DAX-1 was identified as a potential target of miR-181. [score:3]
In addition, the average tumor weight was significantly increased by miR-181 overexpression (Fig. 3C), suggesting that miR-181 may promote tumor growth in vivo. [score:3]
Furthermore, miR-181 overexpression decreased the percentage of cells in the G1 phase and increased the percentage of cells in the S phase (Fig. 2D). [score:3]
miR-181 overexpression promotes prostate cancer cell proliferation in vitro. [score:3]
Furthermore, the expression level of miR-181 is significantly associated with overall survival in hematological malignancies and may be an important clinical prognostic factor for patients with hepatocellular carcinoma (9). [score:3]
Therefore, in the present study, the expression of miR-181 was determined in prostate cancer tissues. [score:3]
A total of 2×10 [5] LNCaP cells stably expressing miR-181 or NC were injected subcutaneously into the dorsal flank of the mice. [score:3]
In the present study, it was demonstrated for the first time, to the best of our knowledge, that miR-181 overexpression may promote cell proliferation and cell-cycle progression in LNCaP cells. [score:3]
In combination, these results further confirm that DAX-1 is an important target gene of miR-181 in prostate cancer cells. [score:3]
Mutations were introduced in potential miR-181 binding sites using a site-directed mutagenesis kit (Qiagen). [score:3]
miR-181 overexpression promotes tumor growth in vivo. [score:3]
Therefore, miR-181 may be an onco-miRNA in the development of prostate cancer. [score:2]
To analyze miR-181 expression, specific stem-loop reverse transcription primers (Invitrogen Life Technologies) were used. [score:2]
The tumor size and volume were markedly increased in mice injected with LNCaP cells overexpressing miR-181 compared with those in control mice (Fig. 3A and B). [score:2]
To investigate whether DAX-1 may be directly targeted by miR-181, a luciferase reporter vector was constructed, containing the putative miR-181 binding sites within the DAX-1 3′-UTR. [score:2]
To further investigate the function of miR-181 on tumor growth in vivo, LNCaP cells with stable overexpression of miR-181 were generated and injected subcutaneously into the dorsal flank of nude mice. [score:1]
Notably, the 3′-UTR of DAX-1 mRNA was observed to contain a complementary site for the seed region of miR-181 (Fig. 4A). [score:1]
Furthermore, miR-181 mimics decreased the endogenous protein levels of DAX-1, as indicated by western blot analysis (Fig. 4C), while the DAX-1 mRNA levels remained unchanged (Fig. 4D). [score:1]
LNCaP cells were transfected with miR-181 mimics or NC (Fig. 2A). [score:1]
In conclusion, the present study provides a novel role for miR-181 in prostate cancer cell proliferation. [score:1]
Furthermore, the targets of miR-181 were investigated in order to determine the underlying mechanism of miR-181 in prostate cancer. [score:1]
Human miR-181 mimics and negative controls (NC) were purchased from Qiagen (Shanghai, China). [score:1]
[1 to 20 of 35 sentences]
10
[+] score: 117
Expression of miR-181a (H) and miR-181b (I) were quantified in the spinal cord tissue derived from EAE mice at different stages of disease. [score:5]
Asking whether miR-181 overexpression might affect the differentiation of macrophages toward M1 or M2 phenotypes, we examined the expression of iNos, a key M1 marker, and arginase and Mrc1 as M2 markers in transfected cells. [score:5]
Interestingly, gene ontology and pathway analysis performed on miR-181 predicted targets has shown an overrepresentation of TCR signaling and TGF-β signaling pathways among miR-181a and -b’s predicted targets (20). [score:5]
Indeed, two miRNA expression profiling studies on tissues derived from MS patients have demonstrated differential expression of miR-181 family members in MS brain tissue (13, 14). [score:5]
miR-181a and miR-181b Are Downregulated in the CNS of MS Patients and EAE Animal Mo del. [score:4]
In the context of MS, both up- and downregulation of miR-181 mature isoforms have been reported in MS brains, this is likely a consequence of the degree of inflammation and tissue location with respect to MS lesions (13, 14). [score:4]
A profiling study performed by Junker et al reported downregulation of miR-181 family members in MS lesions (13). [score:4]
miR-181a and miR-181b are highly expressed in the brain, bone marrow, spleen, and thymus (10, 18). [score:3]
In separate experiments, splenocytes were stimulated with anti-CD3 and anti-CD28 for indicated time points and expression of miR-181a (D) and miR-181b (E) were quantified. [score:3]
Overexpression of miR-181b in resting macrophages resulted in decreased levels of Il6 together with a mild increase in arginase (M2 associated gene) but the increase did not reach statistical significance (Figure S3 in). [score:3]
Overall these data showed that Smad7 expression was associated with alterations in miR-181 levels leading to molecular effects that influence T cell differentiation and macrophage activation in the context of autoimmune neuroinflammation. [score:3]
Figure 1miR-181a and miR-181b expression levels are decreased in the central nervous system of multiple sclerosis (MS) patients and experimental autoimmune encephalomyelitis (EAE) mice. [score:3]
For M2 markers, arginase was induced in miR-181b overexpressing macrophages (Figure 3). [score:3]
Figure S1 miR-181a and miR-181b expression levels after transfection with miR-181a and miR-181b mimics. [score:3]
Primary macrophages were transfected with miR-181a, miR-181b, or negative control sequences and then exposed to LPS (100 ng) for 12 h. The expression of inflammatory cytokines Tnfa, Il1, and Il6 together with M1/M2 markers iNOS, Mrc1, and arginase were then analyzed. [score:3]
Overall, these data indicated that activation of immune cells could be associated with diminished expression of miR-181 isoforms, which in turn might play a role in subsequent pathogenic events. [score:3]
Figure 5Smad7 transcripts are targeted by miR-181a and miR-181b. [score:3]
To examine the expression levels of miR-181 isoforms in T cells following polyclonal activation, we stimulated splenocytes with anti-CD3/CD28 antibodies and studied the transcript levels at several time points following stimulation. [score:3]
Figure 2miR-181a and miR-181b expression is decreased in activated leukocytes. [score:3]
Expression analysis for putative inflammatory cytokines Tnfa, Il1b, and Il6 showed diminished levels of Tnfa and Il6 transcripts in cells transfected with miR-181a or miR-181b sequences (Figure 3), whereas Il1b levels were unaffected. [score:3]
miR-181 family members show altered expression in MS tissues although their participation in MS pathogenesis remains uncertain. [score:3]
Interestingly, overexpression of miR-181a and miR-181b mimic sequence reduced the frequency of Th1 cells (Figures 4D,G). [score:3]
Expression of mir-181a (B) and miR-181b (C) were determined by quantitative real-time PCR analysis at three time points. [score:3]
To examine whether diminished expression of miR-181 isoforms might occur in these cells following activation, we evaluated miR-181a and -b expression levels in primary macrophages and lymphocytes following cell activation. [score:3]
Expression analysis on brain autopsy samples shows levels of miR181a and miR-181b in the brains of MS patients (n = 10) compared with non-MS controls (n = 10) (Mann–Whitney U test, * p ≤ 0.05) (A). [score:2]
miR-181 Family Members Regulate the Differentiation of Th1 Cells and Tregs. [score:2]
Studies on mouse astrocytes have also indicated a regulatory role for miR-181 family members in these cells (46). [score:2]
Members of the miR-181 family are among dysregulated miRNAs in the CNS of patients affected by MS (13, 14). [score:2]
Prior studies have reported on the roles of miR-181 family members in development and function of immune cells, including their role in B cell and T cell differentiation and activities (10, 19). [score:2]
miR-181 -deficient mice show severe defects in development of B, T, NK and NKT cells (49). [score:2]
Figure 4miR-181a and miR-181b regulate CD4 [+] T cells differentiation. [score:2]
We believe that miR-181b increase reported in our previous study was mostly reflective of miRNA content of neural cells (e. g., astrocytes and neurons). [score:1]
Figure 3miR-181a and miR-181b modulate macrophage activation and polarization. [score:1]
Likewise, Th17 polarizing conditions increased IL17 immunopositive cells (Figure 4B), but the frequency of these cells did not reveal any difference following miR-181a or miR-181b transfection (Figures 4E,G). [score:1]
Correlation analysis was performed between Smad7 mRNA levels and miR-181a or miR-181b in acute and chronic phases of EAE (C,D) (Pearson correlation; * p < 0.05). [score:1]
miR-181a, miR-181b, and negative control sequences were transfected into purified naïve CD4 [+] T cells, which were then activated and polarized. [score:1]
The miR-181 family is highly conserved and consists of four members (miR-181a, miR-181b, miR-181c, and miR-181d) in both humans and mice. [score:1]
The sequence of the predicted binding site for miR-181a and miR-181b are shown on 3′-UTR of mouse Smad7, Socs3, or Tgfbr1 mRNA (in italic and bold) (A). [score:1]
miR-181a and miR-181b mimics, negative control, and Attractene transfection reagent were purchased from Qiagen (Syn-mmu-miR-181a miScript miRNA Mimic, Syn-mmu-miR-181b miScript miRNA Mimic, AllStars Negative Control siRNA). [score:1]
Correlation analyses revealed a significant inverse correlation between miR-181a or miR-181 b and Smad7 transcripts in EAE tissues (Figures 6C,D). [score:1]
miRNA-181a and -b mimic as well as scrambled sequences were purchased from Qiagen (Syn-mmu-miR-181a miScript miRNA Mimic, Syn-mmu-miR-181b miScript miRNA Mimic, AllStars Negative Control siRNA). [score:1]
However, in an miRNA profiling study performed by our group on NAWM from MS patients we detected increased levels of miR-181b in MS tissues (14). [score:1]
The effect on Treg differentiation was negligible for miR-181b (Figures 4F,G). [score:1]
Primary macrophage cultures were treated with LPS (10 and 100 ng/ml) for 12 h and the expression of miR-181a and miR-181b were measured (A). [score:1]
As shown in Figures 2D,E, activated T cells showed reduced levels of miR-181a and miR-181b at 24 and 48 h time points after stimulation. [score:1]
At the pre-onset phase, miR-181a showed an increase while miR-181b was reduced similar to the acute and chronic phases. [score:1]
Nonetheless, mir-181b levels did not show any significant changes following LPS stimulation (Figure 2A). [score:1]
Overall, these data suggested that miR-181a and miR-181b diminished polarization of activated T cells toward a Th1 phenotype, a finding that was associated with increased Treg differentiation for miR-181a isoform. [score:1]
Briefly, 3 µl of Hiperfect Transfection Reagent was added to 100 µl of serum-free DMEM medium containing miR-181a or miR-181b mimics or negative control at a final concentration of 50 nM. [score:1]
” PsiCheck vectors containing the 3′-UTR of Smad7, Socs3, or Tgfbr1 mRNA were co -transfected along with miR-181a or miR-181b mimic sequences, or a scrambled negative control sequence into HEK293T cells. [score:1]
However, miR-181b levels did not show statistically significant changes after MOG stimulation (Figure 2C). [score:1]
[1 to 20 of 51 sentences]
11
[+] score: 109
The TNF-α 3′UTR containing the mutated ssc-miR-130a-3p target sequence (TTGCACT to AACGTGA), ssc-miR-181a target sequence (TGAATGT to ACTTACA), ssc-miR-181b target sequence (TGAATGT to ACTTACA), ssc-miR-301a-3p target sequence (TTGCACT to AACGTGA), mmu-miR-130a-3p target sequence (TTGCACT to AACGTGA), mmu-miR-181a target sequence (TGAATGT to ACTTACA), mmu-miR-181b target sequence (TGAATGT to ACTTACA), mmu-miR-301a-3p target sequence (TTGCACT to AACGTGA), and mmu-miR-351-5p target sequence (CTCAGGG to GAGTCCC) were cloned into the pMIR-REPORT Luciferase vector. [score:19]
These data demonstrate miR-130a-3p, miR-181a, miR-181b, or miR-301a-3p regulates the TNF-α expression at the transcriptional level via targeting its 3′UTR, while miR-351-5p may inhibit murine TNF-α expression both at transcriptional and posttranscriptional level. [score:10]
