sort by

55 publications mentioning osa-MIR319a

Open access articles that are associated with the species Oryza sativa and mention the gene name MIR319a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 276
These results provide direct evidence that PvPCF5 is a target of Pvi-MIR319a and that Pvi-MIR319a can regulate the expression of PvPCF5, leading to a significantly lower expression level by direct cleavage (Supplementary Figure S6). [score:10]
In this study, higher levels of target transcripts enabled leaves to maintain normal growth, whereas target mRNAs were cleaved by overexpressing Pvi-MIR319a, thereby leading to broad leaves and abnormal developmental patterns. [score:8]
Switchgrass Pvi-MIR319a Regulates Expression of Putative Target Genes in Transgenic Rice PlantsWe performed a series of qRT-PCR tests to analyze the transcript levels of five TCP genesin Pvi-MIR319a -overexpressing rice. [score:8]
The obvious decrease in the expression of the predicted targets was similar to that observed in osa-miR319a -overexpressing rice (Yang et al., 2013). [score:7]
FIGURE 3Expression levels of putative targets were analysed in Pvi-MIR319a -overexpressing rice plants and wild types by real-time quantitative PCR. [score:7]
Based on the abnormal leaf phenotype of transgenic plants and the early functional studies on TCP transcription factors, we think that the continuous expression of Pvi-MIR319a leads to a series of pleiotropic phenotypic changes in transgenic rice plants due to the negative regulation of its possible target genes. [score:6]
Switchgrass Pvi-MIR319a Regulates Expression of Putative Target Genes in Transgenic Rice Plants. [score:6]
High levels of miR319 or downregulation of its target genes leads to a broader leaf phenotype in arabidopsis (Palatnik et al., 2003), and similar results were found in snapdragons, tomatoes, rice, and other plants (Ori et al., 2007; Yang et al., 2013). [score:6]
Pvi-MIR319a and PvPCF5 Transient ExpressionTo observe whether PvPCF5 is a Pvi-MIR319a target gene, Nicotiana benthamiana leaves were used in this experiment (Llave and Carrington, 2002). [score:5]
Next, we plan to express the Pvi-MIR319a and PvPCF5 into switchgrass itself, with its own promoters, constitutive promoters or tissue-specific expression promoters, respectively. [score:5]
The expression level of PvPCF5 had a relatively negative correlation with the expression of Pvi-MIR319a, at least in young and mature panicles. [score:5]
Expression Profile of PvPCF5 PvPCF5 was identified as one of the target gene of Pvi-MIR319a in switchgrass. [score:5]
FIGURE 4 PvPCF5 is a miR319a target supported by transient expression assay in Nicotiana benthamiana. [score:4]
Taken together, the results imply that Pvi-MIR319a and its targets play critical roles in plant development. [score:4]
Overexpression of Switchgrass Pvi-MIR319a Results in Pleiotropic Phenotype Changes in Transgenic Rice PlantsAs a highly conserved ancient miRNA, miR319 plays important roles in plant development (Jones-Rhoades et al., 2006; Yang et al., 2013; Zhou et al., 2013; Zhou and Luo, 2014). [score:4]
miR319a targeting of TCP4 is critical for petal growth and development in Arabidopsis. [score:4]
Analysis of transgenic rice plants (Figure 2) constitutively expressing Pvi-MIR319a showed that transgenic plants exhibit very distinct phenotypes during the life cycle, including broader and slightly curly leaf blades, shorter plants, and delayed development. [score:4]
The recent studies showed that overexpression of miR319 led to abnormal development and tolerance to stress in several transgenic plants (Yang et al., 2013; Zhou et al., 2013; Wang et al., 2014; He et al., 2014; Zhou and Luo, 2014; Li et al., 2016). [score:4]
Transgenic rice plants overexpressing Pvi-MIR319a were obtained to identify whether overexpressing plants had different phenotypes and growth conditions compared with wild-type plants. [score:4]
We also isolated and identified a putative target gene (PvPCF5) of Pvi-MIR319a in switchgrass; this is a nuclear localization protein with transcriptional activation activity that is negatively regulated by Pvi-MIR319a. [score:4]
It is possible that the ectopic expression of Pvi-MIR319a cloned from switchgrass could affect the normal growth and development of transgenic rice plants, which would help in examining the biological function of the switchgrass miRNA using reverse genetic analysis. [score:4]
To determine that PvPCF5 is an important target of Pvi-MIR319a, a rapid Agrobacterium -mediated transient expression assay was performed in N. benthamiana. [score:4]
We hypothesize that mRNAs from the predicted target genes may be directly degraded by Pvi-MIR319a due to the high degree of homology between Pvi-MIR319a and Osa-miR319a. [score:4]
It has been reported that miR319 -targeted TCPs are involved in leaf development in eudicot species, such as arabidopsis and tomato (Nag et al., 2009; Martín-Trillo and Cubas, 2010). [score:4]
Pvi-MIR319a transcript showed a higher expression level in young panicles, indicating that this gene may plays an important role in inflorescence development (Figure 1B). [score:4]
