sort by

58 publications mentioning rno-mir-34c

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-34c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 108
Notably miR-34c over -expression exacerbated Sipa1 down-regulation induced by DOX, while the transfection with mir-34c hairpin inhibitor significantly rescued the expression (Figure 5C), suggesting that miR-34c is mediating the DOX -induced regulation of Sipa1. [score:11]
The screening for putative targets of microRNAs in DOX treated animals, revealed that a number of DOX-responsive microRNAs may regulate mRNAs involved in cardiac tissue remo deling (data not shown), but we also speculated that the Sipa1 mRNA transcripts could be targeted by miR-34c directly. [score:7]
Ambra1 expression was induced by DOX treatment in vivo and miR-34c could control its endogenous expression levels in H9c2 cardiac myoblasts. [score:5]
Finally, to confirm whether the regulatory effect of miR-34c on the levels of Sipa1 mRNA was direct, 2 luciferase -based reporter expression vectors (pmiR-GLO-Sipa1 WT and mutated) were generated by cloning a 200 nucleotide region surrounding the predicted microRNA seed from each of their 3′-UTR regions downstream of a firefly luciferase reporter gene. [score:5]
0040395.g006 Figure 6Ambra1 expression was induced by DOX treatment in vivo and miR-34c could control its endogenous expression levels in H9c2 cardiac myoblasts. [score:5]
Vice versa transfection of a miR-34c-directed hairpin inhibitor showed a statistically significant decrease of Ambra1 mRNA level. [score:4]
In our study miR-215, part of the miR-192/miR-215 cluster, and miR-34c, involved in DNA damage mediated proliferation arrest [36], [37], [38], [39], were up-regulated, consistent with the pharmacological effect of DOX. [score:4]
Comparable changes for many of these microRNAs were confirmed in additional animals, and a subset of five microRNAs (miR-208b, miR-215, miR-216b, miR-367 and miR-34c) and were largely unaffected by the direct Top2 inhibitor etoposide (EPS) (Figure 3). [score:4]
Finally, evidence for the direct targeting of Sipa1 mRNAs by miR-34c was provided for the first time, and this microRNA-mRNA interaction could potentially play a role in the molecular response to DOX in the rodent heart. [score:4]
However miR-215 and miR-34c were not significantly up-regulated by EPS administration, suggesting that this compound may not trigger a p53 response under these experimental conditions. [score:4]
Interestingly miR-215, up regulated by DOX in this study, was also linked to p53 mediated cell cycle arrest [37], [38], consistent with the pharmacology of DOX and partially replicating expression changes of miR-34c upon treatment, thus strengthening the biological relevance of our findings and consistency with previously published mechanisms [36]. [score:4]
Stratagene “Quick change” kit was used to introduce a 6 nt mutation in the miR-34c predicted seed site to generate the pmiR-GLO-Sipa1 mutant and the pmiR-GLO-Tnni3k mutant expression vectors. [score:4]
The transfection of miR-34c mimics in H9c2 showed a statistically significant decrease of Sipa1 mRNA, as the transfection of miR-34c hairpin inhibitor (HI) showed a statistically significant increase of Sipa1 mRNA (Figure 5C). [score:3]
Five of these microRNAs (miR-208b, miR-215, miR-216b, miR-34c and miR-367) displayed a consistent dose -dependent response to DOX at 2 and 4 weeks and were thus chosen as candidates for further expression profiling across the larger in vivo study treatment groups including co-treatment of DOX with DZR and treatment with EPS only (Figure 3). [score:3]
Therefore miR-34c is directly implicated in the DOX -induced modulation of Sipa1 mRNA regulation. [score:3]
Transfection with miR-34c mimic and inhibitor respectively exacerbated and rescued Sipa1 mRNA levels in H9c2 treated with DOX 0.1 and 1 µM overnight in comparison to negative controls. [score:3]
n = 4 to 6 (except #, n = 2) (B) Endogenous levels of Ambra1 were measured after miR-34c over -expression (miR-34c mimic) or inhibition (miR-34c HI) in absence of presence of DOX 0.1. [score:3]
In fact, miR-34c over expression showed a statistically significant increase of the endogenous levels of Ambra1 mRNA (both with and without DOX). [score:3]
Transfection of miR-34c hairpin inhibitor showed a statistically significant decrease of Ambra1 mRNA. [score:3]
Our study also provides the basis for understanding the global role of microRNAs in DOX -induced cardiac remo deling and toxicity, and provides evidence the direct miR-34c/Sipa1 functional interaction for the first time. [score:2]
MiR-367, miR-215, miR-216b, miR-208b and miR-34c are Specifically Dysregulated by Chronic DOX Treatment. [score:2]
Treatment with DOX at 0.1 µM for 16 h in presence of miR-34c hairpin inhibitor showed a statistically significant decrease of Ambra1 mRNA when compared to the presence of miR-34c mimics. [score:2]
miR-34c directly controls DOX -induced Sipa1 mRNA decrease. [score:2]
This decrease was observed to a lower extent with other members of the miR-34 family (Figure 5C) suggesting that miR-34c interacted directly and specifically with the 3′-UTR of Sipa1. [score:2]
Reporter assay experiments further support that Sipa1 mRNA is a target of the miR-34 family, in particular miR-34c (Figure 5). [score:2]
In addition, our observations in H9c2 myoblast cell line suggest that miR-34c could be involved in the stimulation of the positive autophagy regulator Ambra1, also in presence of DOX. [score:2]
0040395.g003 Figure 3Relative quantification of (A) miR-208b, (B) miR-215, (C) miR-216b, (D) miR-367 and (E) miR-34c in DOX, DOX + DZR, EPS groups, normalized versus vehicle treated animals. [score:1]
MiR-34c Regulates Sipa1 mRNA at the Post-transcriptional Level and is Involved in Autophagy Process. [score:1]
