sort by

53 publications mentioning rno-mir-143

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-143. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 340
Other miRNAs from this paper: rno-mir-93, rno-mir-96, rno-mir-206, rno-mir-155
The present study demonstrated that SNL -induced downregulation of DRG miR-143 contributed to SNL -induced pain hypersensitivities through post-transcriptional disinhibition of Dnmt3a expression, resulting in its upregulation and subsequent downregulation of its downstream target Oprm1 mRNA, in the injured DRG. [score:16]
As expected, the miR-143 inhibitors, but bot the inhibitor negative control, produced the decreases not only in the expression of miR-143 (n = 3 repeats, P < 0.01) but also in the expression of Oprm1 mRNA (n = 3 repeats, P < 0.01), although the inhibitor did not affect relative expression of Dnmt3a mRNA in the AAV5-GFP-tranduced DRG neurons (Figure 3F). [score:13]
These findings suggest that miR-143 directly and negatively regulates post-transcriptional expression of Dnmt3a mRNA, resulting in Dnmt3 protein downregulation and subsequently disinhibition of the downstream Oprm1 mRNA expression in the DRG neurons. [score:12]
Effect of rescuing miR-143 expression on SNL -induced upregulation of Dnmt3a mRNA and downregulation of Oprm1 mRNA in rat DRG. [score:9]
Figure 2miR-143 knockdown caused by of miR143 inhibitors increased the expression of Dnmt3a and reduced the expression of Oprm1 mRNA and MOR in the injected DRG of naive rats. [score:8]
These findings suggest that miR-143 negatively and post-transcriptionally regulates the expression of Dnmt3a through binding to the 3′-UTR of Dnmt3a mRNA and suppressing Dnmt3a mRNA translation in the DRG. [score:8]
The present study showed that SNL -induced downregulation of miR-143 was also required for SNL -induced upregulation of Dnmt3a in the injured DRG. [score:7]
Our in vitro and in vivo experiments revealed that either miR-143 mimics or its inhibitors did not affect the expression of Dnmt3a mRNA, but altered the expression of Dnmt3a protein in the DRG neurons. [score:7]
Ectopic expression of miR-143 in breast cancer cells or restoring expression of miR-143 in colorectal cancer cell lines repressed the Dnmt3a expression at both mRNA and protein levels (Ng et al., 2009, 2014). [score:7]
To define the role of miR-143 in SNL -induced upregulation of Dnmt3a mRNA and its encoding Dnmt3a protein in the ipsilateral DRG, we first examined whether miR-143 expression was altered in the DRG after SNL. [score:6]
Therefore, miR-143 is implicated in neuropathic pain likely through regulating the expression of multiple targeting genes in the DRG. [score:6]
Given that both miR-143 and Dnmt3a are expressed in the DRG neurons (Tam et al., 2011; Zhao et al., 2017), we proposed that miRA-143 might be involved in nerve injury -induced upregulation of Dnmt3a in the DRG under neuropathic pain conditions. [score:6]
Group Functional test Placing Grasping Righting Vehicle + Sham 5 (0) 5 (0) 5 (0) Vehicle + SNL 5 (0) 5 (0) 5 (0) NC + SNL 5 (0) 5 (0) 5 (0) miR-143 + Sham 5 (0) 5 (0) 5 (0) miR-143 + SNL 5 (0) 5 (0) 5 (0) Vehicle 5 (0) 5 (0) 5 (0) miR-143 inhibitors 5 (0) 5 (0) 5 (0) Inhibitor NC 5 (0) 5 (0) 5 (0) n = 5 rats/group. [score:5]
Interestingly, microinjection of miR-143 inhibitors did not alter relative expression of Dnmt3a mRNA in the injected DRG on day 5 post-microinjection (n = 6 rats. [score:5]
Chemically modified antisense RNA molecules that optimized to specifically target endogenous miR-143 were used as miR-143 inhibitors. [score:5]
The miR-143 inhibitors -induced reduction in Oprm1 mRNA was completely reversed by co-administration of AAV5 expressing Dnmt3a shRNA (sh3a). [score:5]
Next, we determined whether mimicking the SNL -induced decrease in DRG miR-143 through microinjection of miR-143 inhibitors into unilateral L4/5 DRGs affected relative expression of Dnmt3a mRNA, Oprm1 mRNA, Dnmt3a, and MOR in the injected DRGs of naive rats. [score:5]
Inh143, miR-143 inhibitors; Inh NC, inhibitor negative control; Veh, vehicle. [score:5]
miR-143 mimics at the dose injected could not further reduce basal level of Dnmt3a expression in the sham rats, despite the fact that miR-143 mimics at this dose markedly blocked the SNL -induced increase in Dnmt3a expression in the injured DRG. [score:5]
Nevertheless, miR-143 overexpression by its mimics may cause side effects as miR-143 has multiple downstream targets as discussed above. [score:5]
Given that miR-143 is likely a negative regulator in DRG Dnmt3a expression under neuropathic pain conditions and that Dnmt3a acts as an endogenous contributor to neuropathic pain genesis (Sun L. et al., 2017; Zhao et al., 2017), we proposed that SNL -induced reduction of DRG miR-143 might participate in the development of SNL -induced pain hypersensitivities. [score:5]
miR, microRNA; NC, negative control; Veh, vehicle; (A,B) Transfection of miR-143 mimics (but not negative control) increased the expression of miR-143 (A) and Oprm1 mRNA (B) and had no effect on the expression of Dnmt3a mRNA in the cultured DRG neurons. [score:5]
Moreover, besides Dnmt3a, miR-143 may potentially and post-transcriptionally inhibit the expression of other genes. [score:5]
Inh143, miR-143 inhibitors; Inh NC, inhibitor negative control; Veh, vehicle; n = 5 rats/group. [score:5]
No effect of miR-143 mimics on in vivo Dnmt3a expression may be due to the low level of Dnmt3a expression in the DRG under normal conditions. [score:5]
The in vivo work described above could not tell whether miR-143 directly regulated the expression of Dnmt3a and MOR in the DRG neurons. [score:5]
Expression of Dnmt3a and MOR regulated directly by miR-143 in DRG neurons. [score:5]
It is worth noting that, in addition to OCT1 and miR143, whether additional transcription factors and/or microRNAs are involved in nerve injury -induced upregulation of DRG Dnmt3a remains to be determined. [score:4]
Microinjection of miR-143 inhibitors, but not the miR-143 inhibitor negative control, reduced the ratios of ipsilateral-side to contralateral-side of miR-143 by 57% (n = 6 rats, P < 0.01) and of Oprm1 mRNA by 22% (n = 6 rats, P < 0.05) as compared to the corresponding vehicle -injected groups (n = 6 rats) on day 5 post-injection (Figure 2A). [score:4]
MicroRNA-143 is downregulated in breast cancer and regulates DNA methyltransferases 3A in breast cancer cells. [score:4]
In summary, our study revealed that miR-143 downregulation participated in a Dnmt3a-triggered epigenetic mechanism of Oprm1 mRNA decrease in the injured DRG under neuropathic pain conditions. [score:4]
Figure 1Rescuing miR-143 downregulation blocked the SNL -induced increase in Dnmt3a and restored the SNL -induced decreases in Oprm1 mRNA and MOR in injured dorsal root ganglia (DRG). [score:4]
In the present study, we demonstrated that this increase was attributed at least in part to peripheral nerve injury -induced downregulation of miR-143 in the DRG. [score:4]
Figure 6miR-143 knockdown caused by of miR-143 inhibitors produced neuropathic pain-like symptoms in naive rats. [score:4]
The wild-type (WT) sequence of the rat Dnmt3a 3′-UTR containing the miR-143 binding site (186–192) was amplified from rat DRG cDNA using forward and reverse primers as shown in Table 1. To create the pmirGLO-Luc- Dnmt3a 3′-UTR WT vector, the resulting PCR fragment was cloned into the pmirGLO dual-luciferase miRNA target expression vector (Promega) using the XhoI and XbaI restriction sites (Promega). [score:4]
Chemically synthesized rat miR-143 mimics were used for the up-regulation of miR-143. [score:4]
Given that Dnmt3a and Oprm1 are key players in neuropathic pain development (Sun L. et al., 2017; Zhao et al., 2017) and that miR-143 mimics impaired this disorder without changing locomotor function and acute pain, miR-143 may be a target for neuropathic pain management. [score:4]
Finally, we determined whether Dnmt3a was required for miR-143 regulation of the expression of Oprm1 mRNA in the DRG neurons. [score:4]
Taken together, these findings further demonstrated the implication of miR-143 in nerve injury -induced MOR downregulation in the ipsilateral DRG. [score:4]
However, transfection of miR-143 mimics into the cultured DRG neurons significantly reduced the expression of Dnmt3a. [score:3]
To further examine whether SNL -induced reduction of miR-143 was involved in the increases of Dnmt3a mRNA and Dnmt3a in the ipsilateral L5 DRG, we aimed to rescue miR-143 expression through microinjection of miR143 mimics into the ipsilateral L5 DRG. [score:3]
Interestingly, miR-143 in the breast and colorectal cancer tissues affected the Dnmt3a expression at both mRNA and protein levels (Ng et al., 2009, 2014). [score:3]
Figure 5Rescuing DRG miR-143 expression alleviated central sensitization in spinal dorsal horn. [score:3]
Figure 7Rescuing DRG miR-143 expression improved morphine analgesia under neuropathic pain conditions. [score:3]
Moreover, Dnmt3a was demonstrated to be a direct target of miR-143 by luciferase reporter assay (Ng et al., 2009, 2014). [score:3]
Rat miR-143 mimics, inhibitors and their NCs were packed by TurboFect in vivo transfection reagent (Thermo Scientific Inc. [score:3]
The miR-143 inhibitor negative control was used as a control. [score:3]
No significant changes in basal paw withdrawal responses to mechanical and thermal stimuli on the contralateral side (Figures 6D,E) and locomotor function (Table 2) were seen in the rats microinjected with miR-143 inhibitors. [score:3]
To address our proposal, we examined the effect of rescuing miR-143 expression in the ipsilateral DRG on SNL -induced mechanical allodynia, thermal hyperalgesia, and cold allodynia. [score:3]
The reason why miR-143 had distinct effects on Dnmt3a mRNA expression between the present study and the previous reports (Ng et al., 2009, 2014) is unknown but may be related to the tissue difference. [score:3]
Microinjection of miR-143 inhibitors also produced thermal hyperalgesia and cold allodynia as evidenced by ipsilateral decreases in paw withdrawal latencies in response to heat stimulation (n = 5 rats, P < 0.01. [score:3]
We also noticed that of miR-143 mimics did not alter relative expression of Dnmt3a in sham rats. [score:3]
Using in silico predictions, Dnmt3a was defined as a potential target of miR-143 (Ng et al., 2009). [score:3]
Effect of mimicking the SNL -induced decrease in miR-143 on relative expression of Dnmt3a and Oprm1 mRNAs and Dnmt3a and MOR proteins in the DRG. [score:3]
Neither SNL nor sham surgery affected relative expression of miR-143 in the ipsilateral and contralateral L4 DRG during the observation period (data not shown). [score:3]