It suggests that Pvi-MIR319a and its target genes may be used as potential genetic regulators for future switchgrass genetic improvement. [score:4]
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
We performed a series of qRT-PCR tests to analyze the transcript levels of five TCP genesin Pvi-MIR319a -overexpressing rice. [score:3]
MicroRNA319 positively regulates cold tolerance by targeting OsPCF6 and OsTCP21 in rice (Oryza sativa L. ). [score:3]
In addition, Zhou et al. (2013) found that transgenic creeping bentgrass (Agrostis stolonifera) overexpressing Osa-miR319a displayed morphological changes in leaves and stems with a parallel increased tolerance to salinity and drought stress (Zhou et al., 2010, 2013; Yang et al., 2013). [score:3]
Overexpression of Pvi-MIR319a in transgenic rice increased leaf width, reduced plant height, and delayed heading time. [score:3]
The expression level of Pvi-MIR319a was low in roots, stems, and mature panicles. [score:3]
Crinkled leaves appear in transgenic dicotyledonous plants ectopically expressing miR319 but not in transgenic monocotyledonous plants. [score:3]
The abundance of Pvi-MIR319a precursors in transgenic plants was higher than that in control plants (Figure 2B), suggesting the Pvi-MIR319a fusion plasmids, driven by the 35S promoter, were successfully expressed in rice. [score:3]
Generation of Transgenic Rice Plants Overexpressing Pvi-MIR319a. [score:3]
PvPCF5 is a miR319a Target Gene in SwitchgrassThe gene sequence of PvPCF5 was cloned and identified. [score:3]
This is similar to the case in rice, where the expression level of miR319 was high only in young panicles, low in other tissues, and lowest in mature leaves and mature panicles (Yang et al., 2013). [score:3]
FIGURE 1 Predicted stem-loop structure and expression profile analysis of pvi-miR319a in switchgrass. [score:3]
PvPCF5 is a miR319a Target Gene in Switchgrass. [score:3]
Pvi-MIR319a Expression Analysis. [score:3]
Control of jasmonate biosynthesis and senescence by miR319 targets. [score:3]
PvPCF5 was identified as one of the target gene of Pvi-MIR319a in switchgrass. [score:3]
The results showed that only tobacco leaves injected with single 35S::PvPCF5-GFP constructs or empty vectors generated GFP fluorescence, whereas co -expression with 35S:: Pvi-MIR319a led to a notably weaker GFP signal (Figure 4). [score:3]
We noticed that the similar report was appear in Arabidopsis thaliana, overexpression miR319 (jaw-D mutants) lead the late flowering in Arabidopsis thaliana (Schommer et al., 2008). [score:3]
Overexpression of Switchgrass Pvi-MIR319a Results in Pleiotropic Phenotype Changes in Transgenic Rice Plants. [score:3]
Very similar leaf phenotypes were observed in transgenic rice/bentgrass overexpressing osa-miR319 (Yang et al., 2013; Zhou et al., 2013; Zhou and Luo, 2014). [score:3]
Pvi-MIR319a and PvPCF5 Transient Expression. [score:3]
To observe whether PvPCF5 is a Pvi-MIR319a target gene, Nicotiana benthamiana leaves were used in this experiment (Llave and Carrington, 2002). [score:3]
The phylogenetic tree (Figure 6C) indicated that PvPCF5, targeted by Pvi-MIR319a, was clustered in the CIN subfamily, and AtTCP4 was most closely related to PvPCF5. [score:3]
Pvi-MIR319a Expression AnalysisIn plants, a long primary miRNA is first transcripted under the guidance of the miRNA gene. [score:3]
FIGURE 2Identification and phenotypes analysis of the Pvi-MIR319a -overexpressing transgenic plants. [score:3]
These data suggest that Pvi-MIR319a and its targets may possess important biological functions in switchgrass. [score:3]
Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. [score:3]
To determine the expression level of Pvi-MIR319a, four transgenic lines were analyzed using qRT-PCR. [score:3]
Cloning of the Pvi-MIR319a Gene, Construction of Plant Expression Vectors, and Rice TransformationThe Osa-MIR319a sequence (ID: MI0001098) was downloaded from the miRNA database [1] (Kozomara and Griffiths-Jones, 2013). [score:3]
Regulation of LANCEOLATE by miR319 is required for compound-leaf development in tomato. [score:3]
Cloning of the Pvi-MIR319a Gene, Construction of Plant Expression Vectors, and Rice Transformation. [score:3]
FIGURE S6 | The target site between Pvi-MIR319a and PvPCF5. [score:3]
This shows that the PvPCF5 levels were markedly decreased when co-expressed with 35S:: Pvi-MIR319a. [score:3]
Overexpression of Pvi-MIR319a in rice increased the number of leaf veins and led to broader leaves with a larger leaf area (Figures 2C– E). [score:3]
Overexpression of microRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerance in rice (Oryza sativa L. ). [score:2]
Pvi-MIR319a -overexpressing transgenic rice lines were used to investigate the role of miR319 in plant morphological development. [score:2]
As a highly conserved ancient miRNA, miR319 plays important roles in plant development (Jones-Rhoades et al., 2006; Yang et al., 2013; Zhou et al., 2013; Zhou and Luo, 2014). [score:2]
Pvi-MIR319a overexpression transgenic rice plants delayed flowering by about 14–20 days compared with those of wild type lines. [score:2]
This result is consistent with the findings reported by Nag et al. (2009) with regard to the role of miR319a in flower development (Nag et al., 2009). [score:2]
To overexpress the switchgrass Pvi-MIR319a gene in rice, Pvi-MIR319a cDNA containing a stem-loop structure was cloned via RT-PCR amplification using the gene-specific primers 5′- TCTAGATTGAGTTTATGGCTTCTCTGGAAGA-3′ and 5′- GTCGACTGAGGTGTTCTATTGGTAGCCCAA -3′; the cloned DNA fragment was then inserted into the Xba I and Sal I sites of the binary vector pZH01, producing p35S- Pvi-MIR319a/p35S-hyg. [score:2]
To determine whether Pvi-MIR319a plays roles in different plant tissues and developmental stages, we conducted quantitative real-time PCR of Pvi-MIR319a transcripts in roots, stems, leaf sheaths, leaves, and panicles. [score:2]
The enlarged site is complete sequence of mature Pvi-miR319a. [score:1]
Based on the miRNA database [6], two members (Osa-miR319a and Osa-miR319b) of the rice miR319 family have common mature miRNA sequences (Yang et al., 2013). [score:1]
Those results suggest that the function of miR319 in flowering may conservative, and it deserves study deeper in the future. [score:1]
Although the role of miR319 in leaf morphogenesis is highly conserved, there are several differences in leaf phenotype between dicotyledonous and monocotyledonous plants. [score:1]
FIGURE S1 | The information of Pvi-MIR319 sequence. [score:1]
Fusion plasmids (35S::PvPCF5-GFP and 35S:: Pvi-MIR319a) were constructed and introduced into Agrobacterium strain EH105 with a control vector. [score:1]
N. benthamiana leaves were injected with Agrobacterium, respectively, carrying the empty vector (LC) (a); 35S::PvPCF-GFP (b); 35S::PvPCF-GFP plus 35S:: Pvi-MIR319a (c); and 35S:: Pvi-MIR319a (d). [score:1]
We could use the known information of the rice miR319 to identify and clone its homologs in switchgrass. [score:1]
Using the stem-loop sequences of the rice miR319 precursor genes as a reference, we found an EST (ID: FL985594) with a length of 748 bp from switchgrass (P. virgatum) by BLAST search [7] (Supplementary Figure S1). [score:1]
These results suggest that the function of miR319 in leaf morphogenesis is high conversed in grass family (Poaceae). [score:1]
Generation of Transgenic Rice Plants Overexpressing Pvi-MIR319aTo investigate the function of Pvi-MIR319a, Pvi-MIR319a gene under the control of 35S promoter, were introduced into rice (Figure 2A). [score:1]
Almost all TCP family members with miR319 -binding sites belong to the CIN subgroup, including OsPCF5 (Yang et al., 2013). [score:1]
FIGURE S4 | Phylogenetic tree analysis of mature miR319a. [score:1]
The Osa-MIR319a sequence (ID: MI0001098) was downloaded from the miRNA database [1] (Kozomara and Griffiths-Jones, 2013). [score:1]
Based on the highly conserved roles of miR319, we hypothesize that Pvi-MIR319a may play a similar role in leaf morphogenesis and lead to similar leaf phenotypes in monocotyledonous plants (Yang et al., 2013; Zhou et al., 2013). [score:1]
Transcripts of Pvi-MIR319a showed a significantly higher accumulation in transgenic rice plants than that in WT controls. [score:1]
And the stem-loop structure of this miR319a was found (Figure 1A and Supplementary Figure S4), So, we named it as Pvi-MIR319a (P. virgatum MIR319a). [score:1]
High levels of Osa-miR319 in transgenic rice led to wider leaf blades and significantly enhanced cold tolerance in acclimated transgenic plants (Yang et al., 2013). [score:1]
The PvPCF5 coding regions were inserted into an pEZR(K)-LC vector (LC) containing the CaMV35S promoter and green fluorescence protein (GFP) to generate 35S::PvPCF5-GFP (LC-PCF5), while the Pvi-MIR319a was inserted into the LC vector that lack GFP. [score:1]
However, few studies have examined the roles played by several important microRNAs, such as miR319, in switchgrass. [score:1]
This suggests that the EST of switchgrass contains the miR319a precursor sequence. [score:1]
The miR319 sequences from rice and switchgrass showed that the two mature regions were in complete agreement (Supplementary Figure S2). [score:1]
By searching with this sequence in the NCBI, we obtained the putative Pvi-MIR319a EST sequence from switchgrass. [score:1]
In plants, microRNA319 (miR319) is one of the most conserved and ancient microRNA families, which was found in diverse plant species from moss to flowering plants (Palatnik et al., 2003, 2007; Pandey and Baldwin, 2007; Cuperus et al., 2011). [score:1]
Sequence similarity analysis showed that EST has substantial similarity with the osa-miR319a precursor gene (Supplementary Figure S3). [score:1]
[1 to 20 of 92 sentences]
2
[+] score: 87
Furthermore, cold stress osa-miR319b expression was down-regulated while the expression of miR319 -targeted genes was up-regulated. [score:13]
Diverse plant species endure cold stress to varying degrees, and miR319 was up-regulated in two varieties of sugarcane [32] and down-regulated in the two major subspecies of rice [13] exposed to cold stress. [score:7]
The study by Yang observed that down -regulating the expression of either of the two miR319 -targeted genes, OsPCF5 and OsPCF6, in RNAi plants also resulted in enhanced cold tolerance. [score:6]
In rice, expression of Osa-miR319 was down-regulated by cold stress [13]. [score:6]
Moreover, the miR319 -targeted genes were up-regulated by low temperature treatments, the inverse-correlated with Osa-miR319b. [score:6]
However, little is known about the regulatory relationship between miR319 and its targets, OsPCF6 and OsTCP21, under cold stress. [score:4]
To elucidate the regulatory relationship between OsmiR319 and OsPCF6/ OsTCP21, we evaluated the effect of Osa-miR319 overexpression on OsPCF6 and OsTCP21 expression under cold stress. [score:4]
Microarray data of the shoot apical meristem of miR319 transgenic plants, compared to wild-type (WT), showed that expression of all miR319 -targeted TCP genes decreased up to 30-fold, which strongly indicated that TCP genes were degraded by miR319 activity [20], [28], [24]. [score:4]
Collectively, the results suggested that, as Osa-miR319 targets, OsPCF6 and OsTCP21 negatively regulated plant cold tolerance. [score:4]
MiR319 was supposed to participate in plant cold tolerance by regulating its target genes or functioning together with other miRNAs [27]. [score:4]
It has been reported that miR319 targeted TEOSINTE BRANCHED/CYCLOIDEA/PCF (TCP) genes, the plant-specific transcription factors containing bHLH motifs that allow DNA binding and protein-protein interaction [22], [23], [24], [25], [26], [27]. [score:3]
Previous studies showed that miR319-TCPs regulated leaf developmental processes, including leaf senescence, cell proliferation, and cell differentiation [20], [29], [30]. [score:3]
In rice, miR319 was predicted to target five TCP genes, OsPCF5, OsPCF6, OsPCF7, OsPCF8, and OsTCP21. [score:3]
In sugarcane, changes in miR319 expression under cold stress were observed in both roots and shoots [31]. [score:3]
This result is generally similar to the larger leaves phenotype observed in transgenic dicotyledonous plants with miR319 overexpression [18], [20], [22]. [score:3]
In previous study, ectopic expression of miR319 induced larger leaf blades and continuous growth of leaf margins in snapdragon, Arabidopsis, tomato and other species though each with its distinct leaf form [20], [22]. [score:3]
Expression of TCPs, lacking the miR319 recognition site were not affected. [score:3]
In previous studies, we constructed a rice miRNA expression profile under cold stress based on the microarray data, and identified a total of 18 cold stress responsive miRNAs, including Osa-miR319. [score:3]
The miR319 family is one of the most ancient and conserved miRNA families, and has been found in a large number of plant species, from Physcomitrella to flowering plants [14], [15], [16], [17], [18], [19]. [score:1]
MiR319, previously known as ‘miR-JAW’, was firstly described in Arabidopsis because of its role in controlling leaf morphogenesis [20], [21]. [score:1]
In this study, we further characterized the biological function of Osa-miR319 in response to cold stress by using overexpression transgenic lines. [score:1]
In addition, several researchers have suggested the involvement of miR319 in the cold stress response. [score:1]
In previous studies, we identified a total of 18 cold stress responsive miRNAs using microarray data, including miR-156k, miR-166k, miR-166m, miR-167a/b/c, miR-168b, miR-169e, miR-169f, miR-169h, miR-171a, miR-535, miR-319a/b, miR-1884b, miR-444a. [score:1]
[1 to 20 of 23 sentences]
3
[+] score: 53
Overexpression of miR319 in Chinese cabbage not only led to altered leaf development, also the cabbage heads were rounder than in cabbage with low miR319 expression and higher expression of its target gene BrpTCP4-1 (Mao et al., 2014). [score:10]
Jaw-D is an overexpressor of the microRNA miR319a in which the CIN-like class II TCPs TCP2, TCP3, TCP4, TCP10, and TCP24 are downregulated (Palatnik et al., 2003). [score:6]
Overexpression of miR319 in the monocot Agrostis stolonifera (creeping bentgrass) leads to downregulation of class II TCPs and to the formation of wider and thicker leaves that are different from the wild type (Zhou et al., 2013). [score:6]
miR319a targeting of TCP4 is critical for petal growth and development in Arabidopsis. [score:4]
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
Regulation of LANCEOLATE by miR319 is required for compound-leaf development in tomato. [score:3]
Also, miR319 overexpressing tomato leaves grow 3 months longer than wild type leaves and show the marks of late differentiation, which is a behavior that is identical to Arabidopsis jaw-D plants (Ori et al., 2007; Efroni et al., 2008). [score:3]
Overexpression of the tomato miR319 led to flowering with fewer leaves than in wild type tomato and it was shown that LA binds to the promoters of the tomato APETALA1 and FRUITFUL orthologs (Burko et al., 2013). [score:3]
La mutants exhibit simple leaves, whereas overexpression of miR319 without LA insensitivity to the microRNA leads to increased partitioning of the compound leaves. [score:3]
Recently, it was shown that miR319a-regulated TCP transcription factors act redundantly with NGATHA transcription factors to limit meristematic activity of leaf meristems during leaf development (Alvarez et al., 2016). [score:3]
Control of jasmonate biosynthesis and senescence by miR319 targets. [score:3]
microRNA319a -targeted Brassica rapa ssp. [score:2]
Nag et al. (2009) showed that this depends on miR319 regulation of TCP4. [score:2]
An ortholog of the Arabidopsis miR319-sensitive TCPs in tomato is LA and it is under the control of the tomato miR319 (Ori et al., 2007). [score:1]
[1 to 20 of 14 sentences]
4
[+] score: 20
Of the 21 common targets, most were conserved transcription factors for ancient miRNAs, including SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPLs) protein coding genes targeted by miR156/miR529, ARFs targeted by miR160, TCPs targeted by miR319, and MYBs targeted by miR159. [score:11]
Additionally, miR164 and miR319 are important for organ morphogenesis by targeting NAM, ATAF1/2 and CUC2 domain-containing proteins (NAC) and TEOSINTE BRANCHED1/CYCLOIDEA/PROLIFERATING (TCP) transcription factor families, respectively [12, 13]. [score:3]
In this study, osa-miR319 and osa-miR156abcdejl showed high abundance, but miR160abe was relatively low-expressed in all three libraries. [score:3]
By repressing TCPs, miR319 played a central role in coordinating multiple miRNAs (i. e., miR396 and miR164) and phytohormones (including auxin, ABA and GA) pathways to control lateral organ development [44, 45]. [score:2]
In particular, miR319, miR168, miR156, miR166, and miR159 were mapped with more than 10,000 reads (S1 Fig). [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 17
More complicatedly, the target genes of osa-miR319, LOC_Os03g57190 and LOC_Os07g05720, encode transcription factors belonging to TCP family, which was demonstrated to positively regulate the expression of miR164 at the transcriptional level in Arabidopsis [31]. [score:6]
Another interesting finding is that different from rice, in which miR159 and miR319 regulate distinct sets of target genes separately (MYB and TCP genes, respectively), miR159 and miR319 in Arabidopsis share an overlapping set of targets. [score:6]
Previous study indicates that although the sequences of miR159 and miR319 show high identity with each other, these two miRNA species possess specialized functions by regulating distinct sets of targets, i. e. MYB and TCP genes, separately [32]. [score:4]
Figure 6 osa-miR159-, osa-miR319-, osa-miR164-, and osa-miR395-involved subnetworks. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 16
Overexpression of miR319 caused plants to stay green much longer while compromised miR319 -dependent regulation of one of its main targets, TCP4, resulted in increased expression of genes that are normally active in older leaves [11]. [score:8]
In addition, many other targets, such as WRKY transcription factor 54, Vacuolar-sorting receptor 6, subtilisin, myb and scarecrow-like protein, targeted by osa-miR1851, PC-3p-35500_181, osa-miR5809, osa-miR319, osa-miR159 and osa-miR171, were reported to be involved in senescence [59]- [62] and were identified in the present study (Table 3, Table S5). [score:5]
Another miRNA, miR319, targeting TB1, CYC and PCF (TCP), has crucial function in repressing the onset of senescence. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 15
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively. [score:1]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
2* and miR319.1/miR319b. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
2, miR319a. [score:1]
2 AGGCAGTCTCTTTGGCTATC 366 miR319a + miR319a. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
2 AATGAATGATGCGGTAGACAAA 8 1,2,4,5 miR319a. [score:1]
Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
1*); specifically, miR319a, miR319a*, miR319b. [score:1]
1* (that is, miR319/miR319b*) in four plants, Arabidopsis, rice, Medicago and P. trichocarpa (ptc). [score:1]
[1 to 20 of 14 sentences]
8
[+] score: 15
Other miRNAs from this paper: osa-MIR319b, sbi-MIR319a, sbi-MIR319b
Whereas, motif 12, representing the target region of miR319, is specific to class II proteins and was detected in 15 TCP proteins (BdTCP4, OsTCP21, SbTCP3, SbTCP1, PCF6, BdTCP1, AtTCP24, AtTCP2, BdTCP14, PCF8, SbTCP18, AtTCP3, AtTCP4, BdTCP5 and PCF5) indicating the possibility of miRNA -mediated regulation of class II proteins. [score:4]
Both SbTCP1 and 3 contain target region of miR319 (motif 12) indicating conserved miRNA -mediated regulation of the orthologous genes in Sorghum as well. [score:4]
Both the genes in Arabidopsis and rice are regulated by miR319 and implicated in organ development and cold stress response, respectively. [score:3]
MEME motif analysis revealed that SbTCP7 contained the motif 12 that corresponds to miR319 binding site, suggesting that SbTCP7 might also be involved in regulation of abiotic stresses in Sorghum through similar mechanism as in rice. [score:2]
Negative regulation of PCF5 through miR319 confers increased tolerance against drought and salinity stress in rice 35 36. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 15
Other miRNAs from this paper: osa-MIR319b, bra-MIR319
Bresso E. G. Chorostecki U. Rodriguez R. E. Palatnik J. F. Schommer C. Spatial Control of Gene Expression by miR319-Regulated TCP Transcription Factors in Leaf DevelopmentPlant Physiol. [score:5]
AtTCP2, AtTCP3, AtTCP4, AtTCP10, and AtTCP24 of the CIN subfamily were the targeted genes of miR319, and they modulate leaf development in Arabidopsis [12, 13, 18, 29]. [score:4]
Some genes are known to participate in regulating the shape of leaves in Arabidopsis; BrpTCP4 was particularly reported to regulate the head shape of Chinese cabbage by miR319a [9]. [score:3]
The class II CIN-type genes, AtTCP2, AtTCP3, AtTCP4, AtTCP10, and AtTCP24, are regulated by miR319a and lead to serrated and crinkled leaves [17]. [score:2]
Most of the CIN subfamily members were the taget genes of miR319, such as BrTCP2, BrTCP3, BrTCP4, BrTCP10, and BrTCP24. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 14
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR529b, osa-MIR1425, osa-MIR1430, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1440a, osa-MIR531b, osa-MIR1847, osa-MIR1848, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1865, osa-MIR812f, osa-MIR1874, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1320, osa-MIR827, osa-MIR2090, osa-MIR396f, osa-MIR2118c, osa-MIR2863a, osa-MIR2863b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR3981, osa-MIR5082, osa-MIR2863c, osa-MIR5337a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1440b, osa-MIR818f, osa-MIR1861o
Moreover, the expression patterns of miR319, miR166, miR810, and miR1861 were in agreement with our study [21]. [score:3]
Interestingly, the expressions of miR171 and miR319 were not only increased, but also repressed during drought stress. [score:3]
Among them, 7 miRNAs, including miR156, miR168, miR169, miR171, miR319, miR396, and miR397 had the same expression pattern in our study. [score:3]
The expression profiles confirmed that miR169, miR397, miR528, miR1425, miR827, miR319a. [score:3]
In combination with prior reports, we identified 13 miRNAs, including miR156, miR164, miR166, miR167, miR169, miR171, miR444, miR397, miR528, miR1425, miR827, miR319a. [score:1]
Nine miRNAs, including miR408, miR810, miR319, miR2863, miR444, miR166, miR167, miR818, and miR1861 were also detected in our study. [score:1]
[1 to 20 of 6 sentences]
11
[+] score: 14
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR444a, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
A qRT-PCR -based assay for the expression of miRNAs under Cd stress in M. truncatula found that miR393, miR171, miR319, and miR529 were up-regulated, whereas miR166 and miR398 were down-regulated [16]. [score:8]
In M. truncatula, miR393, miR171, miR319, and miR529 were up-regulated, whereas miR166 and miR398 were down-regulated in response to Cd treatment as determined by a qRT-PCR -based assay [16]. [score:6]
[1 to 20 of 2 sentences]
12
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR440, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR1428a, osa-MIR169r, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1866, osa-MIR1862d, osa-MIR1862e, osa-MIR1877, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR2275a, osa-MIR2275b, osa-MIR2871a, osa-MIR2871b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g, osa-MIR2863c, osa-MIR5159, osa-MIR5337a, osa-MIR5485, osa-MIR2275c, osa-MIR2275d, osa-MIR5337b
For example, a genome-wide study conducted across different developmental stages of rice revealed that 16 miRNAs, including miR156, miR159 and miR168, were downregulated by drought stress, while 14 miRNAs, such as miR169, miR319 and miR395, were upregulated [42]. [score:8]
For example, miR167, miR393, miR396, miR529 have been shown to be regulated by drought stress [25, 42, 59], miR393 and miR396 were shown to be regulated by cold stress [25, 42, 59], and miR159, miR160, miR319, miR394, miR528, and miR530 were shown to be regulated by salt stress [25, 29, 59- 61]. [score:4]
[1 to 20 of 2 sentences]
13
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR396f, osa-MIR395x, osa-MIR395y, osa-MIR3980a, osa-MIR3980b, osa-MIR5794
QTL miRNA ID of target genes Target gene description qHT-6 osa-miR528-3p LOC_Os06g07530 Retrotransposon protein, putative qHT-8 osa-miR5794 LOC_Os08g31390 Retrotransposon protein osa-miR166a/c/e-5p LOC_Os08g33630 UPF0016 domain containing protein osa-miR166e-3p LOC_Os08g34740 SGT1 protein osa-miR3980a/b-3p LOC_Os08g34900 Pectinesterase qHT-12 osa-miR319a-3p. [score:5]
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
For example, miR319 positively regulates plant response to drought and salinity stress (Zhou et al., 2013). [score:2]
These miRNA families include the three conserved miRNA families, miR166, miR169, and miR319, which have been confirmed to play pivotal roles in other stresses (Zhou et al., 2010; Ni et al., 2013; Li Y. et al., 2014). [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
In Arabidopsis, miR156, miR158, miR159, miR165, miR167, miR168, miR169, miR171, miR319, miR393, miR394, miR396, and miR397 are up-regulated by salt stress while the expression of miR398 is down-regulated (Liu et al., 2008). [score:9]
A great number of miRNAs, for example, miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 have been identified to be regulated by drought in Arabidopsis (Liu et al., 2008). [score:2]
In rice, 14 miRNAs (miR159, miR169, miR171, miR319, miR395, miR474, miR845, miR851, miR854, miR896, miR901, miR903, miR1026, and miR1125) are significantly induced while 16 miRNAs are significantly repressed by drought (Zhao et al., 2007; Zhou et al., 2010). [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 9
Among the miRNAs showing less than a twofold change in response to NaCl, the maximum upregulation was observed for sma-miR319a and the maximum downregulation was observed for sma-miR156b (Fig.   2b). [score:7]
The reverse was true for other miRNAs, such as miR156a, miR159a, miR159c, miR168a, miR169a, miR169b, miR171b, miR172c, miR319a and miR398a (Fig.   2a, b) [58]. [score:1]
The maximum miRNA representation at up to 21 was observed in the miR166 family, and it was followed by 12 miRNAs in the miR396 family, 11 miRNAs each in the miR159 and miR319 miRNA families, and ten miRNAs in the miR156/157 family. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 8
For instance, miR397 overexpression was described to improve rice yield by increasing grain size and promoting panicle branching (Zhang et al. 2013), whereas rice plants overexpressing miR319 had wider leaf blades and enhanced cold tolerance (Yang and Huang 2014). [score:5]
While auxin signalling pathway is regulated by miR160, miR167, miR390 and miR393, the JA biosynthetic pathway is under the control of miR319 and miR159, and miR159 regulate the ABA signalling pathway (Curaba et al. 2014). [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 8
Four miRNAs (miR159, miR165/166, miR319) participate in regulation of various developmental processes by targeting the GAMYB, Homeodomain Leucine Zipper (HD-ZIP) and TCP transcription factors in Arabidopsis, respectively (Millar and Waterhouse, 2005; Jones-Rhoades et al., 2006; Mallory and Vaucheret, 2006; Jung et al., 2009; Rubio-Somoza and Weigel, 2011). [score:5]
Sliced microRNA targets and precise loop-first processing of MIR319 hairpins revealed by analysis of the Physcomitrella patens degradome. [score:3]
[1 to 20 of 2 sentences]
18
[+] score: 7
It was reported that miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 were up-regulated in salt stress in Arabidopsis (Liu et al., 2008), while Ath-miR398 was down-regulated under salt stress (Jagadeeswaran et al., 2009). [score:7]
[1 to 20 of 1 sentences]
19
[+] score: 7
For instance, we found that osa-miR319a was up-regulated under dehydration stress in erf71, which is consistent with the observations of a previous study (Zhou et al., 2010). [score:4]
The 8, 12, 2, and 5 predicted target genes of osa-miR319a were distributed in Modules 2 to 5, respectively. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 6
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR394a, ath-MIR394b, ath-MIR396a, ath-MIR396b, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, ath-MIR403, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR396e, ath-MIR856, ath-MIR858a, osa-MIR169r, osa-MIR396f, ath-MIR2111a, ath-MIR2111b, osa-MIR396g, osa-MIR396h, osa-MIR396d, ath-MIR858b, ath-MIR156i, ath-MIR156j
Further targets were predicted for certain more conserved miRNAs including miR166, miR167, miR319, miR 396 and miR408, miR856 and miR1310 (Additional file 2 Table S1). [score:3]
miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc. [score:1]
Most of the miRNA families were found to be conserved in a variety of plant species e. g. using a comparative genomics based strategy homologs of miR319, miR156/157, miR169, miR165/166, miR394 and miR159 were found in 51,45,41,40,40 and 30 diverse plant species respectively [38]. [score:1]
In addition, miR167 and miR394 were found to have some thousands to tens of thousands of redundancies while miR319, miR166 and miR156 had more than one hundred redundancies. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The high expression of 11 miRNAs (gma-miR164, miR167, miR168b, miR319a, miR396a, miR482b, miR482b*, miR2118a, miR2118b, miR1508a, and miR1509a) in soybean leaves has been verified by microarray analysis, as were low expression levels of miR169a, miR390c, miR1507c, and miR1510a [35]. [score:5]
MicroRNA chip experiments showed that eight miRNAs (miR156/157, miR167, miR168, miR319, miR159, miR894, miR1507, and miR1509) were induced by Pi starvation in soybean leaves, and seven miRNAs (miR159, miR894, miR1507, miR1509, miR396, miR474, and miR482) were induced in soybean roots by low P [31]. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR166c, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160f, osa-MIR164d, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR419, osa-MIR390, osa-MIR444a, osa-MIR528, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR529b, osa-MIR1425, osa-MIR1429, osa-MIR1431, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1441, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1853, osa-MIR1860, osa-MIR812f, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1319a, osa-MIR2096, osa-MIR2864, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR812n, osa-MIR812o, osa-MIR5161, osa-MIR5338, osa-MIR5512a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1319b, osa-MIR5512b, osa-MIR818f
However, over -expression of miR319, a sequence highly similar to miR159, decreases the levels of TCP transcription factors, then delays flowering in long days, stamen morphogenesis, and causes abortive stamens [22]. [score:3]
In addition, the read numbers of miR169b,c, miR319, miR818d, oru-miR117, oru-miR135, oru-miR139, and oru-miR180 were highest in CWR-F2. [score:1]
2. Pre-miR1850 and pre-miR444d both formed three mature miRNA sequences, and pre-miR319a formed two miRNAs* sequences corresponding to miR319a-5p, miR319a-3p and miR319a-3p. [score:1]
We identified only 48 complementary miRNAs* (3p sequences) corresponding to the miRNAs from 512 mature miRNA sequences, and miR319a had two different miRNAs*. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 5
For example, a study identified 18 cold-responsive rice miRNAs, including miR167 and miR319, using a microarray approach on a single variety (14), and most of the differentially regulated genes were down-regulated in a cold -treated environment. [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 5
Other miRNAs from this paper: osa-MIR319b
Schommer C. Palatnik J. F. Aggarwal P. Chetelat A. Cubas P. Farmer E. E. Nath U. Weigel D. Control of Jasmonate Biosynthesis and Senescence by miR319 TargetsPLoS Biol. [score:3]
In addition, a recent study showed that miR319-controlled TCP transcription factors were involved in regulating JA content and leaf senescence [55]. [score:2]
[1 to 20 of 2 sentences]
25
[+] score: 5
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
Several genes, such as ZmSNAC1 (Lu et al., 2012), TaNAC69 (Xue et al., 2011), CarNAC3 (Peng et al., 2009), miR319, AsNAC60 (Zhou et al., 2013), AhNAC2 (Liu et al., 2011), RhNAC2 or RhEXPA4 (Dai et al., 2012), ClNAC (Huang et al., 2012), CsNAM (Paul et al., 2012), SiNAC (Puranik et al., 2011), HSImyb and HSINAC (Robertson, 2004), and TaNAC2a, TaNAC4a, TaNAC6, and TaNAC4 (Tang et al., 2012; Xia et al., 2010a), were increased by drought and NaCl (Figure 5; Table 2). [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 5
We found that At2g33810 in the At2g33810/At2g33815 pair was a target of miR156 and At1g53230 in the At1g53230/At1g53233 pair was a target of miR319. [score:5]
[1 to 20 of 1 sentences]
27
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, osa-MIR414, osa-MIR437, osa-MIR390, osa-MIR440, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR531a, osa-MIR529b, osa-MIR1425, osa-MIR1427, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1439, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1846a, osa-MIR1846b, osa-MIR1859, osa-MIR1860, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1863a, osa-MIR1864, osa-MIR1865, osa-MIR1871, osa-MIR1874, osa-MIR1862d, osa-MIR1876, osa-MIR1862e, osa-MIR1878, osa-MIR1879, osa-MIR1319a, osa-MIR1846c, osa-MIR2055, osa-MIR1846e, osa-MIR2096, osa-MIR396f, osa-MIR2106, osa-MIR2120, osa-MIR2275a, osa-MIR2275b, osa-MIR2863a, osa-MIR2863b, osa-MIR2872, osa-MIR2875, osa-MIR2876, osa-MIR2877, osa-MIR2878, osa-MIR1863c, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1863b, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3981, osa-MIR5072, osa-MIR5073, osa-MIR5076, osa-MIR5079a, osa-MIR5082, osa-MIR5083, osa-MIR2863c, osa-MIR5150, osa-MIR5151, osa-MIR5155, osa-MIR5160, osa-MIR5161, osa-MIR5162, osa-MIR5484, osa-MIR5504, osa-MIR5505, osa-MIR5513, osa-MIR2275c, osa-MIR2275d, osa-MIR5788, osa-MIR5792, osa-MIR5809, osa-MIR5812, osa-MIR1319b, osa-MIR6246, osa-MIR6250, osa-MIR6253, osa-MIR5079b, osa-MIR531c
In comparison with control, the root tissue of N22 showed up-regulation of osa-miR5504, osa-miR169, osa-miR1427, osa-miR390, osa-miR166b-5p, osa-miR5082, and osa-miR319a-3p after SDS. [score:4]
osa-miR319 was suggested to be an oxidative stress-responsive miRNA family in rice (Li et al., 2011). [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR827, osa-MIR396f, bdi-MIR171a, bdi-MIR167a, bdi-MIR397a, bdi-MIR156a, bdi-MIR172d, bdi-MIR166a, bdi-MIR171c, bdi-MIR169b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR166f, bdi-MIR171b, bdi-MIR390a, bdi-MIR160a, bdi-MIR528, bdi-MIR395b, bdi-MIR166d, bdi-MIR171d, bdi-MIR167b, bdi-MIR166b, bdi-MIR160b, bdi-MIR164b, bdi-MIR167c, bdi-MIR396d, bdi-MIR169k, bdi-MIR168, bdi-MIR160c, bdi-MIR396c, bdi-MIR167d, bdi-MIR156b, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR396e, bdi-MIR156c, bdi-MIR172a, bdi-MIR396a, bdi-MIR166e, bdi-MIR166c, bdi-MIR169e, bdi-MIR394, bdi-MIR398a, bdi-MIR164a, bdi-MIR393a, bdi-MIR169a, bdi-MIR172b, bdi-MIR156d, bdi-MIR393b, bdi-MIR169h, bdi-MIR396b, bdi-MIR169c, bdi-MIR395c, bdi-MIR827, bdi-MIR166g, bdi-MIR319a, bdi-MIR395d, bdi-MIR398b, bdi-MIR164c, bdi-MIR169f, bdi-MIR162, bdi-MIR164e, bdi-MIR164f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, bdi-MIR529, bdi-MIR319b, bdi-MIR397b, bdi-MIR156e, bdi-MIR156f, bdi-MIR156g, bdi-MIR156h, bdi-MIR156i, bdi-MIR166h, bