sort by

30 publications mentioning rno-mir-130a

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-130a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 91
Other miRNAs from this paper: rno-mir-130b, rno-mir-132, rno-mir-152, rno-mir-184, rno-mir-212
Concerning the miRNAs studied here, we previously showed that miR-130a expression is downregulated with increased glucose concentration in Wistar rat islets 10, which was supported by our findings in INS-1 832/13 cells for miR-130a, miR-130b and miR-152 (Supplementary Fig. S2). [score:6]
The transient modulation of miR-130a, miR-130b, or miR-152 in INS-1 832/13 cells by either over -expression or knock-down resulted in reciprocal effects on GSIS, but not KCl -induced insulin secretion agrees with targets primarily involved in modulating the cytosolic ATP concentration. [score:6]
When miR-130a and miR-152 in combination were each overexpressed at half the amount of final concentration than when each miRNA was overexpressed separately, similar magnitude of reduction was observed for GSIS and insulin content, demonstrating the additive effect of miR-152 and miR-130a. [score:5]
Over -expression and co -expression of miR-152, miR-130a, and miR-130b in pancreatic islets. [score:5]
However, one may also argue that miR-130a/b can have other target enzymes within the glycolytic pathway which contribute to the further reduction of cytosolic ATP/ADP upon oligomycin -mediated inhibition of mitochondrial ATP synthase. [score:5]
Previous reports regarding decreased glucokinase (GCK) mRNA expression in the pancreatic islets of T2D humans 30 and GK rats 31, and deficiency of pyruvate dehydrogenase activity 17 in the pancreatic islets of diabetic GK rats led us to focus on the potential targeting of miR-130a/b and miR-152 within the 3′UTR and coding sequence (CDS) regions of GCK/Gck and PDHA1/Pdha1 in human/rat (Supplementary Table 2). [score:5]
Moreover, despite different chromosomal locations of the three miRNAs in the human genome (chr11/miR-130a; chr22/miR-130b; chr17/miR-152), there was a notable co -expression among them, indicating highly-coordinated transcriptional regulation of these miRNAs in the human pancreatic islets (Fig. 1C). [score:4]
Upregulation of miR-152, miR-130a and miR-130b in GK rat islets, and in human islets from donors with impaired glucose tolerance and type-2 diabetes. [score:4]
Here, we validated our array findings by qPCR, and showed that miR-130b, which harbours an identical seed sequence as miR-130a and belongs to the miR-130 gene family, was also upregulated in the pancreatic islets of hyperglycaemic GK rats (Fig. 1A). [score:4]
The similar ATP dynamics profile of miR-130a and miR-130b confirmed the similar regulatory targets of these miRNAs by virtue of their identical seed sequence. [score:4]
Of note, the miR-152 and miR-130a are among the 24 miRNAs we previously showed to be upregulated in the pancreatic islets of GK rats 10. [score:4]
We previously determined that miR-152 and miR-130a were among the 24 upregulated miRNAs in the islets of the T2D mo del GK rat, compared to those of Wistar controls using a locked nucleic acid (LNA) -based miRNA array profiling approach 10. [score:3]
Moreover, the significant reduction of ATP levels after oligomycin treatment was only observed in miR-130a/b over -expressing cells. [score:3]
How to cite this article: Ofori, J. K. et al. Elevated miR-130a/miR130b/miR-152 expression reduces intracellular ATP levels in the pancreatic beta cell. [score:3]
We found that miR-130a, miR-130b and miR-152 or combination of miR-130a/miR-152 resulted in significant decrease in the expression of Pdha1 both in the mRNA and protein levels (Fig. 4A,B). [score:3]
html) 29 to identify putative targets of miR-130a-3p, miR-130b-3p, and miR-152-3p. [score:3]