These results suggest that miR-130a-3p, miR-181a, miR-181b, and miR-301a-3p inhibit TNF-α expression at the posttranscriptional level, while miR-146a and miR-351-5p likely inhibit TNF-α expression in transcriptional level. [score:9]
To further determine the roles of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p in regulating TNF-α, cells were transfected with inhibitor control, miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, miR-351-5p inhibitor, or miRNA inhibitor mix and infected with LV-Omp25 or LV-Blank. [score:8]
Our results showed that in Omp25 -expressing PAMs, the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p were upregulated, while miR-125a-5p, miR-125b-5p, and miR-146b were downregulated compared to controls (Figure 4A). [score:8]
In PAMs, transfection of miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p inhibitors apparently improved the relative TNF-α levels compared with the inhibitor control, but miR-181b and miR-351-5p inhibitors had no effects on TNF-α expression (Figure 7A). [score:8]
In mouse RAW264.7 cells, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p were upregulated, while miR-125a-5p and miR-146b were downregulated (Figure 4B). [score:7]
Importantly, B. suis infection induces higher levels expression of miR-146a, miR-181a, miR-181b, or miR-301a-3p in both PAMs and mouse RAW264.7 cells, yet specifically upregulates miR-130a-3p in PAMs and miR-351-5p in RAW264.7 cells, respectively. [score:6]
miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p Inhibit TNF-α Expression at Transcriptional or Posttranscriptional Levels. [score:5]
Altogether, these data demonstrate that Omp25 induces the expression of several miRNAs in PAMs and mouse RAW264.7 cells, with miR-146a, miR-181a, miR-181b, and miR-301a-3p being commonly upregulated in both PAMs and mouse RAW264.7 cells compared to miR-130a-3p and miR-351-5p, which are specific for PAMs and mouse RAW264.7 cells, respectively. [score:5]
In mouse RAW264.7 cells, except for miR-130a-3p and miR-181b inhibitors, other miRNA inhibitors significantly raised the relative levels of TNF-α (Figure 7B). [score:5]
Figure 5Upregulation of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p blocks LPS-stimulated TNF-α production. [score:4]
Considering that miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p might participate in the negative regulation of TNF-α production in Omp25 -expressing cells, we measured the expression of these miRNAs in PAMs and mouse RAW264.7 cells after LV-Omp25 infection. [score:4]
Given above results, we reasoned that miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p likely play crucial roles in the Omp25 inhibition of LPS -induced TNF-α production. [score:3]
To confirm that TNF-α is regulated at posttranscriptional level by which miRNA, we constructed reporter plasmids encoding the WT 3′UTR of porcine or murine TNF-α mRNA downstream of the firefly luciferase gene (porcine or murine TNF-α WT-3′UTR), as well as parallel plasmids containing mismatches in the predicted binding sites (miR-130a-3p, miR-181a, miR-181b, miR-301a-3p, or miR-351-5p MT-3′UTR) of the 3′UTR region (Figure S5 in). [score:2]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
Additionally, miR-181 family also plays crucial roles in inflammation (44), likely by binding to human TNF-α mRNA 3′UTR to promote the fine-tuning of TNF-α in immunoparalysis (45). [score:1]
showed that the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p increased at 12–36 h in LV-Omp25-infected PAMs, whereas miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p showed similar changes in LV-Omp25-infected RAW264.7 cells (Figures 4C–G,I–M). [score:1]
To test this, PAMs and mouse RAW264.7 cells were transfected with miRNA control, miR-130a-3p mimics, miR-146a mimics, miR-181a mimics, miR-181b mimics, miR-301a-3p mimics, or miR-351-5p mimics, and stimulated the transfected cells with LPS for 24 h. In PAMs, transfection of the mimics of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p decreased LPS -induced TNF-α, except miR-351-5p (Figure 5A). [score:1]
In RAW264.7 cells, transfection of the mimics of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p decreased LPS -induced TNF-α (Figure 5B). [score:1]
[1 to 20 of 20 sentences]
12
[+] score: 93
However, the pri-miR-302, pri-miR-181a-2 and pri-miR-181b-2 show upregulation in BIO- and CHIR -treated cells, this indicates that the reduced expression of mature miRNAs might be because of the inhibition of pri-miRNAs processing, rather than inhibition of miRNA transcription. [score:10]
However, CHIR downregulated mature miR-302a, miR-302b, miR-302c, miR-181a and miR-181b expression, and BIO slightly downregulated miR-181a and miR-181b (Fig. 4e). [score:9]
The expression of the miR-302-367 cluster and the miR-181 family of miRNAs are activated by Wnt/β-catenin pathway 26 27, thereby we speculated that members of these family should be upregulated by BIO and CHIR because these inhibitors activate Wnt/β-catenin signalling. [score:8]
The small RNA deep-sequencing data shows that most of differentially expressed miRNAs in the BIO- and CHIR -treated cells were downregulated, including the Wnt/β-catenin-regulated miR-302-367 cluster and miR-181 family members. [score:7]
These data suggest that BIO and CHIR inhibit miRNA maturation, particularly inhibiting maturation of Wnt/β-catenin signalling-activated miR-302-367 cluster and miR-181 family of miRNAs, is probably because inhibition of GSK3 activity disturbs the nuclear localisation of Drosha. [score:7]
Additionally, BIO downregulated the expression of miR-181 family of miRNAs (Table 1). [score:6]
Unexpectedly, CHIR significantly downregulated the expression of miR-302-367 cluster and miR-181 family members, including miR-302a-5p, miR-302b-3p, miR-302d-3p, miR-181a-2-3p, miR-181a-5p, miR-181b-5p, miR-181c-5p, miR-181c-3p, and miR-181d-5p (Table 1). [score:6]
β-catenin was overexpressed in J1 mESCs using the vector pCMV-Myc- β-catenin (Fig. 4a), and the expression of primary and mature forms of miR-302, miR-181a and miR-181b were determined by qPCR. [score:5]
qPCR results showed that BIO treatment resulted in a slight upregulation of pri-miR-302, pri-miR-181a-2 and pri-miR-181b-2. CHIR induced a higher level of expression of these primary miRNAs compared with BIO treatment (Fig. 4d). [score:5]
The expression of pri-miR-302, pri-miR-181a-2, and pri-miR-181b-2 in β-catenin overexpressed J1 mESCs was determined by qPCR. [score:5]
Consistently, pre-miR-302a, pre-miR-302b, pre-miR-302c and pre-miR-302d were reduced following CHIR treatment, and pre-miR-181a-2 and pre-miR-181b-2 were downregulated by both BIO and CHIR (Fig. 4f). [score:4]
The qPCR results showed that overexpression of β-catenin activates the transcription of pri-miR-302, pri-miR-181a-2 and pri-miR-181b-2 (Fig. 4b). [score:3]
The expression of miR-302a-5p, miR-302b-5p, miR-302c-5p, miR-181a-5p, and miR-181b-5p in β-catenin transfected J1 mESCs was determined by qPCR. [score:3]
Expression of miR-302-367 cluster and miR-181 family members in BIO and CHIR treated mESCs detected by small RNA deep-sequencing. [score:3]
To better understand how BIO and CHIR regulate miRNAs that induced by Wnt/β-catenin signalling, we compared the expression of primary and mature miRNAs of miR-302-367 cluster and miR-181 family following BIO and CHIR treatment in J1 mESCs. [score:3]
The expression of miR-302a-5p, miR-302b-5p, miR-302c-5p, miR-181a-5p, and miR-181b-5p in BIO- or CHIR -treated J1 mESCs was determined by qPCR. [score:3]
Additionally, β-catenin overexpression increased the levels of mature miR-302a, miR-302b, miR-302c, miR-181a and miR-181b when compared with controls (Fig. 4c). [score:2]
The qPCR results of precursor form of the miR-302-367 cluster and miR-181 family members confirmed this notion. [score:1]
Transcription of pri-miR-302, pri-miR-181a-2, and pri-miR-181b-2 in BIO or CHIR -treated J1 mESCs was determined by qPCR. [score:1]
for miR-302a, miR-302b, miR-302c, miR-302d, miR-181a and miR-181b were validated by qPCR (Fig. 3i and 3j). [score:1]
To further analyse this, the precursor forms of miR-302a, miR-302b, miR-302c, miR-302d, miR-181a and miR-181b was examined by qPCR in J1 mESCs. [score:1]
[1 to 20 of 21 sentences]
13
[+] score: 88
We also found that CARM1 was post-transcriptionally regulated and was directly targeted by miR-181, which represses the 3′ untranslated region (3′UTR) of CARM1 in hESCs. [score:7]
In differentiated hESCs, H3K27 methylation is inhibited because of the reduction of core pluripotency factors, and miR-181 family members are consequently significantly induced and down-regulate CARM1 activity. [score:6]
In this context, we scanned for microRNAs that target CARM1 and finally identified the miR-181 family as the critical regulator of CARM1 expression. [score:6]
In differentiated hESCs, H3K27 methylation is inhibited due to the reduction of core pluripotency factors, and miR-181 family members are subsequently induced and down-regulate CARM1 activity. [score:6]
Taken together, these results show that miR-181 directly regulates CARM1 by targeting its 3′UTR and that miR-181c may play a prominent role among the 4 members during hESC differentiation. [score:5]
Although the miR-181 family also regulates many target genes [21], [46], [47], [48], [49], it is important to highlight that in mouse ESCs, the miR-181 family regulates another histone modulator, Cbx7, which plays a critical role in maintaining ESC pluripotency [50]. [score:5]
0053146.g002 Figure 2The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
To investigate whether CARM1 can be directly targeted by miR-181, we engineered luciferase reporters that have either the wild-type 3′UTR of CARM1, or a mutant 3′UTR with three point mutations in the target sites as a negative control (Fig. 2C). [score:5]
The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
Enforced Expression of miR-181c Induced hESC Differentiation by Targeting CARM1 We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:5]
All the results indicated that CARM1 down-regulation may greatly contribute to the miR-181-meidated hESC differentiation. [score:4]
Future studies will explore how the expression of the miR-181 family is regulated in ESC differentiation and whether other transcriptional factors are associated with CARM1. [score:4]
By contrast, the expression of mutant reporters was not repressed by miR-181 (Fig. 2D). [score:3]
Thus, we suggest that CARM1 is one of the key target genes of the miR-181 family during the progression of ESCs differentiation. [score:3]
We also found that the expression levels of the miR-181c/d primary transcripts (pri-181c/d) were notably elevated after differentiation in comparison to the primary transcripts of miR-181a and miR-181b (pri-181a1/b1 and pri-181a2/b2) (Fig. 2B). [score:3]
Our work suggests that downstream targets of the miR-181 family include epigenetic factors that reconfigure the H3 arginine methylation signature during the process of hESC differentiation. [score:3]
Considering that the sites of the CARM1 3′UTR that are targeted by miR-181 family members are conserved in mammals, we suppose that the interaction between miR-181 and CARM1 is conserved in mESCs. [score:3]
The mature transcripts of the 4 members of the miR-181 family were all found to be significantly increased in differentiated hESCs, and miR-181c had the highest expression level (Fig. 2A). [score:3]
miR-181 Family Members are Critical Regulators of CARM1 during hESC Differentiation. [score:2]
Our results also suggest that the miR-181/CARM1/core-pluripotency-factors regulatory loop may be a novel mo del pathway involved in the modulation of hESC pluripotency (Figure 4E). [score:2]
We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:1]
To study the role of endogenous miR-181 in repressing the CARM1 3′UTR reporter in differentiated hESCs, we co -transfected the wild-type 3′UTR luciferase reporter and the negative control luciferase into differentiated hESCs. [score:1]
This finding suggests that the miR-181 family may also promote differentiation by affecting histone modulation in mESCs. [score:1]
[1 to 20 of 23 sentences]
14
[+] score: 75
Then, we found that over expressed miR375 significant decreased the expression level of p-IkBa/IkBa and IRF7, whilst the over expression of miR181b significant decreased the expression level of p-IkBa/IkBa, IRF3 and IRF7, but significant increased the expression level of p-Erk/Erk. [score:11]
