sort by

33 publications mentioning rno-mir-134

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-134. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 58
Antagomirs targeting miR-134 attenuates LiCl-pilocarpine -induced SE in rats via inhibiting oxidative stress and improving mitochondrial and autophagic functions in hippocampus. [score:5]
As reported, the hippocampal miR-134 level is significantly downregulated in epileptic rat and children (Peng et al., 2013), while silencing of miR-134 could delay seizure onset, and reduce seizure severity, Racine score and mortality of epilepsy animals (Jimenez-Mateos et al., 2012; Jimenez-Mateos et al., 2015). [score:4]
However, we did not find any direct target of miR-134 in the autophagic system. [score:4]
Expression patterns of miR-124, miR-134, miR-132, and miR-21 in an immature rat mo del and children with mesial temporal lobe epilepsy. [score:3]
Antagomirs targeting microRNA-134 increase hippocampal pyramidal neuron spine volume in vivo and protect against pilocarpine -induced status epilepticus. [score:3]
Inhibition of miR-134 protects against hydrogen peroxide -induced apoptosis in retinal ganglion cells. [score:3]
Previous research reveals the anti-oxidation ability of Ant-134 in H [2]O [2] -induced retinal ganglion cells, and shows the target of miR-134 is the cyclic AMP-response element -binding protein (CREB) (Shao et al., 2015). [score:3]
A total of 103 rats were randomly divided into four groups: control group (Con, n = 18), status epilepticus (SE) group (SE, n = 30), scramble antagomirs sequence group (Scr, n = 30), and antagomir targeting miR-134 group (Ant-134, n = 25). [score:3]
miR-134 regulates ischemia/reperfusion injury -induced neuronal cell death by regulating CREB signaling. [score:3]
Silencing microRNA-134 produces neuroprotective and prolonged seizure-suppressive effects. [score:3]
It is demonstrated that miR-134 could regulate a mitochondrial-apoptosis -associated protein Bcl-2 (Huang et al., 2015; Shao et al., 2015), indicating miR-134 may participate in the regulation of mitochondrial functions, which has not been reported yet. [score:3]
Silencing miR-134 using Ant-134 attenuated MFS in the dentate gyrus, inhibited neuron death in the CA1 region and improved the cognitive function of SE rats. [score:3]
We first detected the mRNA expression of miR-134 in hippocampal tissues of SE rats at day 3 after LiCl-pilocarpine injection. [score:3]
The present study demonstrates that silencing of miR-134 significantly attenuates oxidative stress in the hippocampus, suggesting miR-134 may contribute to the oxidative stress in the development of epilepsy. [score:2]
A novel pathway regulates memory and plasticity via SIRT1 and miR-134. [score:2]
Studies reveal miR-134 is involved in the control of synaptic protein synthesis and plasticity, and thus in the regulation of learning and memory (Gao et al., 2010; Bicker et al., 2013). [score:2]
like previous studies (Jimenez-Mateos et al., 2012, 2015), real-time quantitative PCR analysis showed the hippocampal miR-134 level was significantly increased in the LiCl-pilocarpine -induced SE rats (Figure 1A). [score:1]
Nevertheless, these changes were effectively restored by the silencing of miR-134 with Ant-134. [score:1]
Here we extend the knowledge of miR-134 silencing to its effects on dentate gyrus and CA1 neurons but we did not reveal the detailed molecular targets of miR-134, which will be investigated in the future. [score:1]
However, it should be further studied whether the epileptic hippocampal miR-134 shares the same signaling pathway with the retinal miR-134. [score:1]
In the brain, miR-134 is localized in the synapto-dendritic compartment of hippocampal neurons (Schratt et al., 2006). [score:1]
Mechanically, miR-134 blockage could reduce the density of pyramidal neuron spine in the CA3 region, enlarge its volume and decrease neuronal death. [score:1]
The DEAH-box helicase DHX36 mediates dendritic localization of the neuronal precursor-microRNA-134. [score:1]
FIGURE 3Silencing miR-134 attenuated neuronal death in hippocampus of SE rats. [score:1]
The present study indicates silencing of miR-134 protects the hippocampus from oxidative damage and improves mitochondrial functions. [score:1]
[1 to 20 of 25 sentences]