Specific primers and probes from TaqMan [®] MiRNA Assays (Applied Biosystems, CA, USA) were used to measure the expression levels of miR-130a-3p (#TM_000454), miR-130b-3p (#TM_000456), miR-152-3p (#TM_ 000475) and mRNA expression of their targets: Rat Pdha1 (Rn01424346_m1), Rat Gck (Rn00561265_m1), Human PDHA1 (Hs01049345_g1), and Human GCK (Hs01564555_m1). [score:3]
To conclude, we could show that miR-130a, miR-130b and miR-152 influence the metabolic control of GSIS via modulation of ATP levels, partially through targeting of PDHA1 and GCK in the pancreatic beta cell (Fig. 7). [score:3]
However, using bioinformatics prediction we did not find any of these genes to be potentially targeted by miR-130a/b. [score:3]
Hypothetically, LNAs that knock down miR-130a/miR-130b/miR-152 would affect the glucose conversion pathway in the mitochondria and assist in stabilizing the intracellular ATP to an optimal level. [score:2]
It is therefore plausible that the direct repression of PDHA1 or GCK by miR-130a may have occurred via AGO1 or AGO3. [score:2]
Subsequently, we could show negative regulatory effects of miR-130a and miR-130b on glucokinase and PDHA1, and the direct biochemical interaction of miR-152, with Pdha1 mRNA using the AGO2 RIP assay. [score:2]
In this study, we showed that islets from hyperglycaemic human donors contain elevated levels of miR-130a, miR-130b and miR-152. [score:1]
Effect of modulating miR-130a, miR-130b, and miR-152 levels on insulin secretion in INS-1 832/13 cells. [score:1]
For instance, we could observe that miR-152 impacted less on the ATP:ADP ratios during GSIS than either miR-130a or miR-130b. [score:1]
The characteristics of human pancreatic islet donors are in Supplementary Table 1. We found that the levels of miR-152, miR-130a and miR-130b were upregulated in the islets of hyperglycaemic donors (IGT/T2D) compared to those of normoglycemic (NGT) donors (Fig. 1B). [score:1]
We therefore performed more in-depth bioinformatics prediction for miR-130a binding to other glycolysis-related enzymes 32 in the rat beta cell such as in phosphofructokinase (Pfkm), pyruvate kinase (Pklr), malic enzyme (Me1), ATP-citrate lyase (Alcy), and glyceraldehyde-3-phosphate dehydrogenase (Gapdh). [score:1]
We did not see enrichment in ATP -binding category for genes containing only miR-130a/miR-130b putative binding sites (Supplementary Table 3). [score:1]
However, we found no enrichment of the Pdha1 3′UTR fragment nor of the Gck 3′UTR fragment predicted to interact with miR-130a (Supplementary Fig. S3). [score:1]
To determine enriched Gene Ontology categories for genes with unique putative binding sites for either miR-130a/b or miR-152, we used the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 web server (https://david-d. ncifcrf. [score:1]
In cells transfected with combined Pre-miR-152 and Pre-miR-130a, the concentration of each Pre-miR was reduced to 25 nM. [score:1]
[1 to 20 of 31 sentences]
2
[+] score: 82
b Right panel showed the target mRNA network of miR-130a-3p in immune system Table 3 Target mRNA network of miR-130a-3p in the immune system Target gene Representative transcript Species Gene name MILL1 ENSRNOT00000035286 Rattus norvegicus MHC I-like leukocyte 1(Mill1) PLSCR1 ENSRNOT00000010689 Rattus norvegicus Phospholipid scramblase 1(Plscr1) GPR183 ENSRNOT00000034560 Rattus norvegicus G protein-coupled receptor 183(Gpr183 CXCL14 ENSRNOT00000016009 Rattus norvegicus C-X-C motif chemokine ligand 14(Cxcl14) IRF1 ENST00000245414.4 Rattus norvegicus Interferon regulatory factor 1(Irf1) NLRP3 ENSRNOT00000086710 Rattus norvegicus NLR family, pyrin domain containing 3 (Nlrp3) PIK3CB ENSRNOT00000022179 Rattus norvegicus Phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta(Pik3cb) S1PR1 ENSRNOT00000018318 Rattus norvegicus Sphingosine-1-phosphate receptor 1(S1pr1) CSF2 ENSRNOT00000032333 Rattus norvegicus Colony stimulating factor 2(Csf2) CCL1 ENSRNOT00000031360 Rattus norvegicus C-C motif chemokine ligand 1(Ccl1) TNFSF11 ENSRNOT00000049056.4 Rattus norvegicus Tumor necrosis factor superfamily Member 11(Tnfsf11) IL19 ENSRNOT00000035044 Rattus norvegicus Interleukin 19(Il19) IL36A ENSRNOT00000007540 Rattus norvegicus Interleukin 36, alpha(Il36a) Using TargetScan software, S1PR1 and IRF1 were predicted as the potential target genes of miR-130a-3p (Fig.   7a). [score:12]