Each 100 nM miRNA inhibitor (micrOFF™ mmu-miR-181b-3p inhibitor, micrOFF™ mmu-miR-375-5p inhibitor, and micrOFF™ inhibitor Negative Control) was transfected into BMDCs for 24 h to analyze their effect on DCs via detection of- phenotypic alteration with FACS. [score:9]
Whilst the addition of miR181b decreased the expression of MHCII and CD40, this effect can be repressed by inhibiting expression of miR181b. [score:7]
Our results show that IRF-3 and IRF-7 were all down-regulated in miR375 and miR181b groups, while inhibition of endogenous miR375 and miR181b significantly decreases IRF-3 and IRF7, suggesting that miR375 and miR181b are necessary for the production of IFN-α. [score:6]
Also, miR181b repressed the expression of CD40 and MHCII; this inhibition effect was relieved when endogenous miR181b was silenced. [score:5]
FACS revealed that the inhibition of endogenous miR375 and miR181b decreased the expression of co-stimulatory molecules (CD80/CD86 and CD40) and MHCII, which was induced by PB1 (P < 0.05; Figures 4C,D). [score:5]
To detect whether the phenotypic alteration of BMDCs induced by PB1 was mediated by miR181b or miR375, miRNAs inhibitors were transfected into BMDCs for 4 h as described above, before PB1 over -expression plasmid was transfected. [score:5]
Moreover, results also shown that the abundance of miR181b significant down-regulated all the surface -markers except MHC-II. [score:4]
Inhibition of endogenous miR375 and miR181b blocked PB1 -induced phenotypic alterations in BMDCs. [score:3]
Here, we demonstrated a previously unidentified role for PB1 in the regulation of murine immune responses of DCs, which was mediated by miR375 and miR181b. [score:2]
Roles of microRNA-146a and microRNA-181b in regulating the secretion of tumor necrosis factor-α and interleukin-1β in silicon dioxide -induced NR8383 rat macrophages. [score:2]
The immune function of miR375 and miR181b in regulating mice BMDCs. [score:2]
Finally, the inhibition of miR181b significant repressed the p-Jnk/Jnk signaling pathway when compared with the blank group (Figures 5A,B). [score:2]
Thus, miR181b may enhance the function of DC by down -regulating surface maturation molecules MHCII. [score:2]
Interestingly, we found that the inhibition of miR181b significant increased the MFI of MHCII and CD-86 when compared with the blank group (Figures 4A,B). [score:2]
MicroRNA-375 was observed to influence cell proliferation, apoptosis and differentiation through the Notch signaling pathway, while microRNA-181b modulated the secretion of TNF-α and IL-1β in macrophages (Zhang et al., 2015; Wang et al., 2016). [score:1]
Four selected miRNAs (miR375 and miR181b) were amplified and then cloned into pSilencer4.1. [score:1]
BMDCs were transfect with PB1, miR375, miR181b, In-miR375, and In-miR181b for 48 h. Then cells were collected and washed with PBS three times for the next experiments. [score:1]
Supplementary Image 2Identification and construction of pSilencer-miR375 and pSilencer-miR181b by digestion with BamHI and HindIII. [score:1]
MiRNAs (miR-375 and miR-181) were amplified and cloned into pSilencer4.1 (Invitrogen). [score:1]
MiR181b and miR375 inhibitors, which were chemically modified single stranded RNAs, were designed and purchased from RiboBio to evaluate miRNA function (Guangzhou, China). [score:1]
Effects on signaling pathways stimulated by PB1, miR375 and miR181b. [score:1]
Previous studies demonstrated that PB1 and a number of miRNAs, including miR375 and miR181b, can influence the phenotype of BMDCs. [score:1]
[1 to 20 of 23 sentences]
15
[+] score: 69
In addition, miR-181b is down-regulated in vascular inflammatory diseases such as sepsis and coronary artery disease (CAD) and functions as an antagonist of the nuclear import of NF-κB subunits in ECs (Sun et al., 2012, 2014). [score:8]
MiR-181b IS DOWN-REGULATED IN VASCULAR INFLAMMATORY DISEASES AND CONTROLS THE IMPORT OF NF-κB INTO THE NUCLEUS. [score:5]
This is typically achieved by liposome -mediated delivery modalities, and the effectiveness of this strategy is illustrated by studies utilizing miR-181b over -expression in ECs to inhibit vascular inflammation and atherosclerosis in mouse mo dels (Sun et al., 2012, 2014). [score:5]
Interestingly, systemic delivery of miR-181b inhibits NF-κB in the endothelium through the targeting of IPOA3, but because monocytes/macrophages utilize a distinct Importin for NF-κB activation, no effect on NF-κB signaling is observed in these cells (Sun et al., 2014). [score:5]
While miR-181b represses IPOA3 expression in leukocytes, the main isoform used for NF-κB nuclear transport in leukocytes is IPOA5 (which is not targeted by miR-181b): explaining the insensitivity of leukocytes to miR-181b manipulation. [score:5]
The over -expression of miR-181b in cultured human ECs or systemic delivery of miR-181b mimics in mice represses NF-κB dependent vascular inflammatory gene expression. [score:5]
By analyzing the targets of miR-181b, Sun et al. (2012) found that this microRNA impinges on the NF-κB pathway by targeting the nuclear protein transporter IPOA3 (Importin-3α) in human and mouse ECs (Figure 1). [score:5]
This suggests that down-regulation of miR-181b occurs in diverse vascular inflammatory conditions. [score:4]
They found that miR-181b was rapidly down-regulated by this stimulus. [score:4]
Systemic delivery of microRNA-181b inhibits nuclear factor-kappaB activation, vascular inflammation, and atherosclerosis in apolipoprotein E -deficient mice. [score:3]
Collectively, these studies highlight the importance, and potential therapeutic relevance, of miR-181b in vascular inflammatory diseases. [score:3]
The predominant isoform in ECs is miR-181b, which is expressed at greater than 10-fold higher levels than miR-181a, while the other two isoforms are nearly undetectable (Sun et al., 2012). [score:3]
Inflammation -associated microRNAs are also potential biomarkers for vascular diseases, since miR-155 and miR-181b are reduced in human plasma from patients with CAD (Fichtlscherer et al., 2010; Sun et al., 2014). [score:3]
However, the fact that circulating miR-181b levels are reduced in septic patients and in CAD patients (Sun et al., 2012, 2014), and considering the known role for miR-181b in suppressing NF-κB activity, this suggests that circulating microRNAs may indeed influence vascular inflammation. [score:3]
Treatment with miR-181b mimics also decreases leukocyte recruitment and damage to the lung, and increases survivability in a mouse mo del of sepsis (Sun et al., 2012). [score:1]
Systemic mimic injections resulted in miR-181b accumulation in the intimal region (i. e., ECs) of the aorta and in circulating leukocytes, with limited accumulation in the medial layer of the vessel wall. [score:1]
The miR-181 family consists of four members (miR-181a, b, c, and d) in human and mouse. [score:1]
With success in systemic delivery of miR-181b mimic into mice in an acute inflammatory condition (i. e., sepsis), their subsequent study demonstrated that multiple injections of miR-181b mimic can reduce vascular inflammation and reduce lipid-rich plaque accumulation in mouse mo dels of atherosclerosis (Sun et al., 2014). [score:1]
Importantly, circulating levels of miR-181b are decreased in patients with sepsis, a systemic inflammatory response that is associated with EC activation, vascular permeability, and severe organ damage (Sun et al., 2012). [score:1]
MicroRNA-181b regulates NF-kappaB -mediated vascular inflammation. [score:1]
MiR-155 has been intensely studied for its role in controlling inflammation, but in contrast to miR-146a, miR-10a, miR-92a, and miR-181b, which appear to have predominantly pro- or anti-inflammatory roles, studies on miR-155 have often revealed conflicting roles for this microRNA. [score:1]
Interestingly, the miR-181b -mediated repression of NF-κB activity was only observed in the endothelium and not in leukocytes, despite efficient delivery of miR-181b to leukocytes (Sun et al., 2014). [score:1]
[1 to 20 of 22 sentences]
16
[+] score: 64
A beta-galactosidase expressing vector, and luciferase reporter constructs containing the 3′ untranslated region of the murine Cd69, Prox1, and Lif (WT or with point mutations in two putative miR-181 binding sites (Mut. [score:6]
Thus, the entire miR-181 family could modulate stress responses by targeting Lif and IL-6, especially since IL-6 is a putative target of these miRs (Table 1). [score:5]
The miR-181 family members have overlapping targets such as Cd69, Prox1, Bcl-2, dual specificity phosphatases, and protein tyrosine phosphatases (Table 1). [score:3]
This miR has both similar and distinct gene targets as miR-181a, another member of miR-181 family. [score:3]
Less is known about the role of the three other miR-181 family members (miR-181b, c, and d), two of which are expressed in developing thymocytes [39]. [score:3]
Interestingly, the 3′ untranslated region (UTR) of Lif contains 5 putative miR-181 binding sites (Figure S4A). [score:3]
It should be noted that the down-regulation of the miR-181 family was not as obvious with the RT-PCR assays as with the arrays. [score:3]
These experiments indicate that miR-181 family members can have both overlapping and distinct gene targets. [score:3]
Of the miR-181 family members that were stress responsive in the thymus, miR-181a and miR-181b were also weakly expressed in the brain and spleen. [score:3]
MiR-181d, a member of the miR-181 family, had a 5–15 fold reduced expression following LPS or dexamethasone treatment, suggesting an important functional role for this miR in thymopoiesis. [score:3]
B) Schematic representation of the reporter constructs and predicted binding sites of miR-181 family in the 3′ untranslated region of Cd69, prox1, and Lif. [score:3]
The reduced expression of the miR-17-90 cluster and the miR-181 family was even more pronounced in the DP population (Figure 4B). [score:3]
Figure S5 Dose-response analysis of miR-181 target genes. [score:3]
Target specificity of miR-181 family members. [score:3]
MiR-15a, miR-17, mir-20a, miR-20b, miR-106a, miR-128, miR-181a, miR-181b, and miR-181d were consistently down regulated (Figure 2C). [score:2]
Comparing all the thymocyte subsets, the CD8 SP was the most divergent, with the miR-17-90 cluster up regulated 2-fold and the miR-181 group unaffected by the LPS treatment. [score:2]
This difference could also explain why miR-181d expression levels are very susceptible to stress compared to miR-181a or miR-181b. [score:2]
This is because miR-181a, miR-181b, miR-181c, and miR-181d are very conserved, with only 1–4 bp differences within this family. [score:1]
These included the miR-17-90 cluster, which have anti-apoptotic functions, and the miR-181 family, which contribute to T cell tolerance. [score:1]
The seed sequence of miR-181 is underlined. [score:1]
While all murine miR-181 family members have the same seed region (nucleotides 2–8 at the 5′ end), miR-181d is the most divergent based on total pre-miR sequence, and its precise function is unknown (Figure 5A) [53], [54]. [score:1]
In addition, miR-181d and miR-181c are encoded on a chromosome (murine chromosome 8) distinct from the miR-181a and miR-181b cluster, which have undergone gene duplication on two separate chromosomes (murine chromosomes 1 and 2). [score:1]
A) Homology of miR-181 family members with the seed sequences shaded. [score:1]
0027580.g005 Figure 5 A) Homology of miR-181 family members with the seed sequences shaded. [score:1]
Each graph represents mean +/− SD of the ratio of the normalized luciferase activity in miR-181 and control vector transfections from three independent experiments, with each sample tested in triplicate (n. s.  = not significant, *p<0.05, **p<0.01, *** p<0.001, versus vector alone, unpaired Student t-test). [score:1]
This miR is a member of the miR-181 family, with all four members sharing an almost identical seed sequence. [score:1]
The individual miRs (miR-150, miR-205, miR-128, miR-181a, miR-181b, miR-181d) were detected by Northern blotting. [score:1]
Each graph represents mean +/− SD, using the ratio of the normalized luciferase activity in miR-181 and control vector transfections. [score:1]
[1 to 20 of 28 sentences]
17
[+] score: 52
We speculate that downregulation of miR-181b and miR-378* by baicalin may upregulate CPD removal via the NER signaling pathway. [score:7]
Three miRNAs (mmu-miR-378, mmu-miR-199a-3p and mmu-miR-181b) were downregulated and one (mmu-miR-23a) was upregulated in baicalin treated mice compared with UVB irradiated mice, and they were predicted to be related to DNA repair signaling pathway. [score:6]
Although there is no evidence that the Xpa gene is the direct target of miR-181b and miR-378*, the prediction of their target genes provides clues for further study. [score:6]
In chronic lymphocytic leukemia, miR-181b targets Tcl1, a known oncogene, suggesting that this miRNA is a tumor suppressor [28]. [score:5]
Other potentially important miRNAs downregulated by baicalin with UV irradiation were found in this study (i. e. mmu-miR-181b, mmu-miR-199a-3p, and mmu-miR-378). [score:4]
These two opposite behaviors of miR-181b, tumorsuppressor and oncogene, are an example of the complexity of miRNA mediated gene regulation and the role that this class of genes plays in carcinogenesis. [score:4]
However, Zhang et al. [29] reported an increased copy number of miR-181b in mammary tumors, and microarray studies showed over expression of this miRNA in cancer tissue samples. [score:3]
The expression levels of mmu-miR-233, mmu-miR-141, mmu-miR-23a and mmu-miR-181b were normalized by subtracting their Ct values from that of the internal control mmu-actin, to obtain [Δ]Ct. [score:3]
mmu-miR-181b was expressed at a lower level in the baicalin plus UVB group, but this was not significantly different from the control. [score:3]
uk/), may be a target of miR-181b and miR-378*, and plays an important role in the NER signaling pathway. [score:3]
Expression levels of mmu-miR-233, mmu-miR-141, mmu-miR-23a and mmu-miR-181b were validated using quantitative real-time PCR (qRT-PCR). [score:3]
To confirm the microarray findings, we measured the expression levels of four miRNAs (mmu-miR-223, mmu-miR-141, mmu-miR-23a and mmu-miR-181b) that may be related to the regulation of cellular processes using qRT-PCR. [score:2]
Four miRNAs (mmu-miR-23a, mmu-miR-378*, mmu-miR-199a-3p and mmu-miR-181b) were found to be differentially expressed in the UVB group compared with the baicalin plus UVB treated group (P < 0.05). [score:2]
D: mmu-miR-181b. [score:1]
[1 to 20 of 14 sentences]
18
[+] score: 52
In contrast to mature CD4+ T cells, the miR-181 site affected eGFP- Cd69 3'UTR expression in CD4+ CD8+ DP thymocytes, which express maximal levels of the developmentally regulated miR-181 [31]. [score:7]
Mutation of the miR-181 site in the Cd69 3'UTR did not measurably affect the expression of eGFP in mature CD4+ T cells (Fig. 3C), which express only low levels of the developmentally regulated miR-181 [31]. [score:6]
In addition, miR-181, which also targets Cd69 and is a known modulator of T cell receptor signaling, also affects cell-to-cell variation of CD69 expression. [score:5]
miR-181 is a known modulator of TCR signal transduction [36– 38] and our data show that the deletion of mir-181ab1 affected the CV of CD69 expression mainly by altering the proportion of thymocytes that expressed CD69 at high levels. [score:5]
org) and established target of miR-34 [28] as well as the predicted miR-181 targets Ly6a and H2-K1 (www. [score:5]
To explore the influence of miR-181 on the CV of CD69 expression we analysed DP thymocytes deficient in mir-181ab1, which accounts for most of the miR-181a and -b copies in DP thymocytes [36]. [score:3]
Interestingly, CD69 expression in miR-181 -deficient DP thymocytes also showed an increased CV (Fig. 4A) over a range of activation conditions (Fig. 4B). [score:3]
A dual fluorescence reporter system identifies endogenous microRNAs that target the Cd69 3'UTR in DP thymocytesThe Cd69 3'UTR contains predicted sites for miR-181, miR-130 and miR-17/20 (http://www. [score:3]
Following activation, miR-181 -deficient DP thymocytes showed increased mean CD69 expression (control = 245 ± 17, mean miR-181 ko = 278 ± 10, n = 26, P<10 [–10], 2-tailed T-test). [score:3]
These results show that miR-181 is an important determinant of cell-to-cell variability in CD69 expression in activated DP thymocytes, and is required to restrict the fraction of CD69 [hi] DP cells. [score:3]
The microRNA miR-181 is a critical cellular metabolic rheostat essential for NKT cell ontogenesis and lymphocyte development and homeostasis. [score:2]
CD69 controls cell migration and sphingosine 1-phosphate signaling [30], and the Cd69 mRNA is a well-characterised target of miR-181 and other microRNAs [31– 33]. [score:1]
The 842 nt 3’ UTR of Cd69 contains predicted binding sites for miR-181, miR-130 and miR-17-20 starting at positions 255, 354 and 391, respectively, which were mutated alone and in combination. [score:1]
miReduce analysis [27] of 3'UTR motifs associated with post-transcriptional de-repression in Lck-Cre DP thymocytes (see GSE57511) showed enrichment for microRNAs miR-181, miR-17 and miR-142 (Fig. 1B). [score:1]
The increased CV was due mainly to a higher fraction of CD69 [hi] cells among miR-181 -deficient DP thymocytes (Fig. 4C). [score:1]
This is consistent with a role for miR-181 as a modulator of TCR signaling [36– 38] (Fig. 4E). [score:1]
E) Mo del for the action of miR-181 upstream of TCR signaling and on Cd69 mRNA. [score:1]
The Cd69 3'UTR contains predicted sites for miR-181, miR-130 and miR-17/20 (http://www. [score:1]
[1 to 20 of 18 sentences]
19
[+] score: 49
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
HDI Upregulates Selected miRNAs that Target AicdaWe have shown by qRT-PCR that miR-155, miR-181b, and miR-361, which silence AID by targeting Aicda 3′ UTR, were significantly upregulated by HDI (16). [score:11]
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
In addition to the targeting sites for miR-155, miR-181b, and miR-361, the 3′ UTR of mouse Aicda mRNA also contains the putative target sites for miR-125a, miR-351, miR-92b, miR-26a, and miR-103 (identified by using miRNA -targeting prediction tools: TargetScan. [score:9]
We have further shown that HDI, such as VPA and butyrate, inhibit AID and Blimp1 expression by upregulating miR-155, miR-181b, and miR-361, which silenced AICDA/Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silenced PRDM1/Prdm1 mRNA (16). [score:8]
We have shown by qRT-PCR that miR-155, miR-181b, and miR-361, which silence AID by targeting Aicda 3′ UTR, were significantly upregulated by HDI (16). [score:6]
Some miRNAs, including miR-155, miR-181b, and miR-361, can silence AID expression, whereas miR-30a and miR-125b can silence Blimp-1 expression (16). [score:5]
[1 to 20 of 6 sentences]
20
[+] score: 42
To determine whether decreased miR-21 and miR-181b expression in S100A9 knockout mice during late sepsis is due to lack of C/EBPβ expression and/or Stat3 phosphorylation, we examined C/EBPβ and phosphorylated Stat3 protein levels in the Gr1 [+]CD11b [+] cell lysates. [score:6]
Mechanistically, our data support that nuclear S100A9 promotes the expression of known immunosuppressive miR-21 and miR-181b (24). [score:5]
However, the mechanistic link between miR-21 and miR-181b expression, as well as the signaling regulatory path involving C/EBPβ and NFI-A, supports that S100A9 acts as a transcription co-factor or an indirect epigenetic mediator. [score:5]
Figure 8The expression of miR-21 and miR-181b in Gr1 [+]CD11b [+] cells is inhibited during late sepsis. [score:5]
Expression of miR-21 and miR-181b is induced in Gr1 [+]CD11b [+] cells during sepsis and promotes Gr1 [+]CD11b [+] cell expansion (24). [score:3]
These results strongly support that S100A9 sustains both NFI-A and miR-21 and miR-181b levels during late sepsis immunosuppression. [score:3]
Quantitative real-time qPCR was used to determine the expression levels of S100A8, S100A9, miR-21, and miR-181b in Gr1 [+]CD11b [+] cells. [score:3]
MDSCs Lacking S100A9 Do Not Express miR-21 and miR-181b during Late Sepsis. [score:3]
We also reported that NFI-A expression is induced downstream of miR-21 and miR-181b and promotes Gr1 [+]CD11b [+] cell expansion during sepsis by attenuating myeloid cell differentiation and maturation (31). [score:3]
We previously reported that miR-21 and miR-181b induction during sepsis is dependent on both C/EBPβ expression and Stat3 phosphorylation, which synergize to activate miR-21 and miR-181b promoters (37). [score:3]
Levels of miR-21 and miR-181b in Gr1 [+]CD11b [+] cells were increased during early sepsis in both wild-type and knockout mice (Figure 8A). [score:2]
We reported that blocking miR-21 and miR-181b in septic mice by administration of miRNA antagomiRs diminishes Gr1 [+]CD11b [+] MDSC expansion during late sepsis response (24). [score:1]
[1 to 20 of 12 sentences]
21
[+] score: 42
Figure 3Treatment with Tf-NP- miR-181a increased mature miR-181a levels; downregulated KRAS, NRAS, and MAPK1; and inhibited the RAS-MAPK1 signaling pathwayMature miR-181a, miR-181b and miR-140 expression levels in KG1a, OCI-AML3 and MV4-11 cells (A) and primary patient blasts (n = 3) (C). [score:8]
With regard to AML, we previously provided preliminary evidence that miR-181 may target elements of the “inflammasome” that ultimately lead to NF-κB activation and leukemia growth, while Li et al. showed that miR-181 promoted apoptosis, reduced viability and delayed leukemogenesis in MLL-rearranged AML by downregulating the homeobox gene PBX3 [28]. [score:6]
However, in glioma high expression of miR-181 seems to have tumor suppressor activity [22]. [score:5]
In hematologic malignancies higher expression of miR-181 is associated with better outcomes [2, 9, 26– 28]. [score:3]
High expression of miR-181 has been associated with poor clinical outcomes in patients with colorectal cancer [20] and lymph node metastasis in oral squamous cell carcinoma [21]. [score:3]
miR-181a, miR-181b and miR-140 expression were normalized to U44. [score:3]
Mature miR-181a, miR-181b and miR-140 expression levels in KG1a, OCI-AML3 and MV4-11 cells (A) and primary patient blasts (n = 3) (C). [score:3]
Whereas in colorectal cancer [20] and lymph node metastasis in oral squamous cell carcinoma [21] a high miR-181 level seems to be associated with worse clinical outcomes, in glioma this miR has tumor suppressor function [22]. [score:3]
The miR-181 family comprises four mature miRs (miR-181a, miR-181b, miR-181c, miR-181d) and has been associated with the regulation of inflammatory mechanisms [17, 18]. [score:2]
It should also be underscored that we and others have reported that increased levels of miR-181 lead to enhancement of sensitivity to chemotherapy in AML mo dels [45, 46, 63]. [score:1]
After 24 hours exposure, mature miR-181a levels increased 211 ± 31, 880 ± 10 and 142 ± 10-fold in KG1a, OCI-AML3 and MV4-11 cells, respectively, whereas levels of miR-181b and unrelated miR-140 remained unchanged (Figure 3A). [score:1]
The miR-181 -family has been reported to be an effector in inflammatory response by TNF-α, IL-6, IL-1β, IL-8 and IL-10 [17, 18, 51– 53]. [score:1]
Physiologically, miR-181 may accelerate the megakaryocyte differentiation of CD34 -positive hematopoietic cells [19]. [score:1]
In solid tumors the role of miR-181 seems to be organ-specific. [score:1]
cDNA was synthesized using Superscript III (Invitrogen) or the Taqman miR Reverse Transcription kit (Applied Biosystems, Foster City, CA) for miR-181a, miR-181b, miR-140 and U44. [score:1]
[1 to 20 of 15 sentences]
22
[+] score: 37
Taking into account these previous studies about miR-19b and miR-181b as biomarkers in cardiac disease, we suggest the validation of their utilization as biomarkers for diabetic cardiomyopathy in a specific group of patients diagnosed with asymptomatic diabetes (related to obesity) without pre-existing coronary arterial disease in the context of primary prevention of cardiovascular disease. [score:7]
On the other hand, miR-181b myocardial expression was not associated with cardiac dysfunction in diabetic cardiomyopathy animal mo dels. [score:3]
In addition, miR-181b expression was markedly reduced in cardiac fibroblasts in response to Angiotensin II, suggesting its potential role in cardiac fibrosis [39]. [score:3]
Das, S. et al. Divergent Effects of miR-181 Family Members on Myocardial Function Through Protective Cytosolic and Detrimental Mitochondrial microRNA Targets. [score:3]
At 16 months, all 15 miRNAs were significantly downregulated in heart tissue of obese mice compared to heart tissue of normal mice: let-7f-5p (FC: 3.3), miR-10a-5p (FC: 2.6), miRNA-19b-3p (FC: 5.0), miR-25-3p (FC: 2.6), miR30e-5p (FC: 5.6), miR-140-5p (FC: 5.0), miR-155-5p (FC: 1.7), miR-146a-5p (FC: 4.0), miR-181b-5p (3.0), miR-199a-3p (FC: 3.6), miR-322 (FC: 1.5), miR-451 (FC: 1.9), miR-499-5p (FC: 5.4), miR-669m-5p (FC: 1.7) and miR-3473b (FC: 3.4). [score:3]
We found 8 circulating miRNAs that were less abundant in the obese mice than in normal mice, indicating an association between their gene expression in myocardium: let-7f-5p (FC: 5.4), miR-10a-5p (FC: 2.3), miRNA-19b-3p (FC: 2.5), miR-25-3p (FC: 3.4), miR-140-5p (FC: 4.5), miR-146a-5p (FC: 3.3), miR-181b-5p (FC: 5.2) and miR-499-5p (FC: 2.2). [score:3]
However, recent works suggest that miR-181b may have a central role in vascular inflammation, inhibiting the activation of NF-κB signalling in endothelial cells [32]. [score:3]
Regarding circulating miRNAs as potential biomarkers of diabetic cardiomyopathy, we found an association between differential miRNA expressions in myocardium and plasma at 16 months in 8 miRNAs (let-7f-5p, miR-10a-5p, miR-19b-3p, miR-25-3p, miR-140-5p, miR-146a-5p, miR-181b-5p, miR-499-5p). [score:3]
Regarding insulin resistance mechanisms, Sun and colleagues reported that gene expression of miR-181b was decreased in adipose tissue and endothelial cells of obese mice, impairing glucose homeostasis, insulin sensitivity and promoting adipose tissue inflammation [40]. [score:3]
Seeger and colleagues reported that a decrease of miR-181b and miR-181c levels in serum correlate with changes in the course of immune-senescence accentuated in chronic heart failure patients, providing evidence for miR-181c as a biomarker of poor prognosis in patients with ischaemic or dilated cardiomyopathy [54]. [score:1]
At 12 months we observed a reduction of their abundance in 4 circulating miRNAs: miR-25-3p (FC: 1.5), let-7f-5p (FC: 5.2), miR-181b-5p (FC: 2.0) and miR-19b-3p (FC: 3.4); plasmatic levels were reduced in obese mice during the dietary treatment (Fig.   6). [score:1]
Based on previous pre-clinic studies, the miRNAs validated by RT-qPCR in our study are involved in alteration of glucose and lipid metabolism via insulin pathways (let-7f-5p, miR-10a-5p, miR-322) 20– 22, in cardiomyocytes apoptosis (miR-19b-3p, miR-25-3p, miR-30e-5p, miR-140-5p, miR-199a-3p, miR-499) 23– 28, in mitochondrial function (miR-181a/b) [29], in pro-inflammatory signalling (miR-146a-5p, miR-155, miR-181b-3p, miR-3473b) 30– 33, and in cardiac hypertrophy (miR-451) [34] and myocardial fibrosis process (miR-19b) 35, 36. [score:1]
Hori D and colleagues demonstrated that age -dependent decrease of miR-181b plays a critical role in vascular remo delling by activating TGF-β/pSmadD2/3 pathways [38]. [score:1]
In conclusion, we propose miR-19b and miR-181b as potential biomarkers for diabetic cardiomyopathy, with eventual application in clinical diagnosis to prevent metabolic and functional alteration in hearts of asymptomatic diabetic patients. [score:1]
Supplementary materials miR-19b and miR-181b gene targerts miRNA Microarray Raw data We thank Dr. [score:1]
[1 to 20 of 15 sentences]
23
[+] score: 35
While a number of mRNA targets of miR-181 have been reported, it is not known whether miR-181d has overlapping and/or distinct targets. [score:5]
Such results reveal a differential regulation of miR-181 family members under both steady and disease states [11], [34], [35]. [score:4]
All miR-181 family members are primarily expressed in the thymus, at levels at least 10-20 fold higher than the brain and liver [35]. [score:3]
These experiments suggest that the targeted elimination of one miR-181 family member is insufficient to modulate the stress responsiveness of developing thymocytes. [score:3]
None of the miR-181 family members are normally expressed in these cells [11]. [score:3]
Consistent with this, a complete targeting of all miR-181 family members causes an embryonic lethality [39]. [score:3]
Interestingly, while miR-181d was down-modulated around 15-fold, the much more abundantly expressed miR-181a and miR-181b family members were only minimally affected [11]. [score:3]
MiR-181 family members also target Bcl2, with its reduction increasing the GC-sensitivity of DP thymocytes [19], [36], [53]. [score:2]
Contrasting this, the complete deficiency of all miR-181 family members is embryonic lethal, suggesting a functional compensation or redundancy [38]. [score:1]
The miR-181 family comprises four members, miR-181a, miR-181b, miR-181c, and miR-181d, which are generated from three separate genomic clusters (miR-181ab1, miR-181ab2, and miR-181cd) [32], [33]. [score:1]
In contrast to the stress effects on miR-181d, miR-181c remains unchanged while miR-181a and miR-181b are reduced 2- and 6-fold, respectively [11]. [score:1]
These results suggest that multiple miR-181 family members function in a compensatory manner. [score:1]
It is a member of miR-181 family that includes miR-181a, miR-181b, and miR-181c. [score:1]
It is also plausible that stress can lead to a metabolic reprogramming in immature thymocytes by modulating miR-181 levels. [score:1]
This strongly argues for a functional redundancy/compensatory process among the miR-181 family members. [score:1]
0085274.g001 Figure 1(A) Schematic shows the sequence homology between mature miR-181 family members. [score:1]
Accordingly, T cell-specific elimination of miR-181 family members might be beneficial to recover from thymic atrophy. [score:1]
[1 to 20 of 17 sentences]
24
[+] score: 34
MiR-181 family members play a key role in the regulation of lymphocyte development and function [6- 11]; in particular, miR-181c has been shown to suppress the activation of CD4+ T cells [10]. [score:5]
MiR-181 has been shown to inhibit inflammation in astrocytes, microglia, and dendritic cells by suppressing cytokine levels [11, 14, 15, 22], and miR-181c -transfected BV2 cell culture medium reduced neuronal apoptosis induced by LPS [15]. [score:5]
The lymphocyte miRNA microarray analysis of acute stroke patients revealed that miR-181 family members, including hsa-miR-181a/c/d, were among the top 44 down- or up-regulated miRNAs (Table 1, P < 0.05), implying that this family is clinically relevant. [score:4]
Bcl-2, a mitochondrial membrane -associated protein, is a target of miR-181 that mediates miR-181a -mediated Neuro-2a cell death upon oxidative stress [14], miR-181a-triggered mitochondrial dysfunction and astrocyte death upon glucose deprivation [9], and miR-181d -induced glioma cell apoptosis [23]. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
Hence, miR-181 causes cell injury mainly by targeting mitochondrial proteins. [score:3]
hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. [score:3]
Inhibition of microRNA-181 reduces forebrain ischemia -induced neuronal loss. [score:3]
miR-181 regulates GRP78 and influences outcome from cerebral ischemia in vitro and in vivo. [score:2]
MicroRNA-181 regulates CARM1 and histone arginine methylation to promote differentiation of human embryonic stem cells. [score:1]
This is consistent with a previous observation that miR-181 levels were reduced in the brain tissue of rats subjected to transient focal ischemia [12], and were decreased in the ischemic penumbra, but increased in the ischemic core following transient focal ischemia in the mouse [13]. [score:1]
Evidence for miR-181 involvement in neuroinflammatory responses of astrocytes. [score:1]
[1 to 20 of 12 sentences]
25
[+] score: 33
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-146a, mmu-mir-181b-1, mmu-mir-126b
MiR-146a and miR-181b are downregulated in inflamed endothelium. [score:4]
The expression of miR-146a (A), miR-181b (B), and E-selectin (C) in HMVECs after treatment with TNF-α (10 ng/mL) for 0, 2, and 6 hours. [score:3]
However, the miR-181b packaged in MSV non -targeted system did not have effects, and so did scrambled RNA (Supplementary Fig. S5). [score:3]
The expression of Ccl2 (G), Ccl5 (H), Ccl8 (I), and Cxcl9 (J) in aortic tissues of ApoE [−/−] mice after intravenously injected with vehicle, miR-146a, and miR-181b (15 μg) loaded in PEG/PEI nanoparticles or ESTA-MSV microparticles biweekly for 12 weeks. [score:3]
The expression of miR-146a and miR-181b in inflamed endothelial cells and the transfection efficiency of particles. [score:3]
The expression of miR-146a (F) and miR-181b (G) in HMVECs after transfected with the particles as above. [score:3]
The expression of miR-181b in aorta (B) liver (D) and spleen (F) of ApoE [−/−] mice after injected with PEG/PEI/miR-181b or ESTA-MSV/miR-181b for 12 weeks. [score:3]
Induction of inflammation in HMVECs with TNF-α (10 ng/mL) significantly reduced miR-146a and miR-181b expression (Fig. 1A,B); miR-146a and miR-181b were also down regulated in human aortic tissue with plaque compared to the tissue without plaque (Supplementary Fig. S1A,B). [score:3]
Representative en face ORO-stained aortic arches and thoracic aortas of ApoE [−/−] mice intravenously injected with vehicle, miR-146a, and miR-181b (15 μg) loaded in PEG/PEI nanoparticles or ESTA-MSV microparticles (A) biweekly for 12 weeks. [score:1]
Meanwhile, mice were injected with PEG/PEI-vehicle, PEG/PEI-miR-146a, PEG/PEI-miR-181b nanoparticles, or ESTA-MSV-vehicle, ESTA-MSV-miR-146a, ESTA-MSV-181b microparticles biweekly for 12 weeks via the tail vein. [score:1]
In the present study, mice were injected with 2 nmol of miR-181b packaged in ESTA-MSV system every other week and showed decreased atherosclerosis. [score:1]
The average dosage of miR-181b was similar between these two studies. [score:1]
Importantly, we found that miR-146a and miR-181b decreased plaque size and macrophage infiltration, while increased vascular SMCs and collagen deposition. [score:1]
The ACh -induced relaxation of Phe-precontracted abdominal aortas of ApoE [−/−] mice after intravenously injected with vehicle, miR-146a, and miR-181b (15 μg) loaded in PEG/PEI nanoparticles (A) or ESTA-MSV microparticles (B) biweekly for 12 weeks. [score:1]
Sun et al. 23 reported that injection with 1 nmol of miR-181b packaged with lipofectamine once a week for 12 weeks through tail vein attenuated the atherosclerosis in ApoE [−/−] mice. [score:1]
The mature miR-146a (5′-UGA GAA CUG AAU UCC AUG GGU U-3′), miR-181b (5′-AAC AUU CAU UGC UGU CGG UGG GU-3′), and Cy5-labeled miRs were synthesized by Integrated DNA Technologies (IDT, Coralville, IA). [score:1]
[1 to 20 of 16 sentences]
26
[+] score: 31
miR-181 is thought to function partly through inhibition of Hox-A11 expression [60]. [score:5]
An acute bout of endurance exercise results in the up-regulation of miR-1 and miR-181. [score:4]
In addition, miR-181 was found to be strongly up-regulated in regenerating muscle from an in vivo mouse mo del of muscle injury [60]. [score:4]
miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
miR-1 and miR-181 expression following exercise. [score:3]
Both miR-1 and miR-181 expression, were increased in quadriceps by 40% and 37% (END vs. [score:3]
0005610.g004 Figure 4miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
miR-1 and miR-181 are thought to play an important role in muscle differentiation and development as positive regulators of skeletal muscle remo deling and maintenance [26]. [score:3]
miR-1 and miR-181 expression are normalized to Rnu6. [score:3]
[1 to 20 of 9 sentences]
27
[+] score: 27
The sequences for control and miR-181a inhibitors were as follows: control inhibitor, 5′-CAGUACUUUUGUAGUACAA-3′ and miR-181 inhibitor, 5′-ACUCACCGACAGCGUUGAAUGUU-3′. [score:7]
MiR-181a down-regulates triglycerides and total cholesterol levels in vivoWe have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:5]
The findings that IDH1 is a direct target of miR-181 and the opposite phenotypes displayed by miR-181a TG and IDH1 TG mice led us to test the possibility that miR-181a may regulate lipid metabolism through IDH1. [score:5]
To knockdown miR-181a in mice, six-week old miR-181 WT male mice were given administration of nanoparticles packed with either control or miR-181a inhibitors four times at one-week intervals 33. [score:4]
To determine whether miR-181a is involved in the regulation of lipid metabolism, six-week old miR-181 TG and WT male mice were fed with high fat diet (HFD) for 10 weeks. [score:2]
To explore whether miR-181a is involved in the regulation of lipid metabolism, both miR-181 TG and WT mice were fed with high fat diet (HFD), and after 10 weeks of feeding, miR-181a TG mice exhibited smaller size and lower body weight than miR-181a WT mice (Figures 1A and 1B) while these mice showed no obvious differences in food intake (Supplementary Figure S1B). [score:2]
We have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:2]
[1 to 20 of 7 sentences]
28
[+] score: 25
Contrary to an over -expression of miR-181a and miR-181b in TEC, miR-181a1 and miR-181b1 deletion in Foxn1-Cre::Mir181a1/b1 [fl/fl] mice did not impact on total or lineage-specific TEC cellularity. [score:3]
In order to determine the functional role of miR-181-5p in TEC, the cell line mTEC1 was transfected with miR-181a-5p mimic, miR-181a-5p inhibitor, or a negative control and their in vitro proliferation was quantified[28]. [score:3]
Deletion of both miR-181 and miR-181 in mice perturbed Natural Killer T (NKT) cell and thymocyte development by regulation through PTEN phosphatase modulation of phosphatidylinositol 3-kinase (PI3K) that affects their anabolic activity[24]. [score:3]
Whereas miR-181a-1 and miR-181b-1 are on mouse chromosome 1, ~150-bp apart, miR-181a-2 and miR-181b-2 are on mouse chromosome 2, 1.1 kb apart from each other [23] MiR-181a is highly expressed in the thymus and at lower levels by cells in the heart, lymph nodes and bone marrow (BM)[11, 13]. [score:3]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
This resulted in decreased number of T cells and an increase number of B cells showing that miR-181 acts as a positive regulator of B cells. [score:2]
The importance of miR-181 genes has been shown to be important in cellular growth, development, endothelial cell function and also plays an important role in the immune system[19] [20] [21]. [score:2]
TaqMan Probes used for miRNA181 detection were: mmu-miR-181a (mature miRNA sequence): ACCGACCGUUGACUGUACCUUG, miRBase Accession Number MIMAT0005443. [score:1]
These mice had a decrease in the absolute number of thymocytes further emphasizing the important role miR-181 plays in thymus[24]. [score:1]
In mice with a miR-181 deletion, the absolute number of thymocytes is significantly decreased, highlighting the important role miR-181 plays in thymus[24]. [score:1]
The family of miR181 genes is encoded by 6 miRNAs on three separate chromosomes- MiR-181a1, miR-181a2, miR-181b1, miR-181b2, miR-181c, and miR-181d[22]. [score:1]
In mature CD8+ T cells that were transduced with miR-181a, the TCR was much more sensitive to antigenic stimulation based on the number of peptides required to produce IL-2. Studies by Chen et al. [21], evaluated the ectopic expression of miR-181 in murine lineage negative bone marrow cells. [score:1]
miRNA181 [a/b] relative expression was calculated as 2 [-∆Ct] values. [score:1]
mmu-miR-181b (mature miRNA sequence): CUCACUGAACAAUGAAUGC, miRBase Accession Number MIMAT0017067. [score:1]
[1 to 20 of 14 sentences]
29
[+] score: 23
Since activation of SIRT1 in neuronal precursors promotes astrocyte formation over neurogenesis [34], SIRT1 might represent a critical target for miR-9. Another similar example is miR-181, which is transiently upregulated during muscle differentiation [35]. [score:6]
Site-directed mutagenesis was performed using a QuikChange II Site-Directed Mutagenesis kit (Stratagene; La Jolla, CA) to mutate base pairs 3-6 in the predicted seed region targeted by miR-181 and miR-9 in the SIRT1 3'-UTR. [score:5]
Furthermore, miR-181 and miR-29 family members are downregulated in chronic lymphocytic leukemia, and miR-29 is lost in colon, breast, and lung cancer [50, 53]. [score:4]
Thus, miR-181 family members and miR-9 target the 3'-UTR of SIRT1 through the predicted seed sites. [score:3]
The specificity of this inhibition was demonstrated by testing the effect of the same miRNAs on a construct in which the miR-181 seed -binding site was mutated (pGL3-SIRT1 3'-UTR 181mt; Figure 4A, left panel). [score:3]
Thus, regulation of SIRT1 by miR-181 might contribute to the muscle differentiation program. [score:2]
[1 to 20 of 6 sentences]
30
[+] score: 21
org), the Serial Analysis of Gene Expression (SAGE) and the literature [37, 38], and commercial hearing loss databases and found four genes to be targeted by both NR2F1 and miRNAs: Crym and Snai2 were both targeted by miR-96 and miR-181b; Gjb2 was targeted by miR-140 and miR-183 (Table S5 in File S1 ). [score:9]
With these criteria a set of 11 miRNAs (miR-17, miR-33, miR-96, miR-140, miR-181b, miR-183, miR-191, miR-194, miR-199b, miR-341, and miR-1192) were selected that might participate to coordinate with NR2F1 to regulate inner ear gene expression. [score:4]
Of note, miR-140, -181b and -191 each have a putative NR2F1 binding site close to the proximal portion of their genes and since miR-181b is found in a family cluster we also included miR-181a and -181c, which may be coregulated and share similar gene targets. [score:4]
Of the miRNAs expressed, miR-17 and miR-341 have NR2F1 binding sites within their coding regions, miR-140, miR-191 and miR-199b have NR2F1 binding sites within the proximal promoter region of their loci, and miR-183 and miR-181b have NR2F1 binding sites 8 and 15 base pairs immediately upstream of the transcription start sites, respectively. [score:3]
The levels of miR-181b, -181c and -191 were also decreased but did not reach significance (P=0.3, 0.4, 0.1, respectively). [score:1]
[1 to 20 of 5 sentences]
31
[+] score: 21
All three miRNAs have previously been found to be differentially regulated in MS lesions: miR-146a and miR-193a were upregulated in active MS lesions, whereas miR-181b was found to be down regulated in inactive MS lesions (8). [score:6]
Only one recent study examined miRNA expression during CPZ -induced demyelination by microarray, but miRNAs were only evaluated in sorted CNPase-EGFP [+] cells with an OPC phenotype; only part of the differentially expressed miRNAs were presented, and those did not show miR-181b, miR-146a, or miR-193a (46). [score:3]
Based on a microarray analysis followed by verification with qPCR, we identified three miRNAs, miR-146a, miR-181b, and miR-193a that were differentially expressed in response to CPZ exposure. [score:3]
By contrast, the expression level of miR-193a and miR-181b decreased in response to CPZ -induced demyelination and had returned to baseline in the full remyelination phase (p < 0.001 and p < 0.01, respectively, one-way ANOVA, LSD post hoc test) (Figures 1B,C). [score:3]
In summary, here we used a comprehensive and unbiased approach to identify three miRNAs, miR-146a, miR-181b, and miR-193a, which were differentially regulated in the corpus callosum in response to CPZ exposure. [score:2]
We identified three miRNAs, miR-146a, miR-181b, and miR-193a, which were differentially expressed compared to controls confirmed by qPCR (Figure 1). [score:2]
Using microarray and validation by quantitative PCR (qPCR), three miRNAs, miR-146a (A), miR-193a (B) and miR-181b (C) were differentially regulated in response to CPZ exposure in the corpus callosum. [score:2]
[1 to 20 of 7 sentences]
32
[+] score: 20
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
Analysis of miR-125 and miR-181 families revealed additional intra -family target preferences (Supplementary Fig. 9a–d). [score:3]
Similarly, miR-181 family members were enriched in both seed -dependent and -independent classes. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 19
As shown, the expression levels of miR-183 and miR-181 were significantly downregulated, while miR-29a and miR-34a were upregulated with aging compared to P21. [score:8]
The two downregulated miRNAs, miR-181 and miR-183, are important for proliferation and differentiation, respectively [39]– [42]. [score:4]
miRNAs that were significantly downregulated include members of the miR-181 and miR-183 families. [score:4]
Previous studies have shown that transfection of miR-181b in HeLa and HCT-116 tumor cells regulates a large number of genes, inducing those related to cell growth. [score:2]
The miR-181 family is known to mediate proliferation in many cells [54], [65], [66]. [score:1]
[1 to 20 of 5 sentences]
34
[+] score: 19
The ten most upregulated and downregulated genes and microRNAs by p values, and their fold changes are shown in Table 1. Expression changes for 5 miRNAs (let-7b, let-7i, miR-181b, miR-376b, miR-762) were studied by qRT-PCR, and while the expression changes trended in the same direction as the array analysis the results did not achieve statistical significance (S1 Fig). [score:12]
The most significantly downregulated miRNAs were miR-181b and miR-126-3p (KO/WT ratio 0.4 and 0.46 respectively) while most upregulated miRNAs included miR-762 and miR-3960 (KO/WT ratio 4.43 and 4.2 respectively). [score:7]
[1 to 20 of 2 sentences]
35
[+] score: 19
We observed both miR-21 and miR-181b gene expression were dramatically reduced in RH30 and RH28 rhabdomyosarcoma cell lines by Bazedoxifene treatment (Fig 3D), which was consistent with the report that miR-21 expression was strongly suppressed by silence of STAT3 siRNA [41]. [score:7]
The expression of several known GP130/STAT3 downstream target genes and microRNA such as CYCLIN D1, SURVIVIN, and BCL-XL, miR-21, and miR-181b was reduced following Bazedoxifene treatment shown by RT-PCR or quantitative RT-PCR analysis, which also support the idea that Bazedoxifene is a potent inhibitor of GP130. [score:7]
D, miR21 and miR-181b gene expression were analyzed by real-time quantitative RT-PCR in RH30, or RH28 cells treated with Bazedoxifene overnight at the indicated concentration, **, P < 0.01; ***, P < 0.001. [score:3]
Mature microRNA-21 (miR-21) and microRNA-181b (miR-181b) gene expression were measured by quantitative reverse transcriptase (qRT-PCR) [37]. [score:1]
In addition, two STAT3 activation dependent microRNA-21(miR-21) and microRNA-181b (miR-181b), which were recently recognized oncogene implicated in multiple malignancy-related processes such as cell proliferation, anti-apoptosis, metastasis, and drug resistance [39, 40], were examined in RH30 and RH28 cells treated with Bazedoxifene using quantitative RT-PCR as described in Material and Method. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 18
Since we have previously shown that HMGA1 is able to negatively regulate CBX7 expression (Mansueto et al., 2010) and that HMGA1 positively regulates miR-181 that has CBX7 as target, we can envisage a HMGA1-CBX7 network that operates in the regulation of tumour progression and adipocyte cell growth and differentiation. [score:8]
Identification of a new pathway for tumor progression: microRNA-181b up-regulation and CBX7 down-regulation by HMGA1 protein. [score:7]
Interestingly, a drastic increase in miR-181b expression has been observed in 3T3-L1 cells after induction of adipocyte differentiation (R. F., personal communication). [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 17
In order to mitigate the observed off- target transgene expression in ganglion cells following intravitreal delivery of hGRK1-containing AAV vectors, we incorporated a target sequence for miR181, an miRNA shown to be expressed exclusively in ganglion cells and inner retina into our AAV vectors (Atlas of miRNA distribution: http://mirneye. [score:9]
Similar to methods previously described, [32] we further restricted transgene expression to PRs by incorporating multiple target sequences for miR181, an miRNA endogenously expressed in cells of the inner and middle retina. [score:7]
A hGRK1-GFP-miR181c construct was also generated and packaged in AAV2(quad Y−F+T−V) by inserting four tandem copies of complementary sequence for mature miR-181 (5′ ACTCACCGACAGGTTGAA 3′) (Atlas of miRNA distribution: http://mirneye. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 17
Another study revealed that miR-181 could effectively suppress the expression of Lin28 expression, disrupt the Lin28-let-7 reciprocal regulatory loop, upregulate Let-7, and eventually promote the differentiation of megakaryocytic. [score:11]
Chen et al. [51] reported that miR-181 was preferentially expressed in B cells of bone marrow in mice; moreover, a tissue culture differentiation assay in mice showed that the fraction of B-lineage cells increased after ectopic expression in HSPCs. [score:4]
Nevertheless, miR-181 had no function on hemin -induced erythrocyte differentiation [52]. [score:1]
Li X. Zhang J. Gao L. McClellan S. Finan M. A. Butler T. W. Owen L. B. Piazza G. A. Xi Y. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit Cell Death Differ. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 16
MiR-181a overexpression or SIRT1 knockdown impairs glucose and lipid metabolism in vivoTo explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:9]
To explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:6]
uk/) showed that four miR-181s, namely, miR-181a, miR-181b, miR-181c, and miR-181d, have been identified previously. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 16
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
[1 to 20 of 1 sentences]
41
[+] score: 15
Specifically, miR-181 family members (including miR-181c) were found to be upregulated in hepatocarcinoma stem cells [64] and are misexpressed in different forms of leukemia [68], [69], [70]. [score:6]
This suggests distinct commitments of Smad2/3 in either the transcriptional (Smad4 -dependent) or post-transcriptional (Smad4-independent) regulation of miR-181 family members. [score:2]
Interestingly, several studies have demonstrated the deregulation of the miR-181 family [64], [65], [66], [67], [68], [69], [70] and members of the pri-miR-341∼3072 cluster [71], [72], [73], [74], [75], [76], [77], [78], [79], in various forms of cancer. [score:2]
Specifically, miR-181b was activated in response to TGF-β signaling in hepatocellular carcinoma cells, and siRNA knockdown of Smad4 resulted in a decrease in mature miR-181b levels [63]. [score:2]
However, in this study siRNA knockdown of Smad4 actually increases mature levels of miR-181 family members, consistent with a Smad4-independent role for Smad effectors, as demonstrated by previous studies [44], [45], [46]. [score:2]
miR-181 family members and miR-382 have been previously reported to respond to TGF-β/Activin treatment in different cells and tissues [46], [61], [62], [63]. [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 14
Regulation of CXCR4 function by miRNAs may also occur at the signaling level as another regulator of NK cell development, miR-181, was shown to repress PTEN expression in NKT cells thus allowing proper CXCL12-stimulation of Akt without affecting CXCR4 expression during thymic development (54). [score:9]
In human, miRNA-181 expression increases during NK cell maturation and promotes NK cell differentiation by regulating Notch signaling, essential for lymphocyte development (26). [score:5]
[1 to 20 of 2 sentences]
43
[+] score: 14
Suppression of miR-181-a/-b produced a significant delay in tumour development in a mouse mo del of MM, confirming that this miRNA nourishes MM tumour growth. [score:4]
Pichiorri et al. [25] have shown that miR-181-a/-b, miR-106b~25 and miR-32 are up-regulated in MGUS, MM primary cells and cell lines. [score:4]
Moreover, miR-21, as well as miR-181-a/-b, is upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
Finally, miR-181-a/-b were significantly upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
[1 to 20 of 4 sentences]
44
[+] score: 13
Furthermore, miR-181b-5p was also among the most expressed ovarian miRNAs and its variants were up-regulated in young (mmu-miR-181a-2-3p) and aged df/df mice (mmu-miR-181b-5p). [score:6]
One of the main targets of miR-181 is the ATM mRNA, an important cell cycle checkpoint kinase [61] that has role in repairing double strand DNA breaks [62]. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
The mir-181 family has a role in differentiation of hematopoietic cells [60], and was shown to be induced by TGF-β ligands [61]. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 13
For example, differences in the transcripts level of two microRNA were detected (Table S2 in): mir181-b was downregulated in the 3NF/pCI, while mir1186 was downregulated in K3/pCI. [score:7]
Interestingly, mir181-b inhibits the expression of importin-α3 that is crucial for translocation of NF-κB from cytoplasm to nucleus. [score:5]
The level of mir181-b is reduced after proinflamatory stimulation, e. g., by TNF-α and the transcription of NF-κB -dependent genes can be activated (33). [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 12
Similarly, while miR-133a and miR-181 were down-regulated, the mRNA level of their target, pro-survival gene Mcl1 [36, 37] was up-regulated in the CR heart (Fig. A in S2 File). [score:9]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 12
In this work, we have discovered that, knockdown of Beclin‐1 by siRNA protected the cells from miR181‐5p‐ADSC‐induced autophagy and propose that miR‐181‐5p induces autophagy by inhibiting the STAT3/Bcl‐2/Beclin 1‐dependent pathway. [score:4]
Furthermore, the up‐regulated expression of fibrotic genes in HST‐T6 cells induced by TGF‐β1 was repressed following the addition of isolated miR181‐5p‐ ADSC exosomes compared with miR‐67‐ ADSCexosomes. [score:3]
We found that miR181‐5p down‐regulated STAT3 and Bcl‐2 and activated autophagy in HST‐T6 cells. [score:2]
Exosomes from miR181‐5p‐ ADSCs down‐regulated Stat3 and Bcl‐2 and activated autophagy in the HST‐T6 cells. [score:2]
By exploiting the characteristics of exosome excretion, we have shown that up‐regulated expression of fibrotic genes in HST‐T6 cells induced by TGF‐β1 was repressed following the addition of isolated exosomes containing miR181‐5p compared with exosomes containing the control miR‐67 from C. elegans. [score:1]
[1 to 20 of 5 sentences]
48
[+] score: 12
Over -expression of miR-181b in the vasculature inhibits the expression of NF-κB -dependent genes and protects mice from sepsis (Sun et al, 2012). [score:7]
More recently, miR-181b was found to repress the expression of importin-α3, which is required for the nuclear import of NF-κB proteins (Sun et al, 2012). [score:3]
The MiScript system was also used for the analysis of other microRNAs (miR-10a, miR-17, miR-31, miR-155 and miR-181b) in wild-type and miR-146a [−/−] hearts. [score:1]
This implies that miR-146 may have an even broader anti-inflammatory role than miR-10a, miR-31, miR-17-5p or miR-181b. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 10
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-181b-1, mmu-mir-181c
Downregulation of Six2 by microRNAs miR-181b or miR-181c inhibits cell proliferation and promotes apoptosis in metanephric kidney mesenchymal cells in vitro (Lyu et al., 2013; Lv et al., 2014). [score:6]
MiR-181b targets Six2 and inhibits the proliferation of metanephric mesenchymal cells in vitro. [score:4]
[1 to 20 of 2 sentences]
50
[+] score: 9
To further explore how miR-181/Ago2 downregulates Malat1 transcripts, we first tested whether they could suppress Malat1 transcription as increasing lines of evidence showed the non-canonical functions of nuclear miRNA/Ago in recruiting epigenetic silencing complex, which triggered transcriptional silencing [48]. [score:6]
However, by nuclear run-on assay, we did not detect a decrease in nascent Malat1 transcription by miR-181a overexpression, suggesting that the regulation may not be at the transcriptional level; instead, miR-181/Ago2 may cause Malat1 degradation through an nRISC machinery (Figure 6k). [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 9
We found a significant up-regulation of oncogenic miRNAs and a significant down-regulation of tumor-suppressing miRNAs, which included let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181. [score:9]
[1 to 20 of 1 sentences]
52
[+] score: 9
Activated B cells and CLL cells exhibit similar miR expression profiles that include the upregulation of miR-34a, miR-155, and miR-342-3p and the downregulation of miR-103, miR-181a, and miR-181b [10]. [score:9]
[1 to 20 of 1 sentences]
53
[+] score: 9
Consistently, we previously demonstrated that CBX7 negatively regulates the expression of miR-181 that has among its targets CBX7, creating a synergistic loop that contributes to breast cancer progression [11]. [score:6]
The results presented in Fig.   1 confirm a drastic overexpression of miR-181, miR-137, miR-199, miR-706 and miR-719 and repression of miR-155 in Cbx7 KO MEFs in comparison with the WT ones. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 9
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
To validate the expression of some of the miRs obtained from high-throughput miR array data, we selected 2 upregulated miRs (miR-122 and miR-181b) and 3 downregulated miRs (miR-23a, miR-98, and miR-31). [score:9]
[1 to 20 of 1 sentences]
55
[+] score: 9
The upregulation of miR142-5p, miR181b, miR219-3p and miR219-5p became significant at 1 m (Fig.   3A). [score:4]
Thus, we prioritized miR142-3p, miR142-5p, miR181a, miR181b, miR219-3p and miR219-5p to examine their temporal expression profiles in control and Tau hippocampi. [score:3]
miR181a and miR181b are involved in alteration of synaptic plasticity associated with neuropathology in a murine mo del of AD [30]. [score:1]
For 2 m, miR142-3p, miR181b, miR181a (also known as miR213) and miR219-5p were validated; and for 6 m, validation was performed for miR142-3p, miR142-5p, miR339 and miR1249 (Fig.   1C). [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 8
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 8
Among the p53-miRs that target the components of the miRNA processing complexes, miR-15/16/195, miR-103, miR-107, let-7, miR-124, miR-181, miR-148a/b, miR-30a/c, miR-27, miR-17, and miR-20 appear to target more than five components of the miRNA-processing pathway [Table 4, Table S3], suggesting the conserved nature of p53-miRs. [score:5]
Further, ILF-3 and ILF-2 are targeted by miR-181b/c and miR-25, respectively [Table S2]. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 8
Although miRNA-205 has been shown to inhibit mRNA and protein expression of Lyn, c-Src, and c-Yes in A498 cells resulting in G0/G1 cell cycle arrest and apoptosis [41], and Lyn specifically reduced expression of miRNA-181b that represses the anti-apoptotic protein Mcl1 [42], we did not detect a change in miRNA expression (≥ or ≤1.5-fold) in the U87-CA-Lyn or U87-DN-Lyn cells as compared to U87-LV cells using the Human Cancer miRNA PCR Array (MAH-102A, Qiagen) (WM Liu and CL Gladson, unpublished data). [score:8]
[1 to 20 of 1 sentences]
59
[+] score: 8
miR-181 is upregulated during myocyte differentiation and represses homeobox protein Hox-A11, a repressor of muscle-cell differentiation, thereby allowing new muscle growth [81]. [score:4]
The expression of miR-133 (miR-133a, miR-133b), miR-1, and miR-181 (miR-181a, miR-181b, and miR-181c) was profiled in muscle from patients affected by myotonic dystrophy type1 and it was observed that they were specifically induced during myogenesis [82]. [score:3]
In some other cases, such as mmu-miR-181b-2, mmu-miR-199a-2, and mmu-miR-16a-2, more than one highly abundant isoform was present (Figure 3), indicating that some miRNAs have more than one isoformin specific tissues. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 8
Indeed, miR-181 is highly expressed in the blood vasculature, but significantly reduced in lymphatic endothelial cells, reciprocally to Prox1 expression [32]. [score:5]
The regulation of Prox1 by miR-181 further highlighted the contribution of RNA interference in the induction of lymphatic endothelium. [score:2]
In addition, recent studies reported the role of miR-99b, miR-181a, and miR-181b in the differentiation of human embryonic stem cells to vascular endothelial cells [29]. [score:1]
[1 to 20 of 3 sentences]
61
[+] score: 7
The expression of miR-1A and miR-181 was detected at baseline and was increased at six and 24 hours after hepatectomy (Fig 3C). [score:3]
For validation, the expression of miR-1A and miR-181 was examined in exRNA obtained from serum samples obtained from an independent group of mice undergoing partial hepatectomy. [score:3]
miR-1A and miR-181 were most significantly altered microRNA in both serum and in hepatic tissues, and their presence in serum was quantitated using digital PCR. [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 7
Conti A. Aguennouz M. La Torre D. Tomasello C. Cardali S. Angileri F. F. Maio F. Cama A. Germano A. Vita G. miR-21 and 221 upregulation and miR-181b downregulation in human grade II-IV astrocytic tumors J. Neurooncol. [score:7]
[1 to 20 of 1 sentences]
63
[+] score: 7
HMGA1 enhances the expression of miR-181b, which in turn, represses the translation of CBX7 mRNA. [score:5]
Interestingly, in breast carcinoma, HMGA1 takes part in an important regulatory circuitry involving CBX7 and miR-181b microRNA (miRNA) (34) (Figure 1A). [score:2]
[1 to 20 of 2 sentences]
64
[+] score: 7
For example, miR-29, miR-181 and miR-148a can promote myoblast differentiation by inhibiting the expression of downstream target genes Akt3, Hox-A1 and ROCK1 at protein levels [10– 12]. [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 7
71Oncogene ERBB regulation; Vitamin D receptor; Inflammation miR-181b-5p 2.08/2.68 1.59/13.69 1.84/2.24 1.36/5.47 1.57/5.39 5.44/1.53NFkB stress response; Cell proliferation, k-R as suppression miR-200c 4.65/3.95 0.38/1.85 2.22/3.34 4.22/0.69 3.07/5.86 3.25/2.64 Apoptosis; Intracellular trafficking; Protein repair miR-204-3p 11.06/3.58 8.19/1.38 5.23/7.74 11.13/13. [score:4]
Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas. [score:1]
Likewise, in naproxen -treated mice exposed to MCS modulation of 3 miRNAs in both lung and blood serum (miR-181b, miR-344d, and miR-708) correlated with protection against pulmonary microadenomas, while one miRNA only (miR-711), correlated with protection against pulmonary adenomas, was modulated in both body compartments. [score:1]
In aspirin -treated mice exposed to MCS, modulation of 9 miRNAs in both lung and blood serum (miR-30c, miR-181b, miR-183, miR-301a, miR-350, miR-466a/i, miR-500, and miR-709) correlated with protection against pulmonary microadenomas, while no miRNA related to protection against pulmonary adenomas was modulated at the same time in both body compartments. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
The data verified that two miRNAs, miR-29a and -34a, which have been implicated in apoptotic pathways, are up-regulated and the two miRNAs, miR-181 and -183, which have been shown to have roles in proliferation and differentiation, are down-regulated While it is believed that a major cause of ARHL is the death of hair cells, other age-related changes in the central auditory pathways cannot be ruled out. [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 7
After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars). [score:7]
[1 to 20 of 1 sentences]
68
[+] score: 7
For example, miR-2137, miR-5130 and miR-5112 were highly expressed in heart tissues; miR-490, miR-491, miR-181, miR-362, miR-425, and miR-3104 were expressed at quite a low level (Ct value ∼ over 30), whereas 32 out of those 58 altered miRNA were expressed at an extremely low level in hearts and there were almost no Ct value detected by qPCR. [score:7]
[1 to 20 of 1 sentences]
69
[+] score: 6
Peng Z. Li J. Li Y. Yang X. Feng S. Han S. Li J. Downregulation of mir-181b in mouse brain following ischemic stroke induces neuroprotection against ischemic injury through targeting heat shock protein A5 and ubiquitin carboxyl-terminal hydrolase isozyme L1 J. Neurosci. [score:6]
[1 to 20 of 1 sentences]
70
[+] score: 6
hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. [score:3]
miR-181a belongs to the miR-181 family, and its nucleic acid sequence is highly conserved in mammals (Ji et al., 2009). [score:1]
Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM -positive hepatic cancer stem cells. [score:1]
MicroRNA-181 variants regulate T cell phenotype in the context of autoimmune neuroinflammation. [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 6
MiR-181c-5p is a known tumor suppressor in neuroblastoma: it belongs to the miR-181 family, whose members are known to be upregulated after MYCN silencing [26, 27]. [score:6]
[1 to 20 of 1 sentences]
72
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
TGFbeta -mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. [score:6]
[1 to 20 of 1 sentences]
73
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
74
[+] score: 6
In addition, it has been reported that miR-181 promotes the development of NK cells from CD34 [+] hematopoietic progenitor cells and IFN-γ production in primary human CD56 [+]CD3 [−] NK cell, at least in part through the suppression of nemo-like kinase (NLK), an inhibitor of Notch signaling [48]. [score:6]
[1 to 20 of 1 sentences]
75
[+] score: 6
Recently, Luo et al. (29) have identified that B. suis upregulates miR-146a, miR-181a, miR-181b, and miR-301a-3p leading to reduced TNF-α expression in Raw264.7 cells. [score:6]
[1 to 20 of 1 sentences]
76
[+] score: 6
For example, microRNA-1, -16 and microRNA-181b were down-regulated in cardiac hypertrophy, and in vitro over -expression of them resulted in the reduced size of cardiomyocytes [7– 9]. [score:6]
[1 to 20 of 1 sentences]
77
[+] score: 6
Interestingly, the miR-103-2 (16,537 CPM), miR-107 (2,068 CPM), miR-181 (6,627 CPM) and miR-30 (5,740 CPM) families have not previously been associated with the development of the brain, but were found to be highly expressed in our dataset. [score:4]
MiR-181 plays a crucial role in modulating haematopoietic lineage differentiation [53] whereas miR-30 has been strongly implicated with kidney development and nephropathies [54]. [score:2]
[1 to 20 of 2 sentences]
78
[+] score: 6
Previous studies have shown that miR-181b expression could be increased in HSC-T6 cells treated with TGF-β1 and miR-181b mimics could significantly promote the proliferation of HSC-T6 cells by directly targeting p27 [8]. [score:6]
[1 to 20 of 1 sentences]
79
[+] score: 6
Together with the Yamanaka factors (OCT4, SOX2, KLF4, and c-MYC) (Takahashi and Yamanaka, 2006), co -expression of the miRNA cluster 302/367 or 106a/363; members of the miR-302, miR-294, or miR-181 family; or miR-93 and miR-106b greatly enhance iPSC derivation efficiency (Judson et al., 2013, Li et al., 2011, Liao et al., 2011, Lin et al., 2011, Subramanyam et al., 2011). [score:3]
Recent work has demonstrated that miRNAs such as miR-294, miR-302, and miR-181 family members facilitate (Judson et al., 2013, Li et al., 2011, Liao et al., 2011, Lin et al., 2011, Melton et al., 2010, Subramanyam et al., 2011), but let-7 family members inhibit, reprogramming (Melton et al., 2010, Unternaehrer et al., 2014). [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 6
Despite conclusive evidence of the high expression of miRNAs such as miR-181, -182 and -183 in the retina [8, 9] the genes targeted by these miRNAs did not show significant down regulation at the mRNA level in our analysis. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
Other miRNAs from this paper: mmu-mir-221, mmu-mir-181b-1
Wang B TGFbeta -mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3Oncogene. [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 5
Other MET genes have had characterized miRNA regulation in other tissue types, including regulation of Hoxa11 by miR-181 during muscle differentiation [69], and hypoxia -induced targeting of Fgfrl1 by miR-210 [70]. [score:3]
Literature evidence of microRNA association is represented for Lhx1 (miR-30) and Hoxa11 (miR-181) along with other known transcriptional regulatory relationship (dotted arrows). [score:2]
[1 to 20 of 2 sentences]
83
[+] score: 5
Recent studies have suggested important regulatory roles for miRNAs such as miR-21, miR-216, miR-217, miR-181b, miR-31b and miR-34a, which were confirmed to be upregulated in senescing HUVECs (Menghini et al., 2009), and miR-146, miR-142-3p, miR-223 and miR-29 family members, which were significantly increased in whole aortas of aged mice (Zhao et al., 2010). [score:5]
[1 to 20 of 1 sentences]
84
[+] score: 5
Other miRNAs from this paper: mmu-mir-31, mmu-mir-93, mmu-mir-25, mmu-mir-181b-1
To date, numerous miRNAs have been verified to target LATS2 and involved in Hippo pathway in diverse types of cancer, like miR-181b, miR-93, and miR-372 [40– 42]. [score:3]
MiR-181b was also reported to promote ovarian cancer cell growth and invasion by targeting LATS2 [40]. [score:2]
[1 to 20 of 2 sentences]
85
[+] score: 5
6 miRNAs (miR-221-3p, miR-181-5p, miR-181b-5p, miR-712-5p, miR-345-5p, miR-100-5p; Fig. 4a2,b2) showed a lower expression level in KO crypts than KO villi, but showed higher expression level in WT crypts than WT villi (Fig. 4b2: Red spots vs Fig. 4a2: Blue spots). [score:5]
[1 to 20 of 1 sentences]
86
[+] score: 5
Three of the down-regulated miRNAs (miR-181, miR-21 and Let-7) have this pathway as their top candidate with p-values of less than 0.001. [score:4]
In comparison, miR-21, miR-181 and Let-7 have well characterized roles in cancer and it is not surprising therefore that their target genes result in enrichment for cancer-related pathways as well. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 5
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-181b-1, mmu-mir-21b, mmu-mir-21c
McClure C MicroRNA 21 (miR-21) and miR-181b couple with NFI-A to generate myeloid-derived suppressor cells and promote immunosuppression in late sepsisInfect Immun. [score:5]
[1 to 20 of 1 sentences]
88
[+] score: 5
For example, miR-196 expression affected limb development [8], miR-1 and miR-133 cardiogenesis [9, 10] and skeletal muscle development [11], and miR-181 enhanced myoblast differentiation [12]. [score:5]
[1 to 20 of 1 sentences]
89
[+] score: 5
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
Inhibition of GSK3β activates miR-181 expression through Wnt/beta-catenin signaling in HCC (34). [score:5]
[1 to 20 of 1 sentences]
91
[+] score: 5
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
Several of the miRNAs on the list from P7 wildtype forebrain astrocytes such as miR-21, miR-223, miR-146a and miR-181 (S2 Table) have been previously shown to regulate astrocyte functions [26– 30]. [score:2]
[1 to 20 of 2 sentences]
92
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Other microRNAs, such as MiR-146a and miR-181b, have anti-inflammatory properties by inhibiting the translation of tumor necrosis factor (TNF) receptor -associated factor 6 (TRAF6) and importin α3. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
These data are consistent with previous studies showing that miR-181a and miR-181b are predominantly expressed from mir-181ab1 in thymocytes [38]. [score:3]
Although mice with a complete knock-out of all three miR-181 clusters are presumably lethal [38, 39]future work might rely on the combined T cell progenitor specific conditional deletion of all threemiR-181 clusters. [score:2]
[1 to 20 of 2 sentences]
95
[+] score: 4
To date, in HCC, miR-130b has been shown to promote CD133 [+] CSC tumorigenicity and self-renewal [18], whereas miR-181 inhibition reduces the number of EpCAM [+] CSCs and tumor-initiating ability [19]. [score:3]
It has been reported that exogenous miR-181 increased EpCAM [+] HCC cell quantity and tumor-initiating ability [19]. [score:1]
[1 to 20 of 2 sentences]
96
[+] score: 4
It has also been reported that miR-181b-5p regulates the expression of cell migration associated proteins during decidualization [95]. [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
miR-181, miR-30b* and miR-874 are additional suggestive eQTL with significant genome-wide (α < 0.1) threshold after permutation Similarly, on chromosome 8 we identified eQTL for three miRNAs (miR-486, miR487b and miR-501) in confidence interval 72–95 Mb. [score:2]
miR-181, miR-30b* and miR-874 are additional suggestive eQTL with significant genome-wide (α < 0.1) threshold after permutationSimilarly, on chromosome 8 we identified eQTL for three miRNAs (miR-486, miR487b and miR-501) in confidence interval 72–95 Mb. [score:2]
[1 to 20 of 2 sentences]
98
[+] score: 4
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
On the other hand, the top upregulated miRNAs at the OP3-OL transition included miRNAs (miR-181a, miR-181b, miR-125b, and miR-184) that are associated with decreased proliferation in maturing CNS cells and decreased malignancy in glioma stem cells [49], [50], [51], [52], [53], [54], [55]. [score:4]
[1 to 20 of 1 sentences]
99
[+] score: 4
The expression of miR-17, miR-18a, miR-20a, miR-93, and miR-181 in was evaluated from published gene expression datasets [24, 25]. [score:3]
Specifically, 52 non-CBF-AML and 31 CBF-AML were analyzed for miR-17, 31 non-CBF-AML and 18 CBF-AML were analyzed for miR-18a, 53 non-CBF-AML and 34 CBF-AML were analyzed for miR-20a, 34 non-CBF-AML and 18 CBF-AML were analyzed for miR-93 and miR-181. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 4
hsa-miR-30 and hsa-miR-181 are downregulated [58], and apoptosis is a key mechanism in AD [59]. [score:4]
[1 to 20 of 1 sentences]