Effect of rescuing DRG miR-143 expression on SNL -induced pain hypersensitivities. [score:3]
This finding, combined with our in vivo observations above, suggests the post-transcriptional inhibition of Dnmt3a mRNA occurred in the presence of miR-143. [score:3]
We first examined whether miR-143 truly affected the expression of Dnmt3a and MOR in the cultured DRG neurons. [score:3]
Mimicking SNL -induced decrease in DRG miR-143 through microinjection of miR-143 inhibitors into the unilateral L4/5 DRGs led to mechanical allodynia as demonstrated by ipsilateral decrease in paw withdrawal threshold in responses to mechanical stimulation (n = 5 rats, P < 0.01. [score:3]
Effect of rescuing DRG miR-143 expression on morphine analgesia after SNL. [score:3]
Finally, we examined whether rescuing DRG miR-143 expression improved morphine analgesia under SNL -induced neuropathic pain conditions. [score:3]
As expected, microinjection of neither vehicle nor miR-143 inhibitor negative control markedly altered baselines in the response to mechanical, thermal, and cold stimuli on both ipsilateral and contralateral sides (Figures 6A–E) and locomotor function (Table 2). [score:3]
Figure 4Rescuing DRG miR-143 expression impaired neuropathic pain. [score:3]
miR, microRNA; NC, negative control; SNL, spinal nerve ligation; Veh, vehicle; Microinjection of miR-143 mimics, but not negative control, into the ipsilateral L5 DRG significantly attenuated SNL -induced increases in the levels of phosphorylated extracellular signal-regulated kinases ½ (p-ERK1/2) and glial fibrillary acidic protein (GFAP) in the ipsilateral L5 dorsal horn on day 7 post-SNL. [score:2]
MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer. [score:2]
In addition, microinjection of miR-143 inhibitors decreased the amount of MOR by 37% (n = 6 rats, P < 0.01) compared to the vehicle -treated group in the injected DRGs on day 5 post-microinjection (Figures 2B,C). [score:2]
MicroRNA-143 expression in dorsal root ganglion neurons. [score:2]
To further test this conclusion, we then carried out luciferase reporter assay and found that the transfection of miR-143 mimics significantly reduced the translational activity in the 3′-UTR of Dnmt3a mRNA containing the miR-143 binding site (n = 3 repeats, P < 0.01), but not in the mutant 3′-UTR of Dnmt3a mRNA, in which the miR-143 binding site was mutated (Figure 3E). [score:2]
We also examined whether microinjection of miR-143 mimics altered SNL -induced dorsal horn central sensitization indicated by the increases in phosphorylated-extracellular signal–regulated kinase 1/2 (p-ERK1/2) and glial fibrillary acidic protein (GFAP) in dorsal horn (Latremoliere and Woolf, 2009; Zhang et al., 2016). [score:2]
Microinjection of miR-143 mimics rescued the miR-143 expression demonstrated by a marked increase in the level of miR-143 in the ipsilateral L5 DRG on day 7 post-SNL (n = 6 rats, P < 0.01) as compared to the vehicle -treated sham rats (n = 6 rats) or SNL rats microinjected with vehicle or NC (Figure 1B). [score:2]
The mutant (MU) fragment contains three mutations in the “seed sequence” of the miR-143 binding site, which was synthesized using designed primers (Table 1) via overlap extension PCR and created a pmirGLO-Luc- Dnmt3a 3′-UTR MU vector. [score:1]
miR, microRNA; NC, negative control; SNL, spinal nerve ligation; Veh, vehicle; Microinjection of miR-143 mimics, but not negative control, into the ipsilateral L5 DRG significantly attenuated SNL -induced decreases in paw withdrawal threshold in response to mechanical stimulation (A), in paw withdrawal latency in response to thermal stimulation (B) and in paw withdrawal jump latency in response to cold stimulation (C) on the ipsilateral side on days 3, 5, and 7 after SNL. [score:1]
SNL time -dependently reduced the level of miR-143 in the L5 DRG on the ipsilateral, but not contralateral, side of rats (Figure 1A). [score:1]
the miR-143 mimics plus SNL plus saline group at the corresponding time point. [score:1]
Additionally, in line with our observations in Figure 4C, microinjection of miR-143 mimics into the ipsilateral L5 DRG significantly reversed the SNL -induced decrease in paw withdrawal latency in response to thermal stimulation on the ipsilateral side following intraperitoneal saline injection (n = 5 rats, P < 0.05. [score:1]
Microinjection of neither miR-143 mimics, negative control, nor vehicle altered basal paw responses on the contralateral side (Figures 4D,E) and locomotor function (Table 2). [score:1]
As expected, the level of miR-143 was significantly decreased in the ipsilateral L5 DRG on day 7 post-SNL in the rats microinjected with vehicle (n = 6 rats, P < 0.05. [score:1]
miR-143 likely participates in the mechanisms that underlie neuropathic pain. [score:1]
Effect of mimicking the SNL -induced decrease in DRG miR-143 on basal nociceptive thresholds in naive rats. [score:1]
The cycle parameters for miR-143 and U6 were as follows: 15 min incubation at 95°C, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. [score:1]
As expected, sham surgery did not lead to any changes in basal levels of miR-143 in either ipsilateral or contralateral L5 DRG (Figure 1A). [score:1]
Figure 1B) or NC (n = 6 rats, P < 0.05; Figure 1B) and increased in the ipsilateral L5 DRG on day 7 post-sham surgery in the rats microinjected with miR-143 mimics (n = 6 rats, P < 0.01; Figure 1B). [score:1]
We further determined whether the SNL -induced decrease in DRG miR-143 was sufficient for SNL -induced pain hypersensitivities. [score:1]
Microinjection of miR-143 mimics did not change paw responses to mechanical, heat, or cold stimuli on the ipsilateral side of sham rats (n = 5 rats. [score:1]
Figures 4A–C), but microinjection of miR-143 mimics abolished SNL -induced mechanical allodynia, thermal hyperalgesia, and cold allodynia (Figures 4A–C). [score:1]
The transfection of miR-143 mimics increased the levels of miR-143 and Oprm1 mRNA, respectively, by 1,965-flod (n = 3 repeats, P < 0.01. [score:1]
This reduction was reversed markedly on the ipsilateral side of miR-143 mimics-microinjected rats (n = 5 rats, P < 0.05), but not in negative control -treated rats (n = 5 rats. [score:1]
Neither miR-143 mimics nor negative control altered paw responses to mechanical (D) and thermal (E) stimuli on the contralateral side. [score:1]
As expected, microinjection of miR-143 negative control did not affect SNL -induced mechanical allodynia, thermal hyperalgesia, and cold allodynia on the ipsilateral side during the observation period (n = 5 rats. [score:1]
No changes in paw responses were seen on either ipsilateral or contralateral side in sham rats microinjected with vehicle or miR-143 mimics. [score:1]
Given that nerve injury -induced epigenetic silencing of Oprm1 mRNA was controlled by Dnmt3a in the DRG (Sun L. et al., 2017), the effects of microinjection of miR-143 mimics on SNL -induced decreases in DRG Oprm1 mRNA and MOR were also observed. [score:1]
miR, microRNA; MOR, mu opioid receptor; NC, negative control; SNL, spinal nerve ligation, Veh, vehicle, (A) miR-143 decreased in the ipsilateral, but not contralateral, L5 DRG on days 3 and 7 after SNL, but not sham surgery. [score:1]
These increases were significantly blocked in the miR-143 mimics-microinjected SNL rats (Figures 5A,B). [score:1]
The cells with a confluency of ~60% were transfected with luciferase reporter plasmids and miR-143 mimics or negative control. [score:1]
miR, microRNA; NC, negative control; SNL, spinal nerve ligation; Veh, vehicle; (A) Microinjection of miR-143 mimics, but not negative control, into the ipsilateral L5 DRG reversed the decrease in morphine analgesia on the ipsilateral side 5 days after SNL. [score:1]
Names Sequences (5′ to 3′) Real-time PCR miR-143 F ACACTCCAGCTGGGTGAGATGAAGCACTGT miR-143 R GGTGTCGTGGAGTCGGCAATTCAGTTGAG miR-143 RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGAGCTAC U6 F CTCGCTTCGGCAGCACA U6 R and RT AACGCTTCACGAATTTGCGT Dnmt3a F GTGGTTCGGAGATGGCAAAT Dnmt3a R TGGAGGACTTCGTAGATGGCT Oprm1 F TTCCTGGTCATGTATGTGATTGTA Oprm1 R GGGCAGTGTACTGGTCGCTAA Gapdh F TCGGTGTGAACGGATTTGGC Gapdh R CCTTCAGGTGAGCCCCAGC Cloning Dnmt3a 3′-UTR F GTACTCGAGAAGCAAACCACAGAGGAGGA Dnmt3a 3′-UTR R CAAGAGGTAACAGCGGCTTC Dnmt3a 3′-UTR MU FGGACATCA GACCTTGAGTTTTC Dnmt3a 3′-UTR MU RTGAAAACTCAAG GTCTGATGTC F, Forward; R, Reverse; RT, Reverse-transcription; MU, mutant. [score:1]
[1 to 20 of 96 sentences]
2
[+] score: 211
While miR-100 and miR-143 target NPR3 to downregulate its expression, both microRNAs were also observed to regulate MIR143HG promoter activity suggesting possible cross talk between the two NPR3 -targeting microRNAs. [score:11]
As shown in Fig.   5b, overexpression of miR-143 repressed NPPA, NPPC and NR3C2 expression in HCMa cells, while knockdown of miR-143 upregulated expression of CRHR2. [score:11]
To further examine the interaction of miR-100 and miR-143 with predicted target sites on the promoter region of MIR143HG, mutations were introduced into selected transcriptional response elements that contain over 90% complementary base pair matching with the mature seed region of micro-143 and miR-100, namely −1504 bp and −2171 bp (miR-143 target sites), as well as −44 bp, and −1439 bp (miR-100 target sites) with respect to the transcription start site on the MIR143HG promoter region. [score:8]
Second, the upregulated miR-100 levels observed in multiple cardiovascular cells after knock down of miR-143 expression under both normoxic and hypoxic conditions (Supplemental data 1). [score:7]
In this report, we explored a cluster of microRNAs predicted to target NPR3-3′UTR and discovered that miR-143, a microRNA previously demonstrated to play pivotal roles in cardiac development and smooth muscle cell differentiation [16], negatively regulates the expression of NPR3 in cardiac cells derived from human left ventricle. [score:7]
Our finding of the inhibitory effect of miR-143 on NPR3 expression in cardiac cells is particularly intriguing as knockdown of NPR3 in rats, using RNA interference, elevates circulating ANP levels and ameliorates isoproterenol -induced cardiac hypertrophy [24]. [score:6]
This finding was corroborated by the observed upregulation of miR-100 in multiple cardiovascular cell lineages after knock down of the endogenous miR-143 levels using antagomiR-143 (Supplemental data 1). [score:5]
Furthermore, we demonstrated that miR-143 upregulation resulted directly from hypoxia -induced transcriptional activation of its host gene, MIR143HG, as well as by a feed forward effect of miR-143 on its host gene promoter activity. [score:5]