This study demonstrates that hip fracture -induced IMD, characterized by reduced TNF-α/IL-10 ratio, in aged rats may be attributable to the downregulation of miR-130a-3p and the upregulation of target S1PR1 and IRF1. [score:7]
In addition, a previous study reported that miR-130a directly targeted the 3′-UTR of TNF-α and repressed its translation [29]. [score:6]
In this study, we found the lung expression of SIPR1 and IRF1, both related to the production of IL-10, were significantly increased in IMD rats, suggesting that the reduction of miR-130a-3p may lead to increased expression of SIPR1 and IRF1, which mediates the production of IL-10. [score:5]
Target prediction showed that S1PR1 and IRF-1 genes are potential targets of miR-130a-3p. [score:5]
miR-130a-3p desregulation may be associated with elderly hip fracture -induced IMD, which might act as a new potential biomarker for the diagnosis and prognosis of elderly hip fracture -induced IMD and a potential therapeutic target as well. [score:4]
To further understand the role of miR-130a-3p in the regulation of immune response in aged IMD rats, a miRNA-mRNA network was suggested, including 14 mRNAs (e. g., S1PR1 and IRF-1 genes) related to immune system as the potential target genes of miR-130a-3p. [score:4]
In total, 235 mRNAs which may differentially regulate the miR-130a-3p -targeted mRNAs were included in the network (Fig.   6a). [score:4]
Furthermore, Western blot experiment demonstrated that in lung tissue, the reduction of miR-130a-3p was accompanied with the increase of the protein expression of interferon regulatory factor-1 (IRF1) and sphingosine-1-phosphate receptor 1 (SIPR1). [score:4]
Since reportedly elderly hip fracture often accompanies with postoperative liver and lung dysfunction [2, 6, 7], we selectively observed the expression of miR-130a-3p and protein of S1PR1 and IRF in lung tissue. [score:3]
Particularly, 14 mRNAs as the potential target genes of miR-130a-3p, such as IRF1, S1PR1, Ccl7, Pik3cb, and Cxcl14, were supposedly associated with immune system (Table  3, Fig.   6b). [score:3]
a Prediction of SIPR1 and IRF-1 as the potential target genes of miR-130a-3p. [score:3]
The data showed that the serum and lung levels of miR-130a-3p were significantly downregulated in IMD rats compared with those in normal and non-IMD rats (P < 0.001) (Fig.   3a, b). [score:3]
The potential target genes of miR-130a-3p. [score:3]
In this study, through the target prediction of miR-130a-3p using bioinformatics tool and the measurement of the lung levels of miR-130a-3p, S1PR1, and IRF1, we supposed that S1PR1 and IRF are the targets of miR-130a-3p. [score:3]
In this study, we screened the differentially expressed miRNAs between the normal, IMD, and non-IMD elderly hip fracture rats by using miRNA microarray and further confirmed that the miR-130a-3p levels of the serum and lung tissue in IMD rats were both significantly reduced compared with those in normal and non-IMD rats using qRT-PCR. [score:2]
The vertical axis showed the pathway categories and the horizontal axis showed the degrees of the enrichment of the pathways Furthermore, to illustrate the role of miR-130a-3p, significantly decreased in the serum and lung tissues of IMD rats in comparison to normal and non-IMD rats as validated by RT-PCR, in the regulation of immune system in IMD rats, a miRNA-mRNA network was suggested. [score:2]
The next study will be carried out to determine the direct control of miR-130a-3p toward S1PR1 and IRF genes. [score:2]
qRT-PCR and in silico analysis revealed that miR-130a-3p likely participated in regulating the hip fracture -induced IMD. [score:2]
Consistently, this study revealed that decrease of miR-130a-3p promotes the production of the pro-inflammatory factor TNF-α in hip fracture rats. [score:1]
Hip fracture Elderly Immune disturbance MiR-130a-3p Interferon regulatory factor-1 Sphingosine-1-phosphate receptor 1 Hip fracture remains a leading cause of excessive morbidity and mortality among old people [1, 2]. [score:1]
This implies that miR-130a-3p may be used as a potential biomarker for the IMD related to hip fracture in the elderly. [score:1]
Serum (a) and lung (b) levels of miR-130a-3p in normal, immune disturbance (IMD), and non-IMD rats. [score:1]
Fig. 3Validation of miR130a-3p, miR-150-5p, miR-143-3p, and miR-223-3p in serum and lung tissues by qRT-PCR. [score:1]
[1 to 20 of 24 sentences]
3
[+] score: 53
In addition, miR-130a overexpression decreases, whereas miR-130a inhibition increases, the expression levels of TNF-α in PBMCs (Ma et al., 2015). [score:7]
Based on functional and pathway analysis and related literature examination, we selected miR-134-5p, miR-207, and miR-465-5p to represent the up-regulated miRNAs, and miR-30b-5p, miR-19a-3p, and miR-130a-3p to represent the down-regulated miRNAs. [score:7]
of a C/EBP-ε mRNA lacking a binding site for miR-130a restored both C/EBP-ε production, expression of Camp and Lcn2, and resulted in granulocytic precursors with a more mature phenotype, indicating that miR-130a is important for the regulation of C/EBP-ε expression during granulopoiesis (Larsen et al., 2014). [score:6]
Furthermore, miR-130a down-regulation has been shown to increase the expression of HDAC3 in peripheral blood mononuclear cells (PBMCs), and loss-of-function of miRNA-130a promotes PBMCs apoptosis. [score:6]
Overexpression of miR-130a regulates C/EBP-ε protein expression levels in both murine and human granulocytic precursors. [score:6]
Among these DEmiRNAs, 6 up- or down-regulated miRNAs were chosen for further analysis, including miR-134-5p, miR-207, miR-465-5p, miR-30b-5p, miR-19a-3p, and miR-130a-3p. [score:4]
miRNA-130a regulates C/EBP-epsilon expression during granulopoiesis. [score:4]
In our network, Chst1 (carbohydrate sulfotransferase 1) is regulated by four miRNAs, including miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-134-5p, while Nrbf2 (nuclear receptor binding factor 2) is regulated by miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-207. [score:3]
The DEmiRNAs (e. g., miR-134-5p, miR-207, miR-465-5p, miR-30b-5p, miR-19a-3p, and miR-130a-3p) and common target genes, such as Chst1 and Nrbf2, may be strongly associated with the pulmonary inflammation induced by ZnO-NPs. [score:3]
Increased HDAC3 and decreased miRNA-130a expression in PBMCs through recruitment HDAC3 in patients with spinal cord injuries. [score:3]
Additionally, in our study, Nrbf2 was regulated by miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-207. [score:2]
Finally, Scn9a is modulated by miR-30b-5p, miR-130a-3p, miR-134-5p, and miR-465-5p. [score:1]
Chst1 is modulated by four miRNAs, including miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-134-5p. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 37
Expression of miR-129, miR-130a, miR-130b, miR-141, miR-218b and miR-3588 were uniquely suppressed in mid dose but then elevated in high dose, with opposite expression to their target genes. [score:9]
The expression of target genes of miR-129, miR-218b, miR-141,miR-130a, miR-130b, miR-3588 at 13 weeks. [score:5]
Figure 10 analysis of miR-129, miR-130a, miR-130b and miR-141 expression in the kidneys of the rats in 4 weeks (BK, BM and BHgroups, Figure 10 a), 13 weeks (CK, CM and CH groups, Figure 10 b) and 26 weeks (DK, DM and DH groups, Figure 10 c). [score:3]
Among these 77 miRNAs, those with ≥ 2-fold down-regulation in CM compared to CK (miR-129, miR-130a, miR-130b, miR-141, miR-218b and miR-3588) were selected for bioinformatic analysis. [score:3]
KEGG and GO enrichment analyses were further performed in the six differentially expressed miRNAs (miR-129, miR-130a, miR-130b, miR-141, miR-218b and miR-3588), demonstrating that “phosphatidylinositol signaling system”, “pancreatic cancer” and “MAPK signaling pathway” were mostly significantly enriched. [score:3]
Among the six miRNAs that selected by STEM analysis, 4 miRNAs (most of the pathways were enriched by the targets of miR-129, miR-130a and miR-130b. [score:3]
The mRNA expression of Smoc2/Dcn (miR-129), Emp1/Rapgef5 (miR-218b), lgfbp3/sepp1 (miR-141), lgfbp3/Sepp1/Col1a2/Edem1 (miR-130a/miR-130b) and Edem1/Dpt (miR-3588) at 13 weeks are strongly correlated with its corresponding miRNAs shown in the parentheses. [score:3]
There was no significant effect of OTA on the expression of miR-130a. [score:3]
The expression of miR-129, miR-130a, miR-130b and miR-141 was also examined in kidneys of rats in groups of 4 weeks and 26 weeks. [score:3]
Notably, regulation of the pathways and GOBPs were strongly associated with miR-129, miR-130a and miR-130b. [score:2]
[1 to 20 of 10 sentences]
5
[+] score: 28
Three general trends of miRNA expression trajectories were observed for Wistar islets at 2.8G vs 16.7G: i) increased expression as exhibited by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreased expression as in the case of rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708 and, iii) no change as seen in rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:7]
0018613.g004 Figure 4Three general trends of miRNA expression trajectories were observed for Wistar islets at 2.8G vs 16.7G: i) increased expression as exhibited by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreased expression as in the case of rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708 and, iii) no change as seen in rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:7]
We specifically found expression of rno-miR-130a, rno-miR-132, rno-miR-212 and rno-miR-335 to be regulated by hyperglycaemia. [score:4]
This is clearly seen for rno-miR-212, rno-miR-132, and rno-miR-130a, whose expression levels in the GK and Wistar islets eventually coincide at 16.7G (Fig. 4). [score:3]
We saw changes in miRNA expression manifested within a short temporal window of only one hour, such as for rno-miR-130a, rno-miR-132, rno-miR-212 and rno-miR-335. [score:3]
In general, aside from more significant changes in expression levels of miRNAs at 24 h incubation compared to 1 h incubation, three trends in terms of expression changes are also observed in the Wistar islet upon stimulation at 16.7G as compared to 2.8G: i) increasing miRNA levels, as displayed by rno-miR-132, rno-miR-212 and rno-miR-409-3p, ii) decreasing miRNA levels as exhibited by rno-miR-124, rno-miR-142-3p, rno-miR-375, rno-miR-335, rno-miR-130a and rno-miR-708, and iii) no significant change as displayed by rno-miR-376a, rno-miR-142-5p and rno-miR-433. [score:3]
Among the miRNAs tested only rno-miR-130a, rno-miR-132, rno-miR-212 and rno-miR-335 responded to glucose stimulation at either 8.3 mM or 16.7 mM in the healthy Wistar islets (Fig. 3; p<0.05). [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 21
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Of the three ZT06 groups that illustrated differential expression of miRNAs due to CD, emphasis was placed on the two-week chronic ZT06 group due to the differential expression of miRs 146a and 146b, and miR-127 (Figures 5A-5B and 6A). [score:11]
24-Hour Acute ZT06 Expression 24-Hour Chronic ZT06 Expression 2-Week chronic ZT06 Expression rno-miR-142-5p Over rno-miR-126a-5p Under rno-miR-146a-5p Under rno-miR-150-5p Over rno-miR-30b-5p Under rno-miR-24-3p Under rno-miR-335 Under rno-let-7b-5p Over rno-miR-130a-3p Over rno-miR-15b-5p Over rno-miR-99a-5p Over rno-miR-127-3p Under rno-miR-133a-3p Under rno-miR-10a-5p Over rno-miR-672-5p Over rno-miR-l-3p Under rno-let-7c-5p Over rno-miR-193-3p Over rno-miR-142-5p Under rno-miR-146b-5p Under rno-miR-150-5p Over Differentially expressed miRNAs based on Illumina sequencing in all the circadian-disrupted samples and their links to breast cancer development and circadian rhythms. [score:10]
[1 to 20 of 2 sentences]
7
[+] score: 16
Also the miR-145 and miR-130a that did not show the effect on the reporter fused to the short variant also did not modify luciferase activity of the reporter fused to the long variant, indicating that under these conditions, these miRNAs do not regulate Nurr1 expression. [score:4]
C. RT-PCR showing the expression of the long 3’UTR variant of Nurr1 mRNA in the developing mesencephalon D. Effect of different combination of miR-145, miR-302d and miR-130a on luciferase reporter fused to the long 3’UTR variant of Nurr1 mRNA. [score:3]
E. Effect of miR-145or miR-130a overexpression on Nurr1 3’UTR long. [score:3]
C. Effect of miR-145, miR-302d or miR-130a overexpression on Nurr1 3’UTR short. [score:3]
The precursor sequences of the miR-145, miR-302d, miR-130a, miR-204, miR-93, miR-17, miR-455, miR-212 and miR-30a were cloned on pEGP-CE vector, acquired from Cell Biolabs Inc (7758 Arjons Drive San Diego, CA 92126 USA). [score:1]
The intersection of these criteria resulted in 11 miRNAs (Fig 2A, grey numbers), from which we selected three with higher scores and non-redundant family: miR-145, miR-130a and miR-302d (Fig 2B). [score:1]
The seed sites of miRNAs selected for the short 3’UTR are: miR-145 in nucleotide 25, miR-302d in nucleotide 465, and miR-130a in nucleotide 606. [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 14
Therefore, increased expression of miR-29 and miR-24 and reduced expression of miR-34, miR-130 and miR-378 may be responsible for the beneficial effects exerted by MSC-Exo. [score:5]
Moreover, the low expression of miR-130 and miR-378 in both MSC-Exo and MSCs found in our study is in line with other reports that high expression of the miR-130 and miR-378 caused K ion channel dysfunction in cardiac stem cell and cardiac hypertrophy [37, 38]. [score:5]
We found that the expression of miR-130, miR-378, and miR-34, which negatively regulate cardiac functions, was relatively low. [score:4]
[1 to 20 of 3 sentences]
9
[+] score: 12
There are also a number of miRNAs such as miR-132, miR-212, miR-130a and miR-152 shown to be upregulated in the pancreatic islets of the wi dely-studied T2D mo del Goto-Kakizaki rats (Esguerra et al., 2011) with active roles in beta cell stimulus-secretion coupling (Malm et al., 2016; Ofori et al., 2017). [score:4]
Expression of miR-200a, miR-130a and miR-152 in INS-1 832/13 cells (A–C) or in EndoC-βH1 cells (D–F) at different confluences. [score:3]
For miR-200a, miR-130a and miR-152, the expression levels were found not to be influenced by cellular confluence (Fig. S2). [score:3]
We also investigated the influence of confluence on the expression levels of miR-200a, miR-130a, miR-152, miR-132 and miR-212. [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 11
In this sense, by virtue of miRNAs known mechanism of action, reducing gene expression by binding to the 3'UTR of their targeted genes, a number of evidenced miRNA species (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) might be involved in turning off the 'neuron projection morphogenesis' process in the SHVT group. [score:5]
Other deregulated biological processes included ‘blood vessel development’ (Mir-155, Mir-17-5p and Mir-130a) (FDR = 6x10 [-4]), 'lung development' (Mir-17-5p and Mir-27a) (FDR = 4x10 [-4]), and ‘cell motion’ (Mir-103) (FDR = 8x10 [-4]) (S3 Table). [score:3]
A heatmap built from nominally significant miRNAs between SHVT and NA detected by sRNA-seq are shown in S3 Fig. When comparing the direct sequencing of the samples with the bioinformatic prediction, 28 miRNA species overlapped, from which Mir-27a, Mir-103, Mir-17-5p, Mir-130a, and Mir-155 were nominally significant although the abundance of the latter was observed to be opposite to the one deduced by GSEA (Table 2). [score:2]
Interestingly, this process was the only one involving all four miRNA species with a consistent abundance among microarray -based predictions and sRNA-seq experiments (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) (FDR<1x10 [-4]) (S3 Table). [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 10
Figure 8Modulation of miR19a, miR23a, miR130a, miR224, miR381 and miR384-5p expression after siAQP4 and siCx43 treatment. [score:3]
Interestingly, even though not significant, miR130a, miR381 and miR384-5p also exhibited decreased expression in the siCx43 -treated animals of 33%, 11% and 14%, respectively. [score:3]
We chose the most conserved miRNAs between species and selected 6 miRNAs: miR19a, miR23a, miR130a, miR224, miR381, and miR384–5p (see Table 1). [score:1]
We chose to study 6 miRNAs, among those most conserved between species: miR19a, miR23a, miR130a, miR224, miR381, and miR384–5p. [score:1]
No significant difference was observed between control and siAQP4 animals for miR130a or miR381. [score:1]
AQP4 Cx43 Homo sapiens Mus musculus Rattus norvegicus Homo sapiens Mus musculus Rattus norvegicus miR19a ● ● ● ● ○ ○ ○ miR23a ● ● ● ● ○ ○ ○ miR130a shown to repress transcriptional activity of AQP4 M1 promoter* ● ● ● miR224 ● ● ● ● miR381 ● ● ● ● miR384-5p ● ● ● ● ○ ○ ○● based on microrna. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 9
Other miRNAs from this paper: rno-mir-130b
As demonstrated by qRT-PCR and Western blot analyses, miR-130b inhibitor upregulated Snail, Vimentin, and Collagen IV, but downregulated E-cadherin, however, miR-130 mimic had the opposite effect. [score:9]
[1 to 20 of 1 sentences]
13
[+] score: 7
Other miRNAs from this paper: rno-mir-130b
miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
let-7, miR-98, miR-130a and miR-16 showed uniform levels of expression in 13 different tissues but were hardly detected in pancreas (Figure 3A). [score:3]
Similarly, let-7, miR-98, miR-16 and miR-130a are abundantly expressed in 13 of the 14 tissues (except in pancreas) (Figure 3A). [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 6
The canonical miRNA of two of these, rno-101a-3p and rno-miR-130a-3p, had a variety of validated mRNA targets (n = 44, Table  3). [score:3]
Among these were one isomiR of rno-miR-130a-3p and one of rno-miR-125b-5p (a miRNA already identified as differentially regulated, Table  1). [score:2]
LA rats Small RNA type and sequence Mean RPM Mean RPM SNL-reg diff-reg (canonical miRNA or RNA type)(sham pools)(SNL pools)subtraction method (SNL/sham fold-change )  HALAHALAHALAHA-LA unique-sequence miRNA isoform (isomiR), all pools, and those added by HA_SNL1 pool exclusion *UAUAGUACUGUGAUAACUGACU (rno-miR-101a-3p)11.79.39.911.3−0.167 (−1.182)0.194 (1.215)−0.361 (0.397)CAGUGCAAUGUUAAAAGGGC (rno-miR-130a-3p) *38.041.948.245.00.237 (1.268)0.071 (1.074)0.166 (0.194)UCCCUGAGACCCUAACUUG (rno-miR-125b-5p) *47.830.435.533.1−0.295 (−1.346)0.085 (1.089)−0.380 (0.435)UGGACGGUGUGAGGCC (sha-miR- 5105) *11.015. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 5
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
From the top twenty miRNAs showing highest expression in A2B5+ GalC− cells, miR-130a, miR-16, miR-17, and miR-20a were also in the top twenty expressed miRNAs from our GPs. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
miR-130a and miR-206 inhibit neurotransmitter substance P (SP) releasing through targeting TAC1 in MSC-derived neuronal cells [27]. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 4
Namely, pregnant rats fed SO and FO diets during the first 12 days of pregnancy showed significant lower expression of miR-449c-5p, miR-134–5p, miR-188, miR-32, miR130a, miR-144–3p, miR-431, miR-142–5p, miR-33, miR-340–5p, miR-301a, miR-30a, miR-106b, and miR-136–5p, as compared with OO, LO, and PO diets. [score:2]
miR-449c-5p, miR-134–5p, miR-130a-3p, and miR-431 expressions was induced after OO compared with other treatments, but at different degrees. [score:2]
[1 to 20 of 2 sentences]
19
[+] score: 4
miR-130a was involved in the regulation of autophagy function in EPCs via targeting Runx3 [13]. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
In fact, these autophagy linked genes’ mRNA includes, the target sequence for miRNAs related to diverse families 5, 6. The gene networks regulating autophagy pathway were determined using a system biology and unrevealed miR-130, miR-98, miR-124, miR-204, and miR-142 as presumed posttranscriptional modulators of this pathway at different levels [6]. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Our study showed that no miRNA was different between males and females in adenoma-free mice, while 3 miRNAs (miR-10a, miR-125, and miR-130a) were differentially expressed in adenoma-bearing male and female mice. [score:3]
In particular, miR-10a is related to estrogen dependent cancer promotion [112, 113], miR-130a both to the estrogen and HER2 pathways [114, 115], and miR-125 to HER2/erbb2 estrogen sensitive oncogene activation [116, 117]. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 4
Other miRNAs from this paper: rno-mir-15b, rno-mir-21, rno-mir-210, rno-mir-1, rno-mir-499, rno-mir-15a
Downregulation of connexin43 by microRNA-130a in cardiomyocytes results in cardiac arrhythmias. [score:4]
[1 to 20 of 1 sentences]
23
[+] score: 3
MiR-221 and miR-130a regulate lung airway and vascular development. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
We found that the expression patterns of most of these miRNAs revealed by qPCR were consistent with deep-sequencing results (Figure 2) with the exception of only four miRNAs (rno-miR-296, rno-miR-93, rno-miR-99b and rno-miR-130a), which exhibited minor discrepancy between qPCR and deep-sequencing results at P0. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
Of the four miRNAs selected for Pik3cb, expression of two, miR-25-3p and miR-130a-3p, was reduced (p < 0.05 and p < 0.001, respectively) in in vitro differentiated adipocytes from LP offspring (Fig.   5). [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 2
Ct values were <30.60 for miR-133b, <27.78 for miR-145, <27.66 for miR-193b, <30.19 for miR-143, <33.69 for miR-335, <23.42 for miR-191, <37.89 for miR-130a, <36.00 for miR-325, <32.04 for miR-1. Reference miRs were: MammU6-4395470 (Ct values < 19.30), snoRNA135-4380912 (Ct values < 33.98), and U87-4386735 (Ct values < 28.32). [score:1]
The results for the other two miRs (miR-130a and miR-325) observed in the microarray were not confirmed with qPCR. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 2
MiR-98, miR-124, miR-130, miR-142, and miR-204, might regulate autophagy [25, 26]. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
A few pri-miRNAs exhibit conservation along the entire length of the pri-miRNA (for example mir-497~195, mir-99b~let-7c~mir-125a, mir-124-2, mir-130a and mmu-mir-568) (Figure 10). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Other miRNAs from this paper: rno-mir-301a, rno-mir-130b, rno-mir-146a, rno-mir-301b
MiRNA-301a (miR-301a) is the member of miR-130/301a family. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
MiRNAs such as miR-16, miR-21, miR-130a [14], and miR-200b [15] have been identified as important in dermal wound healing mo dels. [score:1]
[1 to 20 of 1 sentences]