2
[+] score: 27
Based on functional and pathway analysis and related literature examination, we selected miR-134-5p, miR-207, and miR-465-5p to represent the up-regulated miRNAs, and miR-30b-5p, miR-19a-3p, and miR-130a-3p to represent the down-regulated miRNAs. [score:7]
Additionally, miR-134 was found to be significantly down-regulated in A549/cisplatin multidrug resistance lung adenocarcinoma cells, and its expression levels modulate the proliferation, apoptosis, and invasion of lung adenocarcinoma cells (Li et al., 2017). [score:6]
Among these DEmiRNAs, 6 up- or down-regulated miRNAs were chosen for further analysis, including miR-134-5p, miR-207, miR-465-5p, miR-30b-5p, miR-19a-3p, and miR-130a-3p. [score:4]
The DEmiRNAs (e. g., miR-134-5p, miR-207, miR-465-5p, miR-30b-5p, miR-19a-3p, and miR-130a-3p) and common target genes, such as Chst1 and Nrbf2, may be strongly associated with the pulmonary inflammation induced by ZnO-NPs. [score:3]
In our network, Chst1 (carbohydrate sulfotransferase 1) is regulated by four miRNAs, including miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-134-5p, while Nrbf2 (nuclear receptor binding factor 2) is regulated by miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-207. [score:3]
MicroRNA-134 reverses multidrug resistance in human lung adenocarcinoma cells by targeting FOXM1. [score:2]
Chst1 is modulated by four miRNAs, including miR-30b-5p, miR-19a-3p, miR-130a-3p, and miR-134-5p. [score:1]
Finally, Scn9a is modulated by miR-30b-5p, miR-130a-3p, miR-134-5p, and miR-465-5p. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 26
However, repeated EA treatment could relieve the upregulation of miR-134 expression in hippocampal CA1 area. [score:6]
This effect is mediated by miR-134 inhibition of the translation of LIMK1 mRNA [47]. [score:5]
EA Regulated miR-134 Expression in Hippocampal CA1 in MICD Rats. [score:4]
The present study showed that the expression of miR-134 was obviously increased in the MICD rats. [score:3]
As shown in Figure 7, the expression of miR-134 was significantly increased in the MICD group compared with the Sham group (p < 0.01). [score:2]
Furthermore, the mechanism of LIMK1 increase induced by EA treatment may be associated with miR-134, which is localized in hippocampal CA1, by negatively regulating LIMK1 to enhance synaptic-dendritic plasticity in the recovery stage of ischemic stroke. [score:2]
However, repeated EA treatment significantly decreased the expression of miR-134 compared with the MICD group and the MICD+non-EA group (p < 0.05). [score:2]
miR-134 is the first discovered dendritic microRNA, enriched in the neuronal dendrites of rat hippocampal neurons, and negatively controls the size of dendritic spines [46]. [score:1]
To identify the role of synaptic-dendrite-related miR-134 in hippocampus CA1, the levels were detected. [score:1]
[1 to 20 of 9 sentences]
4
[+] score: 24
As well characterized examples, miR-9 has been shown to regulate embryonic neurogenesis by targeting the transcription factor TLX [8]; miR-219 [9] and miR-338 [10] have been identified as regulators of oligodendrocyte differentiation; miR-124 have been shown to promote neuronal differentiation and regulate adult neurogenesis [11, 12]; and miR-134 have been shown to regulate dendritic spine morphology through inhibiting the local translation of Limk1 [13]. [score:9]
The expression level of one extensively studied miRNA rno-miR-134, which plays important roles in regulation of embryonic stem cell differentiation and synapse plasticity [28- 30], was used as a relative standard to judge the abundance of detected miRNAs. [score:4]
As positive control, the expression of three known miRNAs, miR-134, miR-124, and the newly identified miR-344b-5p, was significantly reduced in Dicer knockout brain. [score:4]
C. Expression level of three known miRNAs, miR-344b-3p, miR-124, and miR-134, in P0 cortical tissue of wide type and Dicer knockout mice revealed by qPCR. [score:4]
The expression levels of rno-miR-134 in our samples were 350.10 and 326.51 TPM at E13 and P14, respectively, and were less than 300 TPM at other stages. [score:3]
[1 to 20 of 5 sentences]
5
[+] score: 21