Gain and loss of function assays were then performed in HCMa cells to examine the regulatory effects of miR-143 on the expression of these putative target genes. [score:5]
To examine the possible microRNA-directed transcriptional regulation of MIR143HG, miR-143 and miR-100 mimics were co -transfected with the pMIR143HG-containing vector and the relative strength of promoter activities in driving luciferase reporter expression in transfected cells was determined. [score:5]
Nevertheless, the changes in MIR143HG promoter activities after treatment with miR-100 and miR-143 mimics reflect the complexity of microRNA-directed regulatory mechanisms in gene expression. [score:5]
In experimental PAH mo dels, the authors further demonstrated that downregulation of miR-143 attenuates pulmonary vascular remo deling and the development of pulmonary arterial hypertension [17]. [score:5]
Figure 2Regulatory effects of miR-143 on the expression of NPR3. [score:4]
Figure 5Regulatory effects of miR-143 on the expression of NPPA, NPPC, NR3C2 and CRHR2. [score:4]
To confirm the involvement of hypoxia as a trigger for miR-143 upregulation in vitro, human left ventricle-derived HCMa cells were cultured in 0.2% oxygen for 48 hours and levels of miR-143 were examined. [score:4]
This finding indicates that complementary base pairing of miR-100 and miR-143 with predicted motifs in the promotor region might play role(s) in microRNA-directed transcriptional modulation of the expression of MIR143HG. [score:4]
Regulatory effect of miR-143 on NPR3 expression. [score:4]
The role of miR-143 in mouse vascular smooth muscle cells (VSMCs) differentiation was demonstrated by targeting Ets-like gene 1 (ELK1), a transcriptional coactivator that is crucial for regulation of the VSMC phenotype [16]. [score:4]
Consistent with our previous observations, miR-143 was upregulated in all three cardiac cell lines examined after hypoxic treatment (Fig.   1d and Supplemental data 1). [score:4]
This finding provides the molecular basis for the association of miR-143 with ischemic-related cardiovascular diseases and indicates that miR-143 functions as a modulator of the cardiac cellular response to oxygen deprivation. [score:3]
Western blotting analyses revealed distinct NPR3 expression patterns across three cardiac cell lines (derived from different donors) when subjected to normoxic or hypoxic conditions in the presence of exogenous miR-143 mimic or antagomir (Supplemental data 3). [score:3]
Importantly, results from our study demonstrate that miR-143 may modulate multiple molecules involved in cardiovascular neurohormonal signaling in cardiac lineages, suggesting miR-143 modulates expression of several genes relevant to cardiovascular biology and function. [score:3]
To further explore the possible pathological relevance of miR-143 after ischemic insults in vivo, a rat mo del of myocardial infarction (MI) induced by left anterior descending coronary artery ligation was developed to examine subsequent changes in miR-143 gene expression. [score:3]
These results indicate miR-143 may play multiple roles in circulatory homeostasis by modulating the expression of a range of relevant neurohormones and/or their associated receptors. [score:3]
Previous studies have shown that miR-143 is encoded by the microRNA-143/145 host non-coding RNA gene (MIR143HG, NR_027180; also known as NCR143/145) and the expression of miR-143 is modulated by transcriptional activation of the MIR143HG promoter [17]. [score:3]
In zebrafish heart, miR-143 has been shown to be essential for cardiac chamber morphogenesis by targeting adducin 3 [21]. [score:3]
Figure 1Expression of miR-143 in human HF plasma, animal mo del and in vitro experimental platforms. [score:3]
To further determine the regulatory effects of miR-143 on NPR3 gene expression, the binding of miR-143 to NPR3 3′UTR was examined using luminescence reporter -based interaction assay. [score:3]
Luciferase reporter -based assays together with gain- and loss- of function tests provided strong evidence for the regulatory effects of miR-143 on the expression of NPR3 in cardiac cells. [score:3]
As NPs, particularly ANP and BNP, are known to exert cardio-protective effects countering the deleterious pathological consequences arising from activation of the RAAS and sympathetic nervous systems in cardiovascular disease states, our results suggest that induction of miR-143 may potentially be exploited for therapeutic manipulation of the bioactivity of circulating and /or tissue based cardioprotective NPs. [score:3]
In silico microRNA target prediction (miRWalk 2.0) identified 5 putative miR-143 binding sites within the 3′UTR of NPR3 (Table  1). [score:3]
Recently, a link between miR-143 and cardiovascular disease was suggested by observations of elevated miR-143 levels in patients with pulmonary artery hypertension (PAH), as well as in animal mo dels of PAH [17]. [score:3]
Corroborating these findings, differential expression of these genes of interest were also observed in the other cardiac cell lines after manipulation of endogenous miR-143 levels using analogs or antagomirs (Supplemental data 2). [score:3]
Student’s t-test was used to compare the relative expression of NPR3, HIF-1A and miR-143 at different time points of hypoxia treatment, MI vs sham as well as between clinical groups of heart failure patients and controls. [score:3]
This hypothesis is supported by two lines of evidence, first, the observation of diminished regulatory effect of miR-100 and miR-143 on luciferase activity in cells that harbor mutations on the MIR143HG promoter. [score:3]
Hence, studies clarifying the mechanistic actions of miR-143 in modulating NPR3 gene expression may provide an alternative or supplementary approach in developing future HF therapeutics by prolong the half-life of NPs. [score:3]
A recent genetic study on ischemic stroke (IS) discovered the association of polymorphisms within the promoter region of the MIR143HG with the risk of IS and essential hypertension 22, 23, providing additional evidence for the functional relevance of miR-143 in cardiovascular diseases. [score:3]
Subsequently, HCMa cells were transfected with miR-143 mimics or antagonists and NPR3 transcriptional expression was examined using semi-quantitative PCR. [score:3]
In agreement with observations in HF patients, miR-143 was found to be significantly up-regulated in MI rat plasma compared with sham control (Fig.   1b). [score:3]
Hence targeting of NPR3 with miR-143 may increase ANP bioactivity to augment the cardioprotective effects of NP signaling. [score:3]
Using site-directed mutagenesis of MIR143HG promoter HREs, we have shown for the first time that miR-143 gene regulation may be controlled via a hypoxia -associated signaling cascade. [score:3]
MiR-143 targets other neurohormones and associated receptors. [score:2]
Relative expression levels of miR-143 in (b) rat plasma and (c) rat left ventricular tissue at 7 days post-surgery as compared to sham controls (n = 6). [score:2]
Feedforward regulation of miR-143 and miR-100 on the MIR143HG promoter activity. [score:2]
Hence, the regulatory effect of miR-143 on NPR3 transcript levels might be only one of varied post-transcriptional modification mechanisms present in cells. [score:2]
Figure 6 Schematic diagram of hypoxia -induced transcriptional activation of MIR143HG and the proposed microRNA directed transcriptional modification by miR-143 and miR100 in cardiac cells. [score:2]
Examination of the promoter region of MIR143HG revealed three hypoxia-inducible factor binding sites (consensus motif A/GCGTG), suggesting miR-143 gene regulation might be controlled via a hypoxia -associated signaling cascade. [score:2]
Intriguingly, the promoter activity of MIR143HG was enhanced in the presence of exogenous miR-143, but was suppressed by the exogenous miR100 compared to scrambled controls (Fig.   4a). [score:2]
The negative modulation of the transcriptional activity of miR-100 host gene, MIR100HG, was also observed when treated with exogenous miR-143 (Fig.   4b). [score:1]
Elevations of miR-143 in HF and experimental platforms. [score:1]
Location Sequence alignment Transcriptional factors −1038pMIR143HGmiR-1435′- GAGCTAGCCA GCAAGAAACT A-3′3′- CUCGAUGUCA CGAAGUAGAG U-5′ ENKTF-1 −1504pMIR143HGmiR-1435′-C AGGG ACAGTGTC TG ATTCAG-3′3′-C UCGA UGUCACGA AG UAGAGU-5′ TFII-I, AR −1891pMIR143HGmiR-1435′-AG GAG ACAGTGA TCTTCACAG-3′3′-CU CGA UGUCACG AAGUAGAGU-5′ — −1900pMIR143HGmiR-1435′- GT GCTACAGA GGAGACAG TG A-3′3′- CU CGAUGUCA CGAAGUAG AG U-5′ GR-α −2064pMIR143HGmiR-1435′ -ACATGAAC GGAA TTCATCTTC-3′3′-CUCGAUGU CACG AAGUAGAGU-5′ XBP-1, NFI/CTF −2106pMIR143HGmiR-1435′-CTT CCCT AACC CAC CATCTCT-3′3′-CUC GAUG UCAC GAA GUAGAGU-5′ YY1, coup-TF1 −2171pMIR143HGmiR-1435′-TGT CAGTG GTGCTTTGGAGT A- 3′3′-CUC GAUGU CACGAAGUAGAG U-5′ NFI/CTF, SRY, GR, TCF and LEF-1 The promoter position of the nucleotide with respect to the transcription start site (defined as position 0) that is aligned to the 3′ end of each putative miR-143 binding site in MIR143HG promoter region is indicated under the “Location” column. [score:1]
The NPR3 and MIR143 promoter fragments were inserted upstream of the luciferase reporter coding sequence which is flanked downstream by the NPR 3′ UTR. [score:1]
In that study, miR-143 was found to be highly enriched in pulmonary artery smooth muscle cell (PASMC)-derived exosomes suggesting a role as a biological messenger mediating crosstalk between PASMCs and endothelial cells. [score:1]
Collectively, results from multiple platforms support the postulation that circulating miR-143 could in part originate from hypoxic tissues. [score:1]
To elucidate the involvement of hypoxia in the induction of miR-143 in HCMa, promoter activity of the alpha subunit of hypoxia-inducible factor-1 (HIF-1α) was first examined. [score:1]
Hypoxia induces transcriptional activity of miR-143 host gene in HCMa cells. [score:1]
In the current study, the effects of miR-143 and miR-100 on MIR143HG and MIR100HG promoter activities suggest possible cross talk between the two microRNAs. [score:1]
Sequence analysis of the promoter region of MIR143HG revealed the presence of several specific sequence motifs (~6–7 nucleotides) that are complementary to mature miR-143 and miR-100. [score:1]
Moreover, the elevation of miR-143 was particularly prominent in the peri-infarct zone of the left ventricle (Fig.   1c), suggesting a cardiac contribution to the increase in circulating miR-143. [score:1]
Although two HREs were previous identified in the promoter region of MIR143HG, the functional consequence of induction of miR-143 in hypoxic insults is unknown. [score:1]
Intriguingly, only HCMa and PromoCell cardiac cells responded to miR-143 antagomir treatment with increased NPR3 protein levels under normoxic condition. [score:1]
Luciferase reporter analyses showed that miR-100 and miR-143 fail to modulate the luciferase activities in cardiac cells that harbor the corresponding mutated MIR143HG promoter constructs (Fig.   4a). [score:1]
Findings from previous studies using various experimental platforms have suggested important roles for miR-143 in the cardiovascular system. [score:1]
One hundred and fifty ng psiCHECK-2-NPR3-3′UTR plasmid and 10 pmol mature microRNA-143 mimic (Ambion™) were co -transfected into HeLa cells with Lipofectamine 2000 (Life Technologies) in a 24-well plate. [score:1]
Collectively, our findings support a role for miR-143 in fine tuning NPR3 transcript levels in cardiac cells under both normoxic and hypoxic conditions. [score:1]
Figure 4Differential promoter activities of MIR143HG and MIR100HG in the presence of exogenous miR-100 or miR-143 in HCMa cells. [score:1]
Intriguingly, in addition to NPR3, four additional neurohormonal-related genes were found to interact with miR-143, including natriuretic peptide A (NPPA), natriuretic peptide C (NPPC), and nuclear receptor subfamily 3, group C, member 2 (NR3C2), and corticotropin releasing hormone receptor 2 (CRHR2) (Fig.   5a). [score:1]
In the 2-Kb MIR143HG promoter region, 7 and 4 putative binding sites were identified for miR-143 and miR-100, respectively (Tables  2 and 3). [score:1]
As shown in Fig.   2a, relative luciferase activity in cells co -transfected with psiCHECK2-NPR3 3′UTR and miR-143 mimics was significantly repressed, indicating that the seed region of miR-143 can indeed interact with the NPR3 3′UTR as predicted. [score:1]
The increase in miR-143 in HF was more pronounced in 44 reduced ejection fraction (HFREF) patients (p = 0.0017) than in 12 patients with preserved ejection fraction (HFPEF). [score:1]
None of the tested cardiac cells responded to miR-143 mimic treatments as judged from the Western blotting analyses. [score:1]
[1 to 20 of 71 sentences]
3
[+] score: 139
Through in situ hybridizations, we confirmed the layer and cell-type expression of miR-143, which is up-regulated in LII stellate cells but also expressed in smaller cells in LII and LIII and LV pyramidal cells, and miR-219-5p, which is expressed in ependymal cells, oligodendrocytes, and glia—primarily in LV and LVI. [score:10]
To further delineate targets relevant for miR-143 in MEC LII and stellate cells, we combined the expression profile of miR-143 with those of its predicted, conserved targets. [score:7]
Lmo4 was the gene with highest LFC between MEC layers in gene expression, the best target site as measured by the TargetScan context score, and the second highest negative correlation with miR-143 expression levels. [score:7]
Expression patterns of mRNAs that are the most likely miR-143 (d) and miR-219-5p (f) targets (rho < −0.5 and the best TargetScan 6.0 or 7.0 context score). [score:7]
When comparing these findings to those of the laminar sample study, we saw that one of the up-regulated miRNAs, miR-143, was also up-regulated in LII. [score:7]
Taken together, these results confirm that several of the miRNAs up-regulated in LII also are up-regulated in stellate cells and identify miR-143 as the prime candidate for a stellate-enriched miRNA. [score:7]
The most significantly up-regulated miRNA in LII, miR-143, was found to be up-regulated particularly in stellate neurons. [score:7]
a Gene ontology, b KEGG pathway, and c REACTOME pathway enrichment analyses for validated and predicted, conserved targets of miRNAs up-regulated in stellate cells in general and miR-143 in particular. [score:6]
We hypothesized that if miR-143 was important for regulating stellate-specific gene expression, we would observe miR-143 expression in stellate cells of MEC. [score:6]
Laminar samples are colored (LDeep red, LII turquoise) Because miR-143 was up-regulated both in stellate cells and in LII in general, we also specifically considered the enriched terms and pathways of its predicted or validated targets (Fig.   5a–c). [score:5]
Due to this increased expression during postnatal development, it is possible that the importance of gene regulation by miR-143 increases with age. [score:5]
Laminar samples are colored (LDeep red, LII turquoise) Because miR-143 was up-regulated both in stellate cells and in LII in general, we also specifically considered the enriched terms and pathways of its predicted or validated targets (Fig.   5a–c). [score:5]
Correlating gene expression with miR-143 expression. [score:5]
Grid cells, which are presumed to be stellate cells, reach maturation around the third postnatal week in rats, making the P23 developmental time point relevant for validation of miR-143 up-regulation. [score:5]
Fig. 5Analyses of predicted, conserved mRNA targets expressed in the MEC of miR-143 (a–d) and miR-219 (e, f). [score:5]
The two miRNAs with the lowest p value up-regulated in LII (miR-143 and miR-126; Fig.   1f) are involved in angiogenesis (Climent et al. 2015; Sonntag et al. 2012). [score:4]
Two miRNAs, miR-143 and miR-150, were up-regulated both in LII and in stellate neurons. [score:4]
Although stellate cells were profiled at an early postnatal time point (P4/5), the results from the laminar samples showed that the expression of miR-143 increased further in LII across development. [score:4]
of miRNAs Although stellate cells were profiled at an early postnatal time point (P4/5), the results from the laminar samples showed that the expression of miR-143 increased further in LII across development. [score:4]
By analyzing for enriched ontology terms for their predicted, negatively correlated target genes, we found that miR-219-5p appears to regulate myelination, while miR-143 likely contributes to the specification of neuronal subtypes. [score:4]
The most significant up- and down-regulated miRNAs in LII (miR-143 and miR-219-5p, respectively) were validated by in situ hybridization. [score:4]
Likely targets of miR-143 and miR-219-5p. [score:3]
The top predicted target genes of miR-143, Lmo4, Tpm3, and Cachd1, indicate that miR-143 contributes to laminar and subcellular phenotypes of MEC. [score:3]
The most likely targets of miR-143 in the MEC, according to these criteria, were the Lmo4, Tpm3, and Cachd1 genes (Fig.   5d). [score:3]
Using the same criteria as for miR-143, we found 16 genes that had opposite expression to miR-219-5p between both ages and layers. [score:3]
The medial and lateral entorhinal cortices are known to differ in electrophysiology, connectivity, and function, and with differing patterns in the two regions, miR-143 could be involved in regulating these properties. [score:2]
The exact role of miR-143 in Lmo4 gene regulation and its potential importance for stellate or grid cell function remains to be determined. [score:2]
Interestingly, the density of miR-143 seemed to be higher in MEC than in the lateral part of the EC (LEC), and the signal was more homogeneous across layers in LEC. [score:1]
Consequently, the vascular role of miR-143 appears to be less important in rat MEC, where it instead appears to have roles in stellate and pyramidal cell function. [score:1]
miR-143 is known to be involved in differentiation and proliferation of vascular smooth muscle cells (Rangrez et al. 2011), and modulates the angiogenic and vessel stabilization properties of endothelial cells (Climent et al. 2015). [score:1]
e– h miRNA in situ hybridization on sagittal brain slices from a P23 rat using LNA-probes for miR-143 (e, g) and miR-219-5p (f, h). [score:1]
The miR-143 signal was indeed strong in LII, with the signal in stellate neurons being very dense but not exclusive to this neuronal subtype (Fig.   4e, g). [score:1]
[1 to 20 of 32 sentences]
4
[+] score: 103
At the same time, both preneoplastic and cancerous phenotypes exhibited weak/diffuse miR-143 ISH signals but moderate/strong cytoplasmic HK2 expression (Figure 3C and 3D), indicating down-regulation of the tumor suppressor, miR-143, leads to overexpression of HK2 and enhanced cell proliferation/ESCC development. [score:11]
Thus, integration of metabolomics with transcriptomics [16] & microRNA profiling data [28] in the hyperplastic ZD esophagus revealed that deregulated glucose uptake is accompanied by miR-143 down-regulation and up-regulation of the hexokinase gene Hk2. [score:8]
Based on this observation, we went on to perform Taqman miRNA assays using and showed that the tumor suppressor miR-143 was down-regulated 2.5-fold in hyperplastic ZD vs ZS esophagus from rats after a brief 6-week dietary regimen (P < 0.05, n = 8 rats/group ), and down-regulated 10-fold (P < 0.001, n = 8 rats/group) in archived samples of ESCC-bearing ZD esophagus vs non-ESCC-bearing ZS counterpart from an esophageal tumor study in Zn-modulated rats [28]. [score:8]
Divergent inverse correlation of miR-143 & HK2 expression in nonproliferative esophagus vs proliferative ZD esophageal neoplasia and human ESCCTo understand the distribution and localization of miR-143 in esophageal neoplasia in relation to localization of its target HK2 protein and the level of cell proliferation, we performed in situ hybridization (ISH) and immunohistochemical staining (IHC) on near serial sections of rat esophageal tissues (n = 10 rats/group), as well as in the archived human ESCC tissues for which we previously reported overexpression of miR-31, -21, -223 [27, 28]. [score:7]
Significantly, miR-143, a tumor suppressor in human cancers, including ESCC [55, 56], and a known negative regulator of HK2 [36], was down-regulated 1.8-fold (P = 0.0136) in the highly proliferative ZD esophagus as compared to its non-proliferative counterpart vs ZS [28]. [score:6]
For example, miR-122 and its host gene regulate cholesterol and lipid metabolism in liver [35]; miR-143 and its target gene, HK2, regulates aerobic glycolysis in tumor cells [36- 39]. [score:5]
To understand the distribution and localization of miR-143 in esophageal neoplasia in relation to localization of its target HK2 protein and the level of cell proliferation, we performed in situ hybridization (ISH) and immunohistochemical staining (IHC) on near serial sections of rat esophageal tissues (n = 10 rats/group), as well as in the archived human ESCC tissues for which we previously reported overexpression of miR-31, -21, -223 [27, 28]. [score:5]
The finding shows that to support cell proliferation, ZD reprograms glucose metabolism by modulating the expression of miR-143, which targets HK2. [score:5]
Moreover, we showed that miR-143 regulates cancer glycolysis in ZD -induced esophageal neoplasia by targeting HK2 (Figure 3), a result consistent with reports for lung cancer, renal cell carcinoma, head and neck squamous cell carcinoma, breast cancer, and prostate cancer [36- 38, 62, 63]. [score:4]
In addition, future studies are needed to unravel the mechanism(s) whereby dietary ZD regulates the expression of miR-143. [score:4]
This result is consistent with reports that miR-143 is an essential regulator of cancer glycolysis by targeting HK2 in cancer cells, including lung cancer, head and neck squamous cell carcinoma, renal cell carcinoma, and colon cancer cells [36- 39]. [score:4]
Concurrently, these ZS tissues showed abundant and intense miR-143 ISH signal in basal and suprabasal cell layers along with weak HK2 protein expression. [score:3]
While miR-143 ISH signals were absent in human ESCC tissues, strong cytoplasmic HK2 protein expression was present (Figure 4). [score:3]
In this study, integrated analysis of -omics datasets with miRNA expression profiling revealed a miR-143-HK2-glucose link in hyperplastic ZD esophagus. [score:3]
Figure 4Analysis of cell proliferation, miR-143 and HK2 expression in human esophageal squamous cell carcinoma (ESCC) tissue by in situ hybridization and immunohistochemistryRepresentative hematoxylin and eosin [H&E]-stained and PCNA-stained ESCC tissues (2 cases are shown). [score:3]
Analysis of miR-143 and HK2 expression by in situ hybridization (ISH) and immunohistochemistry (IHC) in formalin fixed paraffin embedded esophageal samples in - C. ZD versus ZS esophagus after a 6-week dietary regimen (n = 8 rats/group) D. Archived samples of ESCC-bearing ZD esophagus versus tumor-free control ZS esophagus [28] (n = 10 rats/group). [score:3]
Analysis of cell proliferation, miR-143 and HK2 expression in Zn -deficient preneoplastic and neoplastic rat esophageal tissues. [score:3]
Divergent inverse correlation of miR-143 & HK2 expression in nonproliferative esophagus vs proliferative ZD esophageal neoplasia and human ESCC. [score:3]
Analysis of cell proliferation, miR-143 and HK2 expression in human esophageal squamous cell carcinoma (ESCC) tissue by in situ hybridization and immunohistochemistry. [score:3]
Together, these data revealed for the first time the opposing inverse-correlation between miR-143 & HK2 expression in normal esophagus with limited cell growth (ZS esophagus) and precancerous/cancerous ZD esophageal cells with unbridled cell proliferation. [score:3]
Following deparaffinization, rehydration in graded alcohol and proteinase K treatment, tissue sections were hybridized with miR-143 probe (20 nM), in hybridization buffer (Exiqon) at 57°C for 14 h in a hybridizer (Dako, Glostrup, Denmark). [score:1]
miR-143 ISH signal (blue, 4-nitro-blue tetrazolium and 5-brom-4-chloro-3′-indolylphosphate; counterstain, nuclear fast red). [score:1]
Figure 3 A. analysis of miR-143 (U87 as normalizer, n = 8 rats/group; results are shown as means, error bars represent standard deviation). [score:1]
Integration of metabolomics with our published transcriptomics and microRNA profiling data revealed a miR-143-HK2-glucose pathway that underlies esophageal neoplasia by ZD. [score:1]
Cellular origin of miR-143 was defined by ISH using high affinity double Dig-labeled LNA probes (Exiqon, Vedbaek, Denmark). [score:1]
In situ hybridizationmiRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, hsa-miR-143, rno-miR-31, and negative controls were purchased from Exiqon (Vedbaek, Denmark). [score:1]
miR-143 ISH signal (blue, 4-nitro-blue tetrazolium and 5-brom-4-chloro-3′-indolylphosphate; counterstain, nuclear fast red) was absent in ESCC tumor area. [score:1]
A. analysis of miR-143 (U87 as normalizer, n = 8 rats/group; results are shown as means, error bars represent standard deviation). [score:1]
miRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, hsa-miR-143, rno-miR-31, and negative controls were purchased from Exiqon (Vedbaek, Denmark). [score:1]
[1 to 20 of 29 sentences]
5
[+] score: 75
MiR-143 and miR-145 were direct transcriptional targets of serum response factor (SRF), myocardin and Nkx2.5 and were down-regulated in injured or atherosclerotic vessels containing proliferating, less differentiated smooth muscle cells. [score:7]
With the exception of miR-143-3p, we observed that changes in the expression of miR-30a-5p, miR-30c-5p, miR-145-5p, and miR-140-3p at 4 weeks post-MI tended to increase compared to the control group, whereas expression of these four miRNAs decreased and the expression of miR-143-3p increased in the SkM treatment group, suggesting that these miRNAs could be associated with the SkM therapy of myocardial injury. [score:6]
Interestingly, as shown in Fig.   3, at 4 weeks post-MI, with the exception of miR-143-3p, changes in miR-30a-5p, miR-30c-5p, miR-145-5p, and miR-140-3p expression tended to increase compared to the control group, whereas the expression of these four miRNAs decreased and the expression of miR-143-3p increased in the SkM +MI group, suggesting that these miRNAs may be associated with SkM therapy in myocardial injury. [score:6]
We focused on a novel set of apoptosis -associated miRNAs and their target genes, among which 4 miRNAs (miR-30a-5p, miR-30c-5p, miR-145-5p, miR-140-3p), except one (miR-143-3p), were downregulated in the SkM treated group as compared to the untreated group. [score:5]
We focused on changes in some apoptosis -associated miRNA and in gene expression in response to SkM MI therapy, corroborated some of the results obtained from microarrays with real-time qPCR analysis, and selected some significant miRNAs, including miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p, which were involved with anti-apoptotic target genes such as Angptl4, Dpep1, Egr1, Eif5a, Tsc22d3, Irs2 and Cebpb. [score:5]
Pathway analysis based on miRNA targeted genes showed significant pathways targeted by rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p. [score:5]
GO-Analysis based on miRNA targeted genes showed significant function of target genes by rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p. [score:5]
We observed a significant trend in the expression of some apoptosis-related miRNA and mRNA, including the expression of miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p (Fig.   3). [score:5]
miR-143 and miR-145 act as integral components of the regulatory network whereby SRF controls cytoskeletal remo deling and phenotypic switching of smooth muscle cells (SMCs) during vascular disease [31]. [score:4]
We also demonstrated that miR-140, miR-143 and miR-145 might also collectively cooperate in MI treatment with SkMs by regulating targeted genes such as Egr1. [score:4]
MicroRNA-GO-Network, screening out the main function of the target genes regulated by rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p. [score:4]
In this experiment, we focused on a subset of apoptosis-related miRNAs, including miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p, and mRNAs involved in anti-apoptotic target genes such as Angptl4, Dpep1, Egr1, Eif5a, Tsc22d3, Irs2 and Cebpb. [score:3]
Venn’s diagram for target genes of rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p predicted by MIRANDA, MICROCOSM, MIRDB. [score:3]
We focused on five apoptosis-related miRNAs (miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p), demonstrated their changes after SkMs treatment and filtered out 7 anti-apoptotic target genes, namely, Angpt14, Eif5a, Egr1, Irs2, Cebpb, Tsc22d3, and Dpep1, in the heart tissues (Fig.   6). [score:3]
Our data also suggest that some apoptosis -associated miRNAs, such as miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, miR-140-3p and their target genes, may play an important role in myocardial injury after MI. [score:3]
MIRANDA, MICROCOSM, and MIRDB programs were employed to predict potential targets of five key miRNAs, miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p. [score:3]
The expression of miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p in the infarcted border zone region was measured by real-time analysis 4 weeks after MI. [score:1]
The results from real-time qPCR analysis showed high concordance with our microarray results for all investigated transcripts, as shown in Fig.   4. Fig.  4 Analyses of the expression of rno-miR-30a-5p, rno-miR-30c-5p, rno-miR-140-3p, rno-miR-143-3p, and rno-miR-145-5p by RT-PCR. [score:1]
The five key miRNAs in the network were identified as miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p, as shown in Additional file 12: Figure S4. [score:1]
The five key miRNAs in the network were identified as miR-30a-5p, miR-30c-5p, miR-145-5p, miR-143-3p, and miR-140-3p. [score:1]
[1 to 20 of 20 sentences]
6
[+] score: 72
In addition, the gain or knockdown of miR-143 only altered ERK5 mRNA levels in adipose SVF derived cells from younger rats, but not from 30 mo old rats, with very little change in ERK5 protein expression in adipose SVF derived cells from both groups of rats, suggesting a dysregulation of miR-143 with age. [score:5]
Impaired protein expression of miR-143 target genes with aging in preadipocytes before and after adipogenic differentiation. [score:5]
To investigate if miRNAs that regulate adipocyte or osteocyte differentiation is compromised in SVF cells from old rats (30 mo), the levels of miR-143 [26] and its target gene ERK5 and miR-204 (which directly inhibits osteogenic factor-Runx2) [27] were determined in the preadipocytes isolated from both groups of rats before (baseline) and after subjecting to ex-vivo adipocyte differentiation. [score:5]
However, after differentiation, only the young cells (6 mo rats) had significantly higher expression of miR-143 (2.4 fold, p<0.01) and miR-204 (13.7 fold, p<0.005) (post-adipogenesis) (Figures 3 & 4 A and B). [score:3]
Correspondingly, a significant induction in the protein levels of the target gene for miR-143, ERK5 (+78%, p<0.01) (Figure 5A and 5B ), which in turn regulates adipogenesis by modulating PPARγ [39] [26] mRNA (30.6 fold, p<0.005) (Figure 4C ) and protein (+370%, p<0.01) (Figure 5A and 5C ) was observed in preadipocytes from young (6 mo) rats post-adipogenesis compared to old (30 mo) rats. [score:3]
In our study, there was a down-regulation of miR-143 levels post adipogenesis, in adipose SVF derived cells isolated from older rats compared to those from younger rats. [score:3]
The role of miR-143 and miR-204 and its target genes on the altered preadipocyte function in young (6 months old) and old (30 months old) Fischer 344 x Brown Norway Hybrid (FBN) rats were studied. [score:3]
miR-143 through its actions on its target genes in the ERK5-PPARγ pathway, promotes adipogenesis and obesity [26]. [score:3]
was used to analyze the protein levels of miR-143 target genes, ERK5, 5A and B; PPARg, 5A and C; or osteogenic marker, Runx2, 5A and D in the young and old rats preadipocytes before and after adipogenic differentiation. [score:3]
Reciprocal induction of miR-143 and its target gene ERK5 plays an important role in adipocyte differentiation [26]. [score:3]
The regulatory role of miR-143 in the adipogenic/osteogenic pathways with age was validated by modulating the miR-143 expression levels in preadipocytes from both young (6 mo) rats and old (30 mo) rats after transfection with either premir (gain of function) or antagomir-143 (loss of function) primers. [score:3]
However, although miR-143 inhibited ERK5, the levels of the adipogenic factors were increased after adipogenesis in adipose SVF derived cells from young rats. [score:3]
0059238.g007 Figure 7The gain or knockdown of miR-143 by premir or antagomir-143 was performed by transient transfection of both young and old rat (n = 8) preadipocytes, pre-adipogenesis. [score:2]
To validate the physiological relevance of miR-143 in the regulation of adipogenic pathway during aging, the isolated preadipocytes from young (6 mo) and old (30 mo) rats were transfected with either premir-143 (AM17100) to increase miR-143 levels or with antagomir-143 (AM17000) to decrease miR-143 levels in cells cultured in 6-well plates (50,000 cells per well). [score:2]
Adipocyte differentiation was performed on the cells after transient transfection of both young and old rat (n  = 8) preadipocytes by premir or antagomir-143 (gain or knockdown of miR-143). [score:2]
Since miR-143 negatively regulates ERK5 mRNA [26], a higher miR-143 levels after premir-143 transfection significantly decreased ERK5 mRNA level (0.36 fold, p<0.05) but increased its levels (4.02 fold, p<0.05) after antagomir-143 transfection (Figure 8B ) post-adipogenesis, only in 6 mo SVF derived cells but not in 30 mo rat cells. [score:2]
The gain or knockdown of miR-143 by premir or antagomir-143 was performed by transient transfection of both young and old rat (n = 8) preadipocytes, pre-adipogenesis. [score:2]
MiR-143 that regulates adipogenic differentiation and miR-204 that regulates osteogenic differentiation and their target genes, were measured in SVF cells isolated from 6 mo and 30 rats (n = 8/group) before and after adipocyte differentiation using mirVana assays. [score:2]
0059238.g008 Figure 8Adipocyte differentiation was performed on the cells after transient transfection of both young and old rat (n  = 8) preadipocytes by premir or antagomir-143 (gain or knockdown of miR-143). [score:2]
This dysfunction was associated with compromised miR-143 (known to play a regulatory role in adipocyte differentiation) levels. [score:2]
Levels of miR-143 (regulator of adipogenic pathway) and miR-204 (regulator of osteogenic pathway) were quantified in the total RNA fraction isolated from the preadipocytes (5×10 [5]) using kit (AM1558) and respective primers: miR-143 (AM30045) and miR-204 (MIMAT0000877) on the MyiQ Bio-Rad real-time PCR system. [score:2]
miR-143, 4A; miR-204, 4B; PPARg, 4C; ap2, 4D; and Runx2, 4E. [score:1]
Gain or loss of function analysis of the role of miR-143. [score:1]
The impaired differentiation capacity with aging correlated with altered levels of miRNAs involved in adipocyte differentiation (miRNA-143) and osteogenic pathways (miRNA-204). [score:1]
An increase in miR-143 and miR-204 after adipocyte differentiation in 6 mo rats but not in 30 mo rats was observed. [score:1]
In transfected SVF derived cells after differentiation into mature adipocytes using adipocyte induction media (post-adipogenesis), the transfection efficiency remained high after transfection with premir-143 in both 6 mo (17.5 fold, p<0.005) and 30 mo rat cells (29.6 fold, p<0.005) and significant decrease in miR-143 levels after antagomir-143 transfection in 6 mo (0.52 fold, p<0.05) and 30 mo rat (0.13 fold, p<0.05) SVF derived cells (Figure 8A ). [score:1]
Transfection efficiency (Figure 7A ) was confirmed by a significant induction of miR-143 after transfection with premir-143 in both 6 mo(>6 fold, p<0.05) and 30 mo rat SVF cells (>3.5 fold, p<0.005) and significant decrease in miR-143 levels after antagomir-143 transfection in 6 mo and 30 mo rat(<0.4 fold, p<0.05) SVF cells. [score:1]
miR-143, 8A; ERK5 mRNA, 8B; ERK5 protein, 8C; PPARg mRNA, 8D; Runx2, 8E; and miR-204, 8F. [score:1]
miR-143, 7A; ERK5 mRNA, 7B; PPARg mRNA, 7C; IL-6 mRNA, 7D; ERK5 protein, 7E; and PPARg protein, 7F. [score:1]
As observed in Figure 3A and B, the levels of both miR-143 and miR-204 were not significantly different in the young and old preadipocytes before adipocyte differentiation (pre-adipogenesis). [score:1]
Increases in miR-143 levels by premir transfection enhanced the adipogenic differentiation capacity of young adipose SVF derived cells with a concomitant increase in PPARg and miR-204. [score:1]
Validation of the role of miR-143 in age-impaired adipogenesis. [score:1]
miR-143, 3A; miR-204, 3B. [score:1]
[1 to 20 of 33 sentences]
7
[+] score: 70
The most robust upregulation was seen for miR-143, which has several predicted targets and is a strong regulator of vascular morphology. [score:7]
For both miR-30a and miR-143, the SAH -induced upregulation appeared to be transient because expression levels at 24 h post-SAH did not differ from sham. [score:6]
Of the 482 miRNAs that were expressed in both sham-operated animals and animals subjected to SAH, we found that 4 miRNAs (miR-30a, miR-143, miR-191*, and miR-223) showed statistically significant changes in expression between the experimental groups (Table  1). [score:5]
Both miR-30a and miR-143 were upregulated in cerebral vessels after SAH; however, this regulation was not detectable in the serum. [score:5]
The finding presented here is most intriguing because miR-143 is highly expressed in vascular smooth muscle cells, cardiac muscle, and endothelial cells and has been identified as essential for regulating smooth muscle cell proliferation and differentiation [32]. [score:4]
We report that miR-30a, involved in regulation of angiogenesis, and miR-143, correlated to vascular smooth muscle tone regulation, are significantly regulated after SAH. [score:4]
miR-30a and miR-143 both displayed upregulation in cerebral arteries at 6 h after SAH. [score:4]
We have not directly tested whether the observed changes in miR-143 expression after SAH are pathological or beneficial. [score:4]
To confirm the differential expression of miR-30a, miR-143, miR-191*, and miR-223 in SAH and sham animals as well as the lack of differential expression of miR-145, additional qPCR assays were performed. [score:4]
The present study is the first demonstration of a time -dependent change in the expression of miR-30a and miR-143 in large cerebral arteries after experimental SAH in rats. [score:3]
Two miRNAs, miR-30a and miR-143, were significantly upregulated in cerebral arteries after SAH when compared to sham-operated animals. [score:3]
miR-30a and miR-143 were both significantly upregulated at 1 h and 6 h post-SAH as compared to sham. [score:3]
This study suggests that an increase in miR-143 and in part miR-145 in the hours after SAH could play an important role in the early development of this pathology. [score:2]
The data from this miRNA screen in cerebral arteries of rats following SAH suggest that in particular, miR-30a and miR-143 changed with time but did not differ from a control group of sham-operated rats at 24 h. Future work with antagomirs will likely shed more light on the involvement of miRNAs in cerebral vasospasm, vascular inflammation, blood–brain barrier dysfunction, and development of LCI after SAH. [score:2]
Interestingly, miR143/145 knockout mice are viable and fertile, but they have a thinner arterial wall than the wild-type animals and thus significantly lower blood pressure [33]. [score:2]
We also examined the regulation of miR-145 because of its relationship with miR-143 and because many studies have shown that the two often co-transcribe and are important in the phenotype of vascular smooth muscle cells [10, 21]. [score:2]
Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, et al. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. [score:2]
However, the fact that miR-143 was identified in our screen strengthens the confidence in this miRNA as an important contributor to the vascular changes that occur in conjunction with experimental SAH. [score:1]
Rangrez AY, Massy ZA, Metzinger-Le Meuth V, Metzinger L. miR-143 and miR-145: molecular keys to switch the phenotype of vascular smooth muscle cells. [score:1]
miR-145, miR-221, and miR-222 were selected based on their relationship with miR-143 and miR-223, respectively. [score:1]
The increases were approximately 2-fold for miR-30a at both time points and 3- and 4-fold, respectively, for miR-143. [score:1]
We hypothesize that miR-30a and miR-143 may play a role in the vascular wall changes seen after SAH. [score:1]
Fold change over sham for miR-30a (A), miR-143 (B), miR-191* (C), miR-223 (D), and miR-145 (E) at 0 h, 1 h, 6 h, and 24 h post-SAH. [score:1]
Subsequent technical confirmation of the data with additional qPCR assays confirmed that miR-30a and miR-143 exhibited significantly altered expression levels after SAH when compared to sham animals (Figure  2). [score:1]
We report that miR-30a and miR-143 in the cerebral arteries show significant changes over time after SAH, but do not differ from sham-operated rats at 24 h post-SAH. [score:1]
[1 to 20 of 25 sentences]
8
[+] score: 37
In summary, the data analysis supports the view that the down-regulation of four miRs (miR-133b, miR-143, miR-335-5p, miR-1) appears to orchestrate the development of chronic neuropathic pain in Sural-SNI while the up-regulation of seven miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1) appear to orchestrate the recovery from post-nerve injury induced pain in Tibial-SNI. [score:8]
By using the rationale from our dual SNI variants we interpret that the decrease in expression of four miRs (miR-133b-3p, miR-145, miR-143, and miR-1) contributes to pain while the increase in expression of two miRs (miR-193b-3p and miR-191-5p) limits the level of pain that develops following a sciatic nerve crush. [score:5]
On the other hand, the translation of these ion channels would be predicted to decrease in the Tibial-SNI primary sensory neurons due to the increase in expression of all seven identified miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1). [score:5]
This analysis indicated that the translation of various ion channels, including some that have already been found to contribute to neuronal hyperexcitability and neuropathic pain (see), would be expected to increase in Sural-SNI primary sensory neurons due to the decreased expression of at least four miRs (miR-133b-3p, miR143, miR-335-5p, miR-1). [score:5]
At Day 7, the only miR that displayed a difference (between Sural-SNI and Tibial-SNI) was miR-143, which showed a downregulation in Tibial-SNI. [score:4]
At Day 23 miR-143 shows an upregulation in Tibial-SNI. [score:4]
In both the microarrays (Figure 3A) and qPCR (Figures 3B,C) seven miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1) had a significantly higher level of expression in Tibial-SNI than in Sural-SNI. [score:3]
L3-DRG, which contains the somata of the uninjured saphenous nerve fibers, also showed differential regulation between the two SNI variants, but only three of these miRs (miR-133b, miR-145, miR-143) were significantly different. [score:2]
Ct values were <30.60 for miR-133b, <27.78 for miR-145, <27.66 for miR-193b, <30.19 for miR-143, <33.69 for miR-335, <23.42 for miR-191, <37.89 for miR-130a, <36.00 for miR-325, <32.04 for miR-1. Reference miRs were: MammU6-4395470 (Ct values < 19.30), snoRNA135-4380912 (Ct values < 33.98), and U87-4386735 (Ct values < 28.32). [score:1]
[1 to 20 of 9 sentences]
9
[+] score: 32
For that reason, rather than selecting the common targets to both algorithms, we chose PicTar algorithm to match upregulated miRNAs (miR-21, miR-98, miR-27a, miR-143, let-7d, miR-126, miR-22) with downregulated putative targets in Ortis et al. and vice versa (Table 4). [score:11]
Using quantitative PCR -based high throughput analysis, we have confirmed upregulation of 7 (miR-21, miR-98, miR-27a, miR-143, let-7d, miR-126, and miR-22) and downregulation of 1 (miR-129) miRNAs out of the 26 activated miRNAs identified in our settings. [score:7]
The expression patterns of miR-27a varied with hyperglycemia in the Gyoto-Kakizaki rat [5], and miRNA-143 overexpression inhibited insulin-stimulated AKT activation and resulted in impaired glucose metabolism [93]. [score:7]
Eight miRNAs from the PCR-confirmed 11 miRNAs, are common to both in vitro and in vivo inflammation conditions; 7 upregulated (miR-21, miR-98, miR-27a, miR-143, let-7d, miR-126 and miR-22) and one (miR-129) downregulated (Table 3). [score:7]
[1 to 20 of 4 sentences]
10
[+] score: 25
The results of luc reporter assays are summarized in Figure 10, C and D. The data showed that miR-143 and miR-155 down-regulated the WT2 c-Maf 3′-UTR, and miR-301a down-regulated the WT3 c-Maf 3′-UTR (Figure 10C, n = 6, P < 0.05). [score:6]
Expression of the lens-differentiation factor c-Maf was predicted to be regulated by multiple miRNAs and experimentally validated for three miRNAs, including miR-143, miR-155, and miR-301a, in lens cells. [score:4]
Taken together, the present data demonstrate that miR-143 and miR-301a are novel regulatory miRNAs for c-Maf expression in mammalian lens. [score:4]
To determine whether the aforementioned miRNAs identified in rat lens explant system are also expressed during mammalian lens development in vivo, we conducted ISH analysis of miR-9, miR-143, miR-155, miR-301a, miR-381, and miR-455 in E14.5 and newborn (P0) lenses. [score:4]
In addition, c-Maf 3′-UTR contains a miR-143 target sequence (Figure 10, A and B). [score:3]
The miR-143, miR-155, and miR-301a down-regulated expression of c-Maf evaluated in cultured lens cells through the 3′-UTR luciferase reporter assays. [score:3]
At postnatal day P0, the distribution of both miR-9 (B) and miR-143 (D) is largely maintained in all the lens cells previously described for the E14.5 lens, whereas miR-301a (F) is not detected. [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 24
The negative correlation between the gene and microRNA expression suggests that the increased mRNA levels of growth factors (Egr1, Fgf2, and Fgf7) may be due to the downregulated expression of their regulating microRNAs (miR-192, miR-143). [score:9]
The presented data indicate that, among others, the activation takes place due to the opposed expression profile of genes and their regulating microRNAs at the site of inflammation (Figure 6); while the expression of all tested mesenchymal markers (Egr1, Fgf2, Fgf7, Jak2, Notch2, Hif1 α, Zeb2, Mmp9, Lox, and Vim) was significantly induced, microRNAs regulating their expression decreased (miR-192, miR-143, miR-375, miR-30a, miR-107, miR-200b, and miR-125a). [score:9]
It is known that miR-192 regulates the expression of Egr1 and Fgf2, while miR-143 is a known inhibitor of Fgf7 [20]. [score:6]
[1 to 20 of 3 sentences]
12
[+] score: 22
Other miRNAs from this paper: hsa-mir-143
Intriguingly, we have recently found that α-mangostin up-regulated the expression of miRNA-143 (Figure 7)[13]. [score:6]
The molecular mechanism of the apoptotic cell death induced by α-mangostin in DLD-1 cells is schematically summarized in Figure 8. α-Mangostin first affects the cell cycle i. e. arrest at G1/S and thereafter induces apoptosis which is mediated by the intrinsic pathway through mitochondria, which follows the modulation of the growth-related signal transduction via MAPK Erk1/2 and Akt, and the expression level of miRNA-143, a target of ERK5. [score:5]
miR-143 is highly expressed especially in normal colon tissues, but its expression in human colon cancer tumors is markedly decreased [25, 26]. [score:5]
α-Mangostin increased the expression levels of miRNA-143 in the process of the apoptotic cell death probably by modulating its transcription and/or the upstream signals associated with the transcription factors of miR-143 [13]. [score:3]
We determined its target mRNA to be ERK5 by introducing miRNA-143 into DLD-1 cells [25, 26]. [score:3]
[1 to 20 of 5 sentences]
13
[+] score: 21
Although scarce details are available on the role of miR-143 and 1246 in islet function, miR-143 was shown to be among the ten most abundant miRNAs expressed in human islets beta cells whereas miR-1246 was predominantly expressed in other islet cell types [35]. [score:5]
Elsewhere, miR-143 expression was found to be essential for human pre-adipocyte differentiation partly through repression of its target gene ERK5 involved in cell growth and proliferation [36]. [score:5]
In contrast mouse islets only expressed miR-143 and very low levels of miR-1246 (Fig.   5b). [score:3]
Further indication for a dysfunctional role of the rs7119 variant in aberrant HMG20A repression was highlighted by the expression of SNP -associated miRNAs, the most abundant being miR-143 and 1246, in human 1.1E7 cells and mouse islets. [score:3]
Notwithstanding, the “mut” allele generates binding sites for six alternative miRNAs (Table  1) of which four, miR-143 (3p and 5p), miR-490-3p, miR-1246, and miR-1261, were expressed in the human 1.1E7 pancreatic cell line (Fig.   5a). [score:3]
Esau C MicroRNA-143 regulates adipocyte differentiationJ. [score:1]
Although it remains to be validated, the potential serendipitous binding of miR-143 to the HMG20A rs7119 gene variant may induce aversely de-differentiation through activation of Pax4 and Rest. [score:1]
[1 to 20 of 7 sentences]
14
[+] score: 12
We performed network analyses using top 10 identified miRNAs (up-regulated: let-7i, let-7c, let-7a, miR-124, miR -145, miR-143, miR-34a, miR-466; down-regulated: miR-21, miR-146b) to predict their potential target transcripts. [score:9]
B: microRNAs let-7i, let-7a, let-7c, miR-34a, miR-124, miR-145, and miR-143 were up regulated; miR-21 was down regulated 12 weeks post-irradiation vs. [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 12
miR-100 targets AGO2, miR-199a-3p and miR-145 target ZEB2, miR-143 targets BCL2, and miR-199a-5p targets CDKN1B, which are 4 of 7 genes targeted by the rat miRNA signature in the present study. [score:11]
al, showed changes in miR-100, 199a-3p, 199a-5p, miR-143 and miR-145. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 12
We found that miR-146a, miR-9, miR-143 and let-7d might be connected with learning and memory ability through review of the literature and prediction of the target gene[16, 17, 18]. [score:3]
Four of the differentially expressed miRNAs (miR-9, miR-143, miR-146a, and let-7d) were selected for qPCR validation. [score:3]
Compared to the other 2 groups, 21 miRNAs are upregulated in 6-hour group as shown in the upper portion of Fig. 2, miR-9, miR-204, miR-335, miR-23a, miR-708, miR-146a, miR-325-5p, miR-106b, miR-143, miR-140, miR-376b-3p, miR-7a, miR-541, miR-185, miR-499, miR-127*, miR-320, miR-140*, miR-145*, miR-423*, miR-378. [score:3]
Four of the differentially expressed miRNAs (miR-9, miR-143, miR-146a, let-7d) were validated independently in samples from these 3 groups. [score:3]
[1 to 20 of 4 sentences]
17
[+] score: 12
For instance, the up-expressed miR-143 and miR-138 can, respectively, target the genes, HK2 and HK1, which are the crucial enzymes in glycolysis and so that lead to potential glycemia [28, 29]; miR-9 and miR-204 were reported that they can regulate the insulin secretion by targeting the gene, SIRT1 [30– 32], while miR-96 can decrease the expression of NOC2 which is involved in the insulin secretion [33]. [score:10]
The microRNAs filtered in intact comparison but not filtered in HFD comparison and no-T2D comparison, including miR-143-3p, miR-99a-5p, miR-138-5p, miR-1304-3p, and miR-33b-5p, might involve the progress of T2D fed with normal diets only. [score:1]
Among the 24 specific miRNAs, 13 of them, such as miR-182/196a/381/499a/99a [6], miR-183 [6, 23], miR-409 [23], miR-146b [6, 24], miR-143 [6, 24], miR-148a [24, 25], miR-204 [5], and miR-9 [6], have been reported to involve in T2D process in mouse or rat. [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 9
Other miRNAs from this paper: rno-mir-145, rno-mir-490
Villadsen et al. found that miR-143/-145 cluster, which directly targeted the PAI-1 3’UTR and reduced PAI-1 mRNA and protein levels, was down-regulated in all stages of bladder cancer and inversely correlated with PAI-1 expression. [score:9]
[1 to 20 of 1 sentences]
19
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-143 expression varied substantially among the 14 tissues examined (Figure 3). [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 9
Other miRNAs from this paper: rno-mir-19b-1, rno-mir-19b-2, rno-mir-145, rno-mir-146a
There are some miRNAs that have been reported to be differentially down-regulated (e. g., miR -29c, -195, -652) or upregulated (miR-146a, -21, miR-143, etc) in activated HSCs, indicating the expression level of miRNA were consistent at certain degree in the process of HSC activation. [score:9]
[1 to 20 of 1 sentences]
21
[+] score: 9
Other miRNAs from this paper: rno-mir-145
Rangrez et al. [25] showed that high Pi treatment causes down-regulation of miR-143 and miR-145 and concomitant up-regulation of their targets and synthetic/activated VSMC markers, such as Klf4 and Klf5. [score:9]
[1 to 20 of 1 sentences]
22
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
23
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, there were seven miRNAs that were only expressed at high levels in one neural tissue, for example let-7b, miR-16, miR-22, miR-206, and miR-143 specifically expressed in olfactory bulb (Fig. 3b). [score:5]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 6
It was found to be targeted by multiple microRNAs in our analysis, including miR-143, miR-30 family members, miR-140, miR-27b, miR-125a-5p, miR-128ab, and miR-342-3p. [score:3]
Among the important genes were Lifr, Acvr1c, and Pparγ which were found to be targeted by microRNAs in our dataset like miR-143, miR-30, miR-140, miR-27b, miR-125a, miR-128ab, miR-342, miR-26ab, miR-181, miR-150, miR-23ab and miR-425. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This spatial pattern of expression closely mirrors that of miR-23a, miR-143, and miR-150, all of which putatively target the Hoxa11 mRNA. [score:5]
[1 to 20 of 1 sentences]
26
[+] score: 5
To select an effective micro RNA target for our glioma-specific oncolytic virus, we studied miR124, miR143 and miR145 expression profiles in a panel of different human tissues and found that the miRNA 124 level is significantly higher in human brain tissue (Figure 3A). [score:5]
[1 to 20 of 1 sentences]
27
[+] score: 5
Importantly, miR-143/145 complex regulates the major phenotypic regulator of VSMC myocardin such that decreased expression converts VSMC to a more proliferative, de-differentiated cell [2], [16]. [score:5]
[1 to 20 of 1 sentences]
28
[+] score: 5
Importantly, the expression of hematopoiesis -associated miRNA (miR-451), brain-enriched miRNA (miR-143), hepatoblastoma -associated miRNA (miR-125) and of the short non-coding RNA RNU6 remained unchanged during the observed period (Fig. 6, lower row), indicating that the amount of these vesicle -associated miRNAs is not modulated at 2, 4 and 6 days after PHx. [score:3]
Other small non-coding RNAs included in the panel [i. e., RNU6, miR-143, miR-451 and miR-125 (close to significance, P = 0.057)] shows a constant expression throughout 2, 4 and 6 days after PHx and a trend of downr-egulation compared to the expression measured at day 0 (See Fig. 7, lower row). [score:2]
[1 to 20 of 2 sentences]
29
[+] score: 4
Fang R. Xiao T. Fang Z. Sun Y. Li F. Gao Y. Feng Y. Li L. Wang Y. Liu X. Chen H. Liu X. Y. Ji H. (2012) MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 gene. [score:4]
[1 to 20 of 1 sentences]
30
[+] score: 4
For instance, it was recently reported that lengthy treatment of vascular smooth muscle cells with PDGF for 24 hours inhibits p53 and miR-143/145 resulting in podosome formation [23], [46]. [score:3]
It would be of interest to investigate whether regulation of CDR formation by p53 also involves miR-143/145, which regulates the switch of vascular smooth muscle cells from the contractile to synthetic phenotypes [47]. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 4
Cordes et al. found that reducing miRNA-143 levels could inhibit adipocyte differentiation in vitro, suggesting that miRNAs may play a significant role in the renin-angiotensin system (RAAS)—an important modulator of systemic blood pressure [11]. [score:3]
Interestingly, some studies [27– 29] have shown that miR-143 and miR-145 play an important role in switching the phenotypes of smooth muscle cells during vascular remo deling. [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 4
Src is a component in a miRNA143/145 pathway that regulates podosome formation [7]. [score:2]
Recently, Quintavalle and co-workers observed podosome formation ex vivo in aortas of miRNA-143(145) knockout mice [7], further implicating podosomes as possible contributors to VSMC migration. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 4
In the context of development, higher detected levels of miRNA in colostrum whey are interesting because miR-143, miR-148b-3p, and miR-141 are known to regulate intestinal function [41], [42] and miR-107 and miR-370 are known to modulate carbohydrate and lipid metabolism [27], [33]. [score:3]
On the other hand, other miRNAs such as, let-7i, miR-143, miR-148b-3p, miR-15b, miR-17-5p, miR-24, miR-27b, miR-92a, miR-106b, miR-125b-5p, miR-181a, miR-181c, miR-181d, miR-200c, miR-375, miR-107, miR-141, and miR-370, were present at higher levels in colostrum whey than in mature milk whey (Fig. 6). [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 4
A number of miRs, such as, miR-1, miR-21, miR-29, miR-31, miR-143/145 and miR-221/222, were verified to be involved in neointimal hyperplasia by regulating the functions of VSMCs [11]. [score:2]
Recent studies have identified that many miRs [11], such as miR-1, miR-21, miR-29, miR-31, miR-143/145, and miR-221/222, play important roles in neointimal hyperplasia by regulating the functions of VSMCs. [score:2]
[1 to 20 of 2 sentences]
35
[+] score: 4
Circular RNA DLGAP4 ameliorates ischemic stroke outcomes by targeting miR-143 to regulate endothelial-mesenchymal transition associated with blood-brain barrier integrity. [score:4]
[1 to 20 of 1 sentences]
36
[+] score: 4
Other miRNAs from this paper: hsa-mir-143, hsa-mir-145, rno-mir-145
It was reported that the tumor suppressors miR-143 and miR-145 could modulate vascular smooth muscle cell differentiation by inactivating Notch-1 signaling [15], but the specific role of miR-145 in regulating the Notch signaling in malignant glioma is unknown. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
It has been reported that the expression of miR-143, let-7a, miR-15b is under negative control of follicle stimulating hormone (FSH) during follicular development [36] and may be involved in FSH -induced rat granulosa cell progesterone production [37]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 3
Among the 12 selected miRNAs, two were lung-specific (miR-195 and miR-200c), one was kidney-specific (miR-10a), and three were co-expressed in the lung and heart (miR-126, miR-143 and miR-145) as determined by HSD, OSI and two-fold criteria. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
The mir-143 has recently emerged as an obesity -induced miRNA that inhibits INS-stimulated Akt activation and impairs glucose metabolism [93]. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
The expression of miR-122, miR-93, miR-103, miR-107, miR-206, miR-143, miR-24, and miR-106b were reduced upon treatment with Tg and Tm in H9c2 cells. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Serum (e) and lung (f) levels of miR-143-3p in normal, IMD, and non-IMD rats. [score:1]
In contrast, there was no significant difference in the serum and lung levels of miR-150-5p, miR-143-3p, and miR-223-3p of among the normal, IMD, and non-IMD rats (P > 0.05, Fig.   3c–h). [score:1]
Fig. 3Validation of miR130a-3p, miR-150-5p, miR-143-3p, and miR-223-3p in serum and lung tissues by qRT-PCR. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 3
Levels of miR-143/145 expression were increased in CLs from PAH subjects as compared to control specimens from control unremo deled PA, whereas MiR-143/145 expression was decreased in PLs as compared to CLs and unremo deled control PA. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Interestingly, LNA probes for miR-143 and -153 again did not produce any positive signal (data not shown). [score:1]
Again, the miR-143 probe did not reveal any signal in these experiments (data not shown). [score:1]
We were able to detect miR-10a, -29a, -98, -99a, -124a, -134, and -183, but not miR-122, miR-143, and miR-153 even after 50 cycles of PCR, although they were previously reported from TG via Northern analysis [11]. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 2
Since the first report on the role of miRNA in VSMCs was published in 2007, miRNAs such as miR-143/145, miR-21, and miR-20a have been shown to regulate various aspects of VSMC biology 18– 21. [score:2]
[1 to 20 of 1 sentences]
47
[+] score: 2
And Mir375 is one of a number of involved in insulin synthesis and secretion (for instance Mir9 and Mir29a/b/c), insulin sensitivity in target tissue (Mir143 and Mir29) or glucose and lipid metabolism (Mir103/107 and Mir122) and thus, having potential roles in diabetes [see for instance, [52], [53]. [score:2]
[1 to 20 of 1 sentences]
48
[+] score: 2
Analysis of the sequences attributed to miR-143 (Fig. 4D) showed that the mature sequence was only the 4 [th] most common sequence, indeed the most common miR-143 sequence is an isomiR with an unambiguous post-transcriptional modification, that is a non-templated addition of A at nt no. [score:1]
miR-22, miR-486, miR133a and miR-143 were detected at greater than 100,000 RPMM. [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 2
Zhang et al. indicated that miR-143 mediates the proliferative signaling pathway of FSH and further regulates estradiol production [15]. [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 1
MiR-143 and miR-145 control odontoblast differentiation and dentin formation through KLF4 and OSX transcriptional factor signaling pathways [10]. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
This was done independently for each of the 12 pools in two alternative ways: 1) In “within-library normalization” the number of reads assigned to a unique identifier name in a given library (e. g. rno-miR-143-3p in library (i)) was normalized to the total number of reads identified by all identifiers in that library. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
Other miRNAs from this paper: rno-mir-194-1, rno-mir-194-2
For example, miR-194 or miR-143 strongly influences adipocyte differentiation [60– 62]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
TCA cycle intermediates including citrate, succinate, 2-oxoglutarate and fumarate are positively correlated with miR-143, miR-126-3p, miR-146a, miR-150 and miR-155. [score:1]
[1 to 20 of 1 sentences]