Treatment with DOX at 1, 2 and 3 mg/kg/week showed a dose -dependent decrease of signal -induced proliferation -associated 1 (Sipa1) and a dose -dependent increase of miR-34c (Figure 5A). [score:1]
Mutant 3′ UTR restores luciferase activity in Sipa1/miR-34c. [score:1]
#, n = 2. (B) DOX treatment for 24 h caused a decrease of Spa1 mRNA and an increase of miR-34c in cardiac myoblast cells (H9c2). [score:1]
Similarly, the treatment of H9C2 rat myoblasts with DOX at 0.1 and 1 µM for 24 h showed a decrease of Sipa1 mRNA and an increase of endogenous miR-34c (Figure 5B). [score:1]
Relative quantification of (A) miR-208b, (B) miR-215, (C) miR-216b, (D) miR-367 and (E) miR-34c in DOX, DOX + DZR, EPS groups, normalized versus vehicle treated animals. [score:1]
Transfection of miR-34c mimics showed a statistically significant increase of Ambra1 mRNA. [score:1]
Treatment with DOX at 0.1 µM for 16 h in the presence of miR-34c mimics showed a statistically significant increase of Ambra1 mRNA. [score:1]
Importantly, Sipa1 mRNA showed an anti-correlated pattern with miR-34c in H9c2 cells treated with DOX 1 µM during 24 h (Figure 5B). [score:1]
The co-transfection of the Sipa1 reporter with miR-34c in HEK 293 cells showed a significant decrease in the luciferase signal. [score:1]
Immunochemistry staining of autophagy markers like Ambra1 in heart tissues will also be required to elucidate the functional involvement of miR-215, miR-216b, miR-367, miR-208b and miR-34c in the DOX -induced autophagy process since they seem to be specifically associated to vacuoles appearance. [score:1]
[1 to 20 of 38 sentences]
2
[+] score: 104
Other miRNAs from this paper: rno-mir-17-1, rno-mir-17-2
Therefore, we want to reveal whether the changes of CRFR1 expression occur with the accompanying changes in CRFR1 mRNA expression and miR-34c expression in the hypothalamus, as one of the miR-34c targets is the CRFR1 mRNA, which was regulated via the complementary site on its 3′UTR [15]. [score:10]
Our results demonstrated that severe traumatic stress in early adolescent induced lasting effects on anxiety-like behavior and spatial memory damage, different alterations of CRFR1 expression, and CRFR1 mRNA and miR-34c expression in hypothalamus between adolescent and adult period, which suggested that the miR-34c expression in hypothalamus may be unique regulator of stress reaction and may play a role in vulnerability to PTSD following exposure to traumatic experience. [score:8]
After a protracted struggle which did not work, the level of miR-34c expression returned to normal gradually, while the level of CRFR1 expression was upregulated, as we observed in the hypothalamus six weeks after foot shock. [score:8]
Second, we probe into the question whether miR-34c expression could timely regulate CRFR1 expression by using CRFR1 antagonist to block the CRFR1 activity. [score:6]
These results supported the idea that traumatic stress could induce increased miR-34c and decreased CRFR1 expression, which is consistent with the mechanism about miRNA influencing the protein translation [8]. [score:5]
miR-34c reduces the expression of stress-related proteins (such as CRFR1) and plays a role in the recovery process of stress reaction, suggesting that it might have vital implication in vulnerability to PTSD and might become a new target for the prevention and treatment of stress-related disorders [15]. [score:5]
However, miR-34c expression and the association between miR-34c and CRF1 expression in hypothalamus in adult rats after adolescent stress had not clarified. [score:5]
CRFR1 mRNA Expression and miR-34c Expression in Hypothalamus. [score:5]
For instance, miR-34c was upregulated after exposure to acute stress, performing anxiolytic properties [15]. [score:4]
In adolescent study, stressed rats showed similar level of CRFR1 mRNA, increased miR-34c expression, and decreased CRFR1 expression compared with the controls in hypothalamus. [score:4]
In our study, after adolescent foot shock, stressed rats showed increased level of miR-34c in the short term which trigged lower expression of CRFR1 in the hypothalamus to fight against the anxiety. [score:3]
The study focused on the relationship among levels of CRFR1, CRFR1 mRNA, and miR-34c expression in adult stressed rats. [score:3]
The expression of CRFR1 mRNA or miR-34c was calculated according to the threshold cycle (Ct); the CT of the target gene for each sample was corrected by subtracting the CT of the internal control (ΔCT). [score:3]
Six rats in each group were used to detected CRFR1 mRNA and miR-34c expression. [score:3]
In the adolescent hypothalamus [F(2, 16) = 9.272, p = 0.002; see Figure 6], the S group (p = 0.011) and the S + A group (p = 0.003) had higher miR-34c expression than the CON group. [score:3]
In this study, we focused on the short-term and long-term effects of adolescent foot shock on anxiety-like behavior, memory damage, protein CRFR1 expression, CRFR1 mRNA, and miR-34c levels in the hypothalamus of male Wistar rats. [score:3]
Combined with the result of improved behaviors in CRFR1 antagonist group, our study suggested that CRFR1 antagonist could target a positive process including increased level of miR-34c during acute stress reaction and give a new certification that miR-34c might be closely related with vulnerability to PTSD. [score:3]
The purpose of the study was first to detect dynamic changes, including short-term state and long-term state of miR-34c expression after early adolescent exposure to the stress. [score:3]
However, in the adult hypothalamus [F(2, 16) = 8.547, p = 0.003; see Figure 6], the S + A group exhibited higher miR-34c expressions than the CON group (p = 0.005) and S group (p = 0.012). [score:3]
The results indicated CRF1 antagonist might improve anxiety-like behavior and memory by alteration of miR-34c expression in hypothalamus. [score:3]
What caught our attention was that CRFR1 mRNA is the target of miR-34c. [score:3]
We would observe miR-34c expression in the hypothalamus after adolescent stress because this brain region is a complex region considered to be part of the limbic system and integrate the nervous system and the endocrine system and act as a “switching station” in the brain [19]. [score:2]
In consistent with our hypothesis, stressed rats showed lower level of CRFR1 mRNA, similar level of miR-34c, and increased CRFR1 expression compared with the unstressed rats. [score:2]
As a marker in stress recovery process, higher level of miR-34c was observed in S + A group. [score:1]
It is noticed that there were prominent higher levels of miR-34c in both adolescent and adult CRFR1 antagonist group in the study. [score:1]
Previous work has confirmed that miR-34c combined with an evolutionarily conserved region in the 3′UTR of CRFR1 mRNA perform its effect. [score:1]
This means although the behavioral performance is the same between adolescence and adulthood of rats after adolescent stress, the CRFR1 mRNA, miR-34c, and protein CRFR1 displayed different dynamic changes after certain period of passing time. [score:1]
miR-34c is a stress-related miRNA which was prominently increased after traumatic stress and associated with decreased anxiety-like behaviors. [score:1]
Finally, relative expression levels were calculated as 2 [−[(Ct  of  CRFR1  mRNA)−(Ct  of  GAPDH)]] or 2 [−[(Ct  of  miR-34c)−(Ct  of  U6)]]. [score:1]
1 mL of RNA was used to measure the expression of CRFR1 mRNA or miR-34c by RT-PCR. [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 51
b Expression levels of Notch signaling proteins and effects of miR-34 siRNA in control (C) and folate -deficient (MDD) H19-7 cells at 13 h after induction of differentiation (Si− = non -targeting siRNA, Si+ = miR-34 -targeted siRNA). [score:7]
Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) The Notch receptor ligand delta-like 1 (dll1) is a target of miR-34, and during morphogenesis of the central nervous system, differentiation of neural progenitors is known to be inhibited by hairy and enhancer of split homolog 1 (Hes1), whereas it is stimulated by mammalian achaete-scute complex homolog 1 (Mash1) [46]. [score:5]
Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) The Notch receptor ligand delta-like 1 (dll1) is a target of miR-34, and during morphogenesis of the central nervous system, differentiation of neural progenitors is known to be inhibited by hairy and enhancer of split homolog 1 (Hes1), whereas it is stimulated by mammalian achaete-scute complex homolog 1 (Mash1) [46]. [score:5]
While it cannot fully prevent early-occurring NTDs such as spina bifida, maternal supplementation with folic acid during the period corresponding to the last trimester of pregnancy in women appeared to help preserve a normal development, at least partly through restoring let-7 and miR-34 normal expression. [score:4]
Early Methyl Donor Deficiency Alters the Expression Pattern of a Wide Range of Genes Influenced by Let-7 and miR-34 and Involved in Various Aspects of Development. [score:4]
Methyl Donor Deficiency Increases Expression Levels of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Fig. 7Effects of methyl donor deficiency and folic acid supplementation on Notch signaling proteins, targets of miR-34. [score:3]
c Expression levels of miR-34 in the midbrains of control and deficient rat embryos, and effects of folic acid supplementation. [score:3]
Methyl Donor Deficiency Affects Protein Expression Levels of Known Downstream Pathways of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Among the subset of miRNAs known to be regulated by methylation [28], let-7 (lethal 7) and miR-34 are believed to exert a requisite role at various steps of cerebral development, while they would influence the occurrence of NTDs [27, 29]. [score:3]
Most importantly, folic acid supplementation helped restoring the levels of let-7 and miR-34 and their respective targets. [score:3]
Fig. 3Effects of methyl donor deficiency on the expression of let-7 and miR-34: influence of folic acid supplementation. [score:3]
Taken together, our data therefore suggest that the alterations observed in let-7 and miR-34 pathways in response to methyl donor deficiency may participate to a disruption of the proliferation/differentiation balance, resulting in improper development of the central nervous system, and influencing the occurrence of NTDs. [score:2]
Products of RT reaction (1.33 μL) were used in a real-time PCR reaction, which also included 10 μL of the TaqMan Universal Master Mix II, and 1 μL TaqMan miRNA assay containing the sequence-specific primers of either the target miRNA (let-7: UGAGGUAGUAGGUUGUAUAGUU, miR-34: UGGCAGUGUCUUAGCUGGUUGU) or the U6SnoRNA (CACGAATTTGCGTGTCATCCTT) used as an endogenous control for normalization. [score:1]
By using the microarray approach, the identification of new putative target genes affected in response to methyl donor deficiency via let-7 and miR-34 warrants further investigations. [score:1]
In order to identify further mechanisms underlying the effect of maternal B-vitamin status on neural tube and brain development, in line with potential epigenetic dysregulations, we investigated the participation of let-7 and miR-34 as well as their related pathways in the consequences of methyl donor deficiency both in vivo on a validated rat mo del of maternal deficiency [30, 31] and in vitro in hippocampal progenitors [32]. [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 49
According to the PCR results, the miR-34c expression levels were up-regulated, whereas the miR-1188a, miR-328a and miR-331 expression levels were down-regulated (*p<0.05) (Fig 4 A–4 C, left), and miR-1188a presented the most pronounced changes in expression in the hippocampus, which is consistent with the microarray findings. [score:13]
Among the 11 significantly dysregulated miRNAs, 4 miRNAs were up-regulated (miR-34c, miR-374, miR-181a, and miR-let-7c-1), and 7 miRNAs were down-regulated (miR-1188, miR-770-5p, miR-127-5p, miR-375, miR-331, miR-873-5p, and miR-328a) (differentially expressed miRNAs were defined by a fold-change >1.5, up or down-regulated; p <0.05). [score:13]
Some of the up-regulated (miR-34c, miR-374, miR-181a, and miR-let-7c-1) and down-regulated (miR-1188, miR-770-5p, miR-127-5p, miR-375, miR-331, miR-873-5p, and miR-328a) miRNAs we detected using miRNA microarray were suggested to be closely connected with memory function. [score:7]
As observed in our data, the peripheral blood expression levels of miR-1188a, miR-328, and miR-331 decreased in TLE-MI rats (Fig 4 A–4 C, right), whereas the expression level of miR-34c increased (Fig 4 D, right) in TLE-MI rats, suggesting that the expression pattern trends were identical to those of their counterparts in the hippocampus. [score:7]
For example, miR-34c has been proven to play an important role in cellular proliferation and apoptosis by regulating the expression of several genes; this transcript also shows increased expression levels in both PBMC and plasma in AD patients compared with those of age-matched normal controls[44]. [score:5]
Hippocampus and blood expression levels of miR-34c increased in TLE-MI rats compared with those in TEL-C rats (the values are presented as the mean±SEM, *p<0.05; n = 6 per group). [score:2]
The dysregulated miRNAs (miR-34c, miR-1188a, miR-328a, and miR-331) were confirmed using qRT-PCR and the results were consistent with the microarray analysis. [score:2]
[1 to 20 of 7 sentences]
5
[+] score: 44
miR-34c reduced wildtype Arc expression to 62% of control levels, whereas miR-34a expression had a much stronger effect, reducing expression to 18% of control. [score:7]
Furthermore, point mutation of the miR-34 binding site rescued inhibition induced by miR-34a, but not miR-34c. [score:4]
Virally -mediated expression of miR-34c in the central nucleus of the amygdala has anxiolytic effects, possibly through regulation of corticotropin releasing factor [70]. [score:4]
Recent work elegantly revealed a role for miR-34c in contextual fear conditioning, and identified SIRT1 as a decisive target for this regulation [30]. [score:4]
However, the miR-34 family genes are differentially expressed and regulated. [score:4]
We therefore compared the effects of ectopic expression of miR-34a and miR-34c on Arc expression. [score:4]
miR-34a and miR-34c are also coexpressed following acute restraint stress and chronic social defeat stress in mice. [score:3]
Regulation of Arc by miR-34 and miR-326 is attenuated by point mutations and deletion of the microRNA seed region. [score:3]
miR-34 family microRNAs (miR-34a, -34b, -34c) share a common seed sequence and therefore share many of the same targets in many cell types. [score:3]
The authors point out that miR-34c may have other targets, referring specifically to c-MYC [30], [72]. [score:3]
Interestingly miR-19, miR-34 and miR-326 are all dysregulated in multiple sclerosis patients [62]. [score:2]
The miR-34 family has three members, miR-34a, -34b and -34c, that are predicted to bind the same sites. [score:1]
Three nucleotides in the seed -binding region of miR-34, -193, -326, -378 and -512_5p were mutated in the Arc 3′UTR and the whole seed binding region was removed for miR-19. [score:1]
While little is currently known about mir-193a and miR-19a, new studies have shed light on miR-34 and miR-326 function in the nervous system. [score:1]
[1 to 20 of 14 sentences]
6
[+] score: 32
Furthermore, five deregulated miRNAs (miR-128-3p and miR-34c-5p, both downregulated at P10; miR-19b-3p, miR-449a-5p and miR-30e-5p, these three being upregulated at P21) have E2F3 in common as a target gene. [score:10]
At P10, the differential expression of the three miRNAs was statistically confirmed, with miR128-3p and miR34c-5p downregulated and miR434-3p upregulated. [score:9]
Among these miRNAs, three showed more than twofold differential expression (Fig 1): miR-128-3p and miR-34c-5p were significantly downregulated, and miR-434-3p was significantly upregulated. [score:9]
Among the other miRNAs found deregulated in our study, miR-34c-5p, miR-128-3p miR-184, miR127-3p, miR-30e-5p, and miR-23b-5p were also previously described as “tumour suppressors”[22– 26], although many miRNA studies previously dealt with cancer or oncogenic proliferation states and the current analysis depended on previous reports. [score:4]
[1 to 20 of 4 sentences]
7
[+] score: 19
For example, the expression of tumor suppressor genes, like PTEN [26] and P53 [27], which are the targets of miR-21 and miR-34c, were significantly reduced in the premalignant foci and HCC nodules [28]. [score:7]
Similarly, the expression of oncogenic miRNAs like miR-21, miR-10b, let-7i, miR-34c, were increased more than 2 fold in EpCAM [+] liver cancer cells; whereas miR-125b, miR-200a, miR-148b were most down-regulated. [score:6]
miR-21, miR-10b and miR-34c have been reported to be upregulated in various types of cancers, including HCC [25]. [score:4]
Our previous report also revealed that the relative expression levels of miR-92b, miR-21, miR-34c, miR-10b, and let-7i in EpCAM [+] liver cancer cells compared to fetal liver cells were increased (P<0.05). [score:2]
[1 to 20 of 4 sentences]
8
[+] score: 18
Other miRNAs from this paper: rno-let-7d, rno-mir-138-2, rno-mir-138-1, rno-mir-296, rno-mir-494
Compared to their expression in WKY rats, miR-138, miR-138*, miR-296, miR-34C*, and miR-494 expressions were significantly downregulated (Fig.   2e) in SHRs, results consistent with those of the miRNA microarray. [score:7]
These suggested that there was a strong reverse correlation between the expressions of Nr3c1 and the miRNA (miR-138, miR-138*, miR-296, miR-34C*, and miR-494) and that Nr3c1 might be the main molecule responsible for the regulation. [score:4]
The common potential target of miR-138*, miR-138, miR-296, miR-34C*, and miR-494 focused on the mRNA of Bhlhb2 (Fig.   2d), which encodes a basic helix-loop-helix domain-containing protein. [score:3]
Nr3c1 and transcription factors (Pou1f1, Sp1, Nf1, and CUX1) all have putative binding sites upstream of either the miR-138*, miR-138, miR-296, miR-34C*, or miR-494 genes or the Bhlhb2 gene (Supplemental Table 2, Fig.   2d). [score:1]
The precursors of miR-138, miR-138*, miR-296, miR-34c*, and miR-494 were obtained by PCR from rat genomic DNA and cloned into Hpa I and Xho I sites of lentivirus pLL3.7. [score:1]
analysis predicted that the upstream sequences of miR-138-1, miR-138-2, miR-296, miR-34c*, and miR-494 genes would have putative binding sites of Nr3c1 and transcription factors including CUX1, Pou1f1, Nf1, and Sp1 (Fig.   2b). [score:1]
Bioinformatics analysis predicted that the upstream sequences of miR-138-1, miR-138-2, miR-296, miR-34c*, and miR-494 genes would have putative binding sites of Nr3c1 and transcription factors including CUX1, Pou1f1, Nf1, and Sp1 (Fig.   2b). [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
Similarly, miR-34, an established p53 effector that is typically downregulated in malignant lung cancer [105], was upregulated in microadenomas but not in adenomas, as demonstrated in the present study. [score:7]
Thus, maintenance of miR-34 expression is a prerequisite to avoid the passage from benign to malignant cancer lesions in lung tissue. [score:3]
[1 to 20 of 3 sentences]
10
[+] score: 17
mir-200a, mir-34, mir-195, and mir-381-3p are usually downregulated in presence of SIRT1 expression, and vice versa low expression of SIRT1 relates to miRNAs upregulation [9, 11, 17, 18, 26– 28]. [score:11]
Also, upregulation of mir-34c-5p and mir-381-3p that target Nampt, an enzyme involved in the production of NAD, the cofactor for SIRT1 [29], diminishes SIRT1 actions. [score:6]
[1 to 20 of 2 sentences]
11
[+] score: 17
Previous studies showed that inhibition of miR-34 expression in vivo using LNA -based antimiRs or antagomiRs improved cardiomyocyte survival after MI and thereby preserved cardiac contractile function [35, 36]. [score:5]
Therefore, increased expression of miR-29 and miR-24 and reduced expression of miR-34, miR-130 and miR-378 may be responsible for the beneficial effects exerted by MSC-Exo. [score:5]
We found that the expression of miR-130, miR-378, and miR-34, which negatively regulate cardiac functions, was relatively low. [score:4]
Moreover, our results showed that the expression of miR-34 was decreased in both MSC-Exo and MSCs. [score:3]
[1 to 20 of 4 sentences]
12
[+] score: 17
In detail, five miRNAs were significantly up-regulated (miR-21, miR-34c-3p, miR-470*, miR-10b, let-7i*) and two miRNAs significantly down-regulated in SP of HCC cells (miR-200a*, miR-148b*). [score:7]
These target genes were PTEN (miR-21), P53 (miR-34c), Rho C (miR-10b), RAS (let-7i), and ZEB1 (miR-200a). [score:3]
As shown in Figure 4A, the results showed that the expression levels of miR-21, miR-34c-3p, miR-16, miR-10b, and let-7i* in SP of HCC cells compared to SP of fetal liver cells were increased 3.5 ± 0.84, 2.1 ± 0.52, 2.2 ± 0.46, 3.9 ± 0.61, and 2.8 ± 0.25 -fold respectively, which were consistent with miRNA microarray results (P < 0.05). [score:2]
Here we validated significant overexpression of miR-10b, miR-21, and miR-34c-3p in SP fractions of HCC compared to SP fractions of normal fetal liver cells. [score:2]
A total of 68 miRNAs, including miR-10b, miR-21, miR-470*, miR-34c-3p, and let-7i*, were identified as overexpressed in SP of HCC cells compared to fetal liver cells. [score:2]
A different situation exists with other miRNAs such as miR-34c-3p, which is a member of the miR-34 family. [score:1]
[1 to 20 of 6 sentences]
13
[+] score: 16
Eleven of the altered miRNAs were downregulated (miR-122, miR-93*, miR-872, miR-7*, miR-146a, miR-342-3p, miR-150, miR-139, miR-30a, miR-30e, miR-320), whereas three miRNAs, namely miR-463*, miR-34c* and miR-1188, were upregulated in the RYGB group. [score:7]
Downregulated plasma miR-342-3p and upregulated miR-34c* in RYGB-operated rats demonstrate a broad correlation with the liver, plasma and urinary metabolite profiles, indicating their extensive involvement in metabolic processes. [score:7]
In addition to miR-342-3p and miR-34c*, miR-872*, miR-463*, miR-30e, miR-2183, miR-1971, miR-150, miR-146a, miR-1188 and miR-93* all correlate with liver energy metabolism processes, such as glycolysis and glycogenesis involving glucose, glycogen and lactate. [score:1]
Furthermore, miR-206, miR-1188, miR-1971 and miR-34c* are inversely correlated with plasma lipid fractions, whereas miR-320 and miR-342-3p and to a lesser extent miR-7*, exhibit a positive correlation. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 15
In the present study, miR-145-5p mimic clearly decreased Nurr1 expression in HEK293T (P < 0.001), as did miR-132 and miR-34c-5p, which was consistent with the previous study that miR-34c-5p directly regulated Nurr1 in HCT116 cells (Beard et al., 2016) and miR-132 targeted Nurr1 in differentiation of dopamine neurons (Yang et al., 2012). [score:7]
showed that the miR-145-5p mimic clearly decreased the luminescence reporter signal to a greater extent (P < 0.001; Figure 2D), as did miR-132 and miR-34c-5p, which were previously shown to directly target Nurr1. [score:4]
Eleven miRNAs, including miR-145-5p, miR-34c-5p, miR-365-3p, miR-214-3p, miR-151, miR-27a, miR-153-5p, miR-365-3p, miR-33-5p, miR-217-5p and miR-129-5p, were differentially and significantly expressed (P < 0.05; Figure 2B). [score:3]
The orphan nuclear receptor NR4A2 is part of a p53-microRNA-34 network. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 15
Sano et al. [23] also demonstrated the upregulation of micro-34a during seizure -induced neuronal death, further indicating the involvement of miR-34 family in seizure pathology. [score:4]
MiR-34b, miR-34c, which locate in the same transcriptional unit as miR-34b, were moderately upregulated. [score:4]
Among these candidates, miR-34b-5p attracted our attention because of previous studies about the miR-34 family in CNS diseases. [score:3]
But the function and regulation of miR-34b and miR-34c remain poorly understood, especially regarding their roles in the CNS. [score:2]
The miR-34 family is composed of three mature non-coding microRNAs-miR-34a, miR-34b, and miR-34c-found at three different loci across the genome. [score:1]
We discovered that miR-34b-5p, a member of the miR-34 family, increased significantly in flurothyl -treated rat hippocampus tissue. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 14
For example, miR-34a-5p, which shares seed similarity to miR-34c-5p, elevated levels of which have been shown to be detrimental to memory (Zovoilis et al., 2011), has been shown to regulate the synthesis of Arc, a cytoskeletal protein involved in trafficking of AMPAR subunits (Wibrand et al., 2012), as well as Grm7, a metabotropic glutamate receptor subunit (Zhou et al., 2009), Sirt1, an epigenetic regulator of gene expression (Yamakuchi and Lowenstein, 2009), and the neurotransmitter release-related genes Syt1, Syn1, and Stx-1a (Agostini et al., 2011). [score:5]
A subset of the rapidly down-regulated miRNA (miR-34a-5p, miR-34c-5p, miR-132-3p, miR-181c-5p, miR-214-3p) were chosen for more in-depth analysis by RT-qPCR, based on previous associations with plasticity processes (Wayman et al., 2008; Schonrock et al., 2010; Agostini et al., 2011; Zovoilis et al., 2011; Ryan et al., 2012). [score:4]
microRNA-34c is a novel target to treat dementias. [score:3]
Using individual TaqMan qPCR assays, we confirmed reduced expression of miR-34a-5p and miR-132-3p (miR-34a-5p: p = 0.0001, n = 8; miR-132-3p: p = 0.001, n = 8; Figure 3), but not miR-34c-5p (p = 0.14, n = 9), miR-181c-5p (p = 0.46, n = 10) or miR-214-3p (p = 0.65, n = 9). [score:2]
[1 to 20 of 4 sentences]
17
[+] score: 13
In addition, levels of miR-34b and miR-34c were up-regulated in CCA rats, but down-regulated in CCE rats. [score:7]
Levels of miR-34b and miR-34c, which showed an increase in expression in CCA rats (p < 0.05 vs. [score:3]
The level of miR-34c is found to be elevated in the hippocampus in Alzheimer’s disease [23]. [score:3]
[1 to 20 of 3 sentences]
18
[+] score: 13
Four of these miRNAs were downregulated in the liver of rats born to DEX -treated mothers (miR-34a-5p, miR-34c-5p, miR-124-3-3p and miR-150-5p). [score:4]
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
Additionally, an increase in phosphorylated AKT after the inhibition of the miR-34 family has been observed [39]. [score:3]
Expression of miR-34a-5p, miR-34c-5p, miR-124-3p, and miR-150-5p (respectively, 52%, 56%, 47% and 20% lower than CTL; P < 0.05) but not miR-449a was reduced in the liver of 60-hour fasted rats born to DEX -treated mothers (Fig.   5G). [score:3]
[1 to 20 of 4 sentences]
19
[+] score: 12
Intriguingly, miR-34 and HMGA1 generate an intricate regulatory loop since HMGA1 is able to negatively regulate the expression of miR-34 (Puca, unpublished observations) and p53 (61), being the latter able to induce the expression of miR-34. [score:7]
In this process, HMGA1 has a central role since, upon its overexpression, alters miR-34 pathway by acting directly and indirectly on it, through the repression of p53 (Figure 1C). [score:5]
[1 to 20 of 2 sentences]
20
[+] score: 12
Our study identified an upregulation of miR-34c after occlusion compared to control, and its upregulation compared to ablation. [score:5]
Reports showed that miR-34c is induced after acute ischemic damage (Greco et al., 2009), miR-34b and miR-34c belong to an evolutionary conserved miRNA family that plays a fundamental role in the p53 tumor suppressor network (He et al., 2007). [score:3]
Similarly, miR-34c and mir-93 expressions were higher expressed in occlusion at 1 week compared to control, and also in occlusion compared to ablation. [score:3]
Since MI procedures promotes p53 -dependent apoptosis (Fiordaliso et al., 2001), it is tempting to speculate that the p53/miR-34 axis may be involved in a MI -induced death pathway. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 11
Members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [14- 19]. [score:7]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
[1 to 20 of 2 sentences]
22
[+] score: 11
Interestingly, several reports have shown that the miR-34 family is a direct target of p53, and its activation induces apoptosis and cell cycle arrest [31, 32]. [score:4]
In his report, Hermeking described the role of p53 as a mediator of tumor suppression through the activation of miR-34 family members. [score:3]
The ectopic expression of miR-34 genes is known to cause a G1 phase arrest [28]. [score:3]
In addition, the activation of miR34-a by p53 feeds back to p53, and such positive feedback leads to further activation of p53 [30]. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 11
However, the slightly up-regulated miR-16, miR-34c-3p and let-7i* miRNAs in this study have been demonstrated to be down-regulated in other cancer settings [56], [57], [58]. [score:7]
Cell Cycle 9 In press 69 Hagman Z Larne O Edsjo A Bjartell A Ehrnstrom RA 2010 miR-34c is down regulated in prostate cancer and exerts tumor suppressive functions. [score:4]
[1 to 20 of 2 sentences]
24
[+] score: 10
In order to validate the changes in miRNA expression detected by a deep-sequencing, we conducted quantitative real-time PCR analysis to examine expression levels of six miRNAs including rno-miR-378, rno-miR-182, rno-miR-21, rno-miR-34a, rno-miR-34b, and rno-miR34c. [score:5]
rno-miR-881, rno-miR-880, miR-741-3p, miR-511*, miR-187, miR-449a, as well as 6 members of miR-34 family, miR-34a, miR-34a*, miR-34b, miR-34b*, miR-34c, and miR-34c*, showed over 10-fold up-regulation. [score:4]
It was followed by activation of P53 and the binding P53 to the promoter of miR-34a resulted in mir-34 activation [41]. [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 9
More recently, hippocampus-expressed miRNAs such as miR-134 and miR-34 have been shown to target the deacetylase sirtuin-1 (SIRT1) and thereby influence learning and memory processes (Gao et al., 2010; Zovoilis et al., 2011). [score:5]
microRNA-34c is a novel target to treat dementias. [score:3]
For example, miR-34c has been implicated in the cognitive impairment associated with dementia. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 9
Other miRNAs from this paper: rno-mir-34b, rno-mir-34a
45, 46 Moreover, inactivation of miR-34 expression has been recently shown to lead to accelerated neurodegeneration and ageing in D. melanogaster, [44] whereas in vertebrates its elevation has been suggested to be either protective or contribute to age -associated events. [score:3]
Interestingly, the peak amplitude of the NMDA current in miR-34a cells was greatly suppressed as compared with control neurons (Figures 3c and d) by normalizing NMDA -induced current to cell capacitance (empty vector cells, 8.2±5.3 pA/pF, n=28; miR-34 A cells, 5.4±2.5 pA/pF n=25; P<0.05; all cells were recorded at 11 DIV). [score:2]
Consistently, recent reports have implicated miR-34 family in regulating genes that mediate the behavioural changes in response to stress. [score:2]
41, 42 miR-34 increases with age in C. elegans and D. melanogaster. [score:1]
Nevertheless, we cannot exclude that other factors may mediate the reduction of DCX by miR-34. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 9
Murakami et al. reported that 11 miRNAs including miR-34, miR-199a-5p, miR-199, miR-200, and let-7e were up-regulated in a CCl [4] -induced fibrosis mo del mouse [31]. [score:4]
Recently, Li et al. reported that 16 miRNAs including miR-34, miR-199a-5p, miR-221, miR-146b, and miR-214 showed progressive up-regulation in rat with hepatic fibrosis caused by dimethylnitrosamine [30]. [score:4]
Among them, miR-34 and miR-199a-5p were common in the two mo dels. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 8
Other microRNAs to have been reported to be related to depression are miR-34 acting as a regulator of CRF signaling, miR-134 and miR-124a levels were significantly downregulated after treatment with duloxetine and miR-144 was found to have an increased expression in both lithium- and valproate -treated animals (Haramati et al., 2011; Hansen and Obrietan, 2013; Pan and Liu, 2015). [score:7]
MicroRNA as repressors of stress -induced anxiety: the case of amygdalar miR-34. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 7
miRNAs that had approximately 2-fold upregulation included members of miR-29 family and miR-34 family and that were downregulated by about 2-fold were members of the miR-181 family and miR-183 family. [score:7]
[1 to 20 of 1 sentences]
30
[+] score: 7
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34b, hsa-mir-34c, rno-mir-34b, rno-mir-34a
Because miR-34a upregulation was only observed in hepatocytes, we wondered how miR-34 functions in liver fibrosis. [score:4]
As shown in Fig 4C, miR-34 significantly induced the apoptosis of L-02 cells in a dose -dependent manner, and the induced apoptosis was then inhibited by SRT1720. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 7
It has been shown that miR-29, miR-15 and miR-107 are upregulated; while miR-124, miR-34 and miR-153 are downregulated in patients with AD (Delay et al., 2012; Lau et al., 2013). [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
Sun et al. have shown that expression levels of miR-34c-5p and 34b-5p were significantly higher in peripheral blood leukocytes of depressed patients than healthy controls. [score:3]
It is noteworthy that miR-34a-5p, miR-34b-5p, and miR-34c-5p are members of the same miRNA family, possessing identical seed region and therefore similar potential targets. [score:3]
However, further studies are needed to define the exact role of miR-34-5p/449-5p family in stress-related pathologies because it has been shown that both resilient animals and depressed patients exhibit increased miR-34 levels. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 5
Notably, a panel of 11 Runx2 -targeting miRNAs (miR-23a, miR-30c, miR-34c, miR-133a, miR-135a, miR-137, miR-204, miR-205, miR-217, miR-218, and miR-338) is expressed in a lineage-related pattern in mesenchymal cell types [20]. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
In a bone cancer mo del, intrathetal injections of miR-1 -inhibitor or miR-34c-5p -inhibitor, respectively produce a mild or a strong decrease in mechanical hypersentitivity (Bali et al., 2013). [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Fig.   4c showed that treatment with pre-miR-34c suppressed Beclin-1 mRNA expression under ischemia, however, that was increased by cells treated with anti-30c under both ischemia and normoxia. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 4
The miR-34 family was recently shown to be upregulated in the gut of patients during severe aGvHD (18). [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
Other miRNAs from this paper: rno-mir-34b, rno-mir-34a, rno-mir-208a, rno-mir-208b
MiR-34 family members (miR-34a, -34b, and -34c) are upregulated in the heart in response to stress (i. e. myocardial infarction) and contribute to the age -dependent decline in cardiac function [9, 10]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 3
Other miRNAs from this paper: rno-mir-34b, rno-mir-34a
miR-34a belongs to one of several evolutionarily-conserved families of miRNAs, namely miR-34, and was originally identified as a TP53 -targeted mRNA [40]. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Among these aberrant miRNAs, ten miRs (miR-183-3p, miR-34c-3p, miR-200b, miR-466c, miR-465-3p, miR-185-3p, miR-320a, miR-493-5p, miR-181b-5p and miR-21-5p) were reported to be differentially expressed at both 12 and 48 h after IR. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, rno-mir-34b, rno-mir-34a
Wong KY Yu L Chim CS DNA methylation of tumor suppressor miRNA genes: a lesson from the miR-34 familyEpigenomics. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
The expression level of miR-34a was approximately 29-fold with miR-34 agomir and 0.4-fold with miR-34a antagomir (Figure 5A). [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Finally, we performed RTqPCR for a number of candidate miRNAs chosen from the most expressed miRNA in spermatozoa, including Mir34c and Mir34b [35, 36], and found no differences between groups. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Other miRNAs from this paper: rno-let-7d, rno-mir-34b
Preliminary evidence for association of genetic variants in pri-miR-34b/c and abnormal miR-34c expression with attention deficit and hyperactivity disorder. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 2
MicroRNAs from miR-8 family and miR-34 family were reported to be involved in the regulation of ceramide signaling pathway in the frontal cortex and dopamine signaling pathway in the hippocampus respectively [17]. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
Several candidate therapeutic miRNAs have progressed into clinical and preclinical development; for example, antisense miR-122 is being developed as a treatment for hepatitis C virus, miR-208/499 for chronic heart failure, miR-195 for myocardial infarction and miR-34 and let-7 for cancer 10, 11. [score:2]
[1 to 20 of 1 sentences]
47
[+] score: 2
This is the first report of microRNA regulation following perforant path LTP in awake freely moving rats and is particularly relevant as the seed recognition sequence of the MIR34 family has recently been reported to rescue learning impairment [51]. [score:2]
[1 to 20 of 1 sentences]
48
[+] score: 2
Other miRNAs from this paper: rno-mir-34b, rno-mir-34a
Notably for our study, DICER1 has been shown to mediate stress -induced anxiety through its regulation of microRNA-34 in the amygdala [91]. [score:2]
[1 to 20 of 1 sentences]
49
[+] score: 2
Of those, 9 miRNAs (let-7c-1, miR-221-3p, miR-221-5p, miR-222-3p, mir-322-2, mir-34c, miR-384-5p, mir-496, and mir-542-1) reported consistent directional changes as our data (15, 31– 33). [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 2
Some of these miRNAs, i. e. rno-miR-34c, rno-miR-449a, rno-miR-301b, rno-miR-532-5p, rno-miR-219-5p, rno-miR-451, and rno-miR-152, were even 10-fold more abundant at E10 than at any other stages, providing a hint that these 7 miRNAs may play important roles in the regulation of progenitor cell proliferation. [score:2]
[1 to 20 of 1 sentences]
51
[+] score: 2
8 -55.3 -90.4 mmu-miR-34c* -3.7 -1.7 -6.5 mmu-miR-709 -2.9 -2.4 -4.3 mmu-miR-326 -3.9 -2.9 -5.6 rno-miR-664 -1.8 -2.2 -3.6 mmu-miR-350 -1.4 -110.5 -5.1 mmu-let-7e 1.4 -7.6 -5.1 mmu-miR-542–5p -1.9 -5.2 -5.1 rno-miR-20b-5p -3.0 -4.5 -5.0 mmu-miR-374 -1.7 -3.7 -4.4 To understand the cardiovascular benefit of resveratrol in ischaemia/repurfusion, we included longevinex, a commercial formulation of resveratrol by gavage to rat. [score:1]
9 -45.6 mmu-miR-27b -1.8 -71.4 -462.7 mmu-miR-214* -2.6 -5.0 -43.5 mmu-let-7c-1* -73.2 -204.4 -334.1 mmu-miR-34c -9.4 -26.1 -42.7 mmu-miR-542–3p -5.9 -195.6 -319.8 mmu-miR-706 -9.3 -5.0 -38.7 mmu-miR-487b -2.0 -161.5 -263.9 mmu-miR-467b* -10.1 -2.2 -33.6 rno-miR-17–3p -1.6 -152.0 -248.5 mmu-miR-323–3p -3.7 -23.3 -29.8 mmu-miR-10b -2. 4 -136.6 -223.3 mmu-miR-202–3p -6.5 -5.9 -21.4 mmu-miR-29b -3.0 -135.1 -220.9 mmu-miR-339–5p -1.6 -9.6 -19.6 mmu-miR-297a* -2.4 -128.4 -209.8 mmu-miR-181c -2.0 -10.5 -14.6 mmu-miR-692 -41.5 -115.8 -189.2 mmu-miR-203 -4.6 -6.4 -13.8 mmu-miR-208 -40.6 -113.5 -185.5 mmu-miR-467a* -2.6 -3.9 -11.4 mmu-miR-467c -38.9 -108.6 -177. [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 2
Recently, miR-34a and miR-34c have been shown able to down regulate peroxisome proliferator-activated receptor (PPAR) in hepatic stellate cells thus inducing their activation, a hallmark of liver fibrosis [53]. [score:2]
[1 to 20 of 1 sentences]
53
[+] score: 1
On the other hand, a few miRs have been found to promote apoptosis of myocardiocytes, such as miR-26 [29], miR-34 [30], and miR-92 [31]. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
MiR-137, miR-124, miR-34a, and miR-34c have also been implicated in ketamine -induced neurotoxicity in various in vivo and in vitro mo dels [20– 23]. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
The mature miR-34, a 22-nucleotide microRNA, has three members: miR-34a, miR-34b, and miR-34c. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
MiRNAs such as hsa-let-7f, hsa-miR-499, hsa-miR-373, hsa-miR-372, hsa-miR-371, hsa-miR-369-5p, hsa-miR-34c, hsa-miR-34b, hsa-miR-34a, hsa-miR-29c, hsa-miR-217, and hsa-miR-20a might influence senescence or aging [42]. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
Many miRNAs, such as miR-122 (Santaris Pharma, Denmark) and miR-34 (Mirna Therapeutics, USA), need to be studied clinically 53. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Although they did not reach statistical significance, the microarray data suggested a possible increase of miR-34a, miR-34b and miR-34c in the islets of old animals (ESM Table 4). [score:1]
[1 to 20 of 1 sentences]