To assess whether cocaine induced long-lasting changes in the expression level of striatal miRNAs that are important for synaptic plasticity, we analyzed the expression pattern of miR-124, miR-132, miR-134, and miR-212 after 14 days of the SA of the drug and after the 10-day extinction training (Table 2). [score:5]
Recent studies revealed that Pum2 mRNA is a direct target of miR-134 [14] and metabolic stress, which recruits Pum2 into stress granules (SGs) [25]. [score:4]
Consistent with the above findings, in this study, we analyzed the expression of miR-124, miR-132, miR-134, and miR-212, as well as the levels of the Ago2, Pum2, and REST mRNAs and proteins following cocaine self-administration (SA) and its withdrawal with using extinction training (neither cocaine delivery nor the presentation of the conditioned stimulus) in rats. [score:3]
As uncovered by Fiore et al., miR-134 may regulate protein synthesis by regulating RNA binding protein Pumilio-2 (Pum2) [14], while other studies have suggested that miR-134 interacts with PUM2 buffering PUM2 protein levels that may be crucial for maintenance of LTP [5, 15]. [score:3]
Another brain-specific miRNA is miR-134 that overexpression disturbs synaptic growth accompanying synaptic plasticity [8]. [score:3]
The expression levels of miR-124 and miR-134 did not exceed the 1.3-fold cutoff threshold in the cocaine SA-1 rats and the YC-1 group compared to the YS-1 group or in the rats that underwent extinction training following cocaine SA-2 or YC-2 versus YS-2. Therefore, these miRNAs were excluded from the subsequent analyses. [score:2]
Recently, it was demonstrated that four miRNAs (miR-124, miR-132, miR-134, and miR-212) are especially important for neuronal function, plasticity, and/or substance use disorder. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 21
For example, miR-134 regulates LimK1 at the spine by stimulation of BDNF [19], miR-138 regulates palmitoylation in neurons by inhibiting the translation of LYPLA [16], [18], miR-132 targets p250GAP to enhance spine growth [20] and the FMRP associated miRNA, miR-125b blocks the translation of NR2B resulting in neuronal structural changes [21]. [score:11]
On the other hand, miR-134, miR-138 and miR-34b showed bigger changes in the expression of their primary transcripts than their mature forms (Figure 5F to H). [score:3]
In mouse, the deacetylase SIRT1 modulates learning and synaptic plasticity via miR-134, which represses translation of BDNF and CREB [14], [19]. [score:3]
Recently, it was also shown that miR-134 regulates learning and memory in a mouse mo del [14]. [score:2]
Especially, in the case of miR-134, about 20% of the mature form decreased in 24 hours after contextual conditioning, but 80% of primary transcript was decreased at the same time point. [score:1]
We have also noticed that miRNAs previously detected in neurites such as miR-134, miR-25 and miR-26a showed changes at 24 h after contextual conditioning [17], [19]. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 14
More recently, hippocampus-expressed miRNAs such as miR-134 and miR-34 have been shown to target the deacetylase sirtuin-1 (SIRT1) and thereby influence learning and memory processes (Gao et al., 2010; Zovoilis et al., 2011). [score:5]
This action of miR-134 occurs through its inhibitory action on lim1 kinase expression. [score:5]
Schratt et al. found that the brain-specific miRNA, miR-134, is localized to the synaptodendritic compartment and negatively regulates the size of dendritic spines (Schratt et al., 2006). [score:2]
A novel pathway regulates memory and plasticity via SIRT1 and miR-134. [score:2]
[1 to 20 of 4 sentences]
8
[+] score: 14
B13 cells that were transduced with Ad-PNM showed upregulation of 6 miRNAs (miR-134-5p, miR-455-3p, miR-384-5p, miR-137-3p, miR-135a-5p and miR-22-5p) and downregulation of 2 miRNAs (miR-335-3p and miR-148a-5p). [score:7]
Among the upregulated miRNAs, miR-134 and miR-22 were identified. [score:4]
Moreover, miR-134 represses several components of a network that controls pluripotency in its targeting of Nanog, Oct4 and Sox2 [46]. [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 14
The brain-specific miR-134 regulates dendritic spine development by repressing the translation of an mRNA encoding a protein kinase, Limk1, that controls spine development [21], while the brain-enriched miR-137 has a significant role in neuronal maturation and dendritic morphogenesis via direct targeting of Mib1, a ubiquitin ligase important for neurogenesis and neurodevelopment [22]. [score:10]
For example, miR-134 and miR-137 regulate neuronal maturation through the modulation of their target mRNA. [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 10
For example, miR-134 is a brain-specific miRNA that can negatively regulate the size of dendritic spines of rat hippocampal neurons via mediating limk1 expression [19]. [score:4]
Silencing miR-134 expression in hippocampus in vivo reduces the prolonged seizures in mice [20]. [score:3]
Some miRNAs which have been previously reported to be involved in brain disorders and drug abuse, including miR-133b, miR-134, miR-181c, miR-191, miR-22, miR-26b, miR-382, miR-409-3p and miR-504, were found to be changed in their expression following repeated cocaine exposure and subsequent abstinence from cocaine treatment. [score:3]
[1 to 20 of 3 sentences]
11
[+] score: 10
In the time course of downregulation, miR-10a, -98, -99, and -124a showed a long duration (~24 hr) of downregulation, while miR-134 nearly fully recovered by this time (P > 0.05 compared to the basal level). [score:6]
To support the above observations, we tailed miR-134 and -143 LNA probes with digoxigenin-dUTP and viewed miRNA signal in in situ hybridization with a colorimetric method, which in general produces better cellular morphology. [score:1]
Figure 3 miR-134 level in the ispi- and contralateral TG. [score:1]
Glial cells and other nonneuronal cells in TG did not show detectable miR-134. [score:1]
The LNA probe of miR-134 was tailed by digoxigenin-dUTP, and visualized by a detection kit (Roche). [score:1]
[1 to 20 of 5 sentences]
12
[+] score: 9
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-125b-2, rno-mir-146a, rno-mir-155
Expression profiling studies had detected miR-134 among up-regulated miRNAs in mo dels of SE in mice [46] and in epileptic rats [47]. [score:6]
More detailed studies showed that miR-134 induction occurred in regions of the hippocampus that were damaged by seizures as well as in less-injured neuronal populations [42]. [score:1]
miR-134 was discovered as a brain-specific miRNA [45]. [score:1]
Functional studies employing antagomirs have identified that silencing miR-134 potently reduced SE, seizure-damage and the later occurrence of spontaneous seizures [42]. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 8
The results of the qPCR experiments (Fig. 5) show a large increase of miR-29a, -29b, -29c, -1, -194, -195, -347 and a decrease of miR-134 expression during early postnatal development in muscular type vasculature corroborating the microarray data. [score:4]
We ended up with 4,311, 4,687, 4,221, 4,961, 4,263, 3,662, 3,692, and 3665 putative target genes for miR-134, -1, -194, -195, -347, -29a, - 29b and -29c, respectively (Fig. 4). [score:3]
Thus, we performed qPCR experiments for 8 potential candidate miRNAs: miR-134, -1, -194, -195, -347, -29a, -29b and -29c. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 8
MicroRNA miR-134 targeting WWOX expression is associated with head and neck carcinogenesis [95]. [score:5]
Liu CJ Shen WG Peng SY Cheng HW Kao SY Lin SC Chang KW miR-134 induces oncogenicity and metastasis in head and neck carcinoma through targeting WWOX geneInt J Cancer 2013 96. [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 7
Other microRNAs to have been reported to be related to depression are miR-34 acting as a regulator of CRF signaling, miR-134 and miR-124a levels were significantly downregulated after treatment with duloxetine and miR-144 was found to have an increased expression in both lithium- and valproate -treated animals (Haramati et al., 2011; Hansen and Obrietan, 2013; Pan and Liu, 2015). [score:7]
[1 to 20 of 1 sentences]
16
[+] score: 7
a The relative expression level of miR-134, miR-155, miR-30c and miR-630 in breast cancer cells respectively was detected by qRT-PCR. [score:3]
The relative expression level of miR-134, miR-155, miR-30c and miR-630 in breast cancer cells respectively was detected by qRT-PCR. [score:3]
We used miRwalk database to identify potential miRNAs that bind to 3′ UTR of CTHRC1 and identified miR-134, miR-155, miR-30c and miR-630 as possible candidates (Additional file 4: Figure S2A). [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 7
miR-448, let-7b, miR-540, miR-296, miR-880, miR-200a, miR-500, miR-10b, miR-336, miR-30d, miR-208, let-7e, miR-142-5p, miR-874, miR-375, miR-879, miR-501, and miR-188 were upregulated, while miR-301b, miR-134, and miR-652 were downregulated in TMH group (Table 5). [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 6
The exact function of miRNA-134 upregulation in the stimulated astrocytes needs further research. [score:4]
MiRNA-134 silencing exerts prolonged seizure suppressant and neuroprotective actions [34]. [score:2]
[1 to 20 of 2 sentences]
19
[+] score: 6
Additionally, another evidence collected from the current inverstigation demonstrate that the microRNA -mediated regulation is not limited to the 3’UTR, the functionality of target sites in the CDS also confirmed by previous studies [57– 59], such as miR-24 [58], miR-296, miR-470, miR-134 [60], miR-126 [43], miR-181a [59], miR-148 [57] and miR-519 [61] that target sequences within the mRNA coding region have been reported to repress the biosynthesis of the encoded proteins in similar way. [score:6]
[1 to 20 of 1 sentences]
20
[+] score: 6
In a recent paper, Henshall et al. reported that miR-134, a miRNA implicated in the control of dendritic spine morphology, was up-regulated in a mouse mo del of status epilepticus, and silencing of miR-134 expression reduced neurone dendrite spine density and rendered mice refractory to seizures [10]. [score:6]
[1 to 20 of 1 sentences]
21
[+] score: 5
The expression of Arc -targeting miRNAs was not significantly different from that of the previously described dendritic miRNAs, miR-132 and miR-134. [score:5]
[1 to 20 of 1 sentences]
22
[+] score: 5
miR-134 regulates SIRT1 via post-transcriptional regulation of cAMP response binding protein (CREB) expression in brain [22]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
Further, translation of mRNA in biochemically isolated synapses has been shown to be regulated by miR-134-5p [17]. [score:4]
[1 to 20 of 1 sentences]
24
[+] score: 4
miR-449c-5p, miR-134–5p, miR-130a-3p, and miR-431 expressions was induced after OO compared with other treatments, but at different degrees. [score:2]
Namely, pregnant rats fed SO and FO diets during the first 12 days of pregnancy showed significant lower expression of miR-449c-5p, miR-134–5p, miR-188, miR-32, miR130a, miR-144–3p, miR-431, miR-142–5p, miR-33, miR-340–5p, miR-301a, miR-30a, miR-106b, and miR-136–5p, as compared with OO, LO, and PO diets. [score:2]
[1 to 20 of 2 sentences]
25
[+] score: 3
Silencing microRNA-134 produces neuroprotective and prolonged seizure-suppressive effects. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
CYP11A1, the gene encoding cholesterol side-chain cleavage enzyme (P450scc), was predicted to be the target gene of miRNA-134. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 2
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ hybridization and immunostaining In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 2
A novel pathway regulates memory and plasticity via SIRT1 and miR-134. [score:2]
[1 to 20 of 1 sentences]
29
[+] score: 2
In the hippocampus, miR-134 regulates the size of dendritic spines, sites of synaptic transmission [42]. [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 1
MiR-128, miR-132, miR-134, and miR-138 have also been shown to be involved in NSC maturation and dendritic spine morphogenesis [17]. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
Other families that had a high abundance of reads were miR-134, miR-136, miR-154, miR-370, miR-412, miR-431, miR-432, miR-433, miR-485, miR-493, miR-541; a total of 11 miRNA families. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
On the other hand, the response of certain miRNAs (e. g. miR-146 and miR-134) following SE contrasts with results from other studies, probably due to specificities of the H-PILO or technical limitations inherent in the use of a large-scale experimental approach. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
A study from 2013 proposed members of the miR-132 and miR-134 families as biomarkers for the detection of mild cognitive impairment (MCI) [41]. [score:1]
[1 to 20 of 1 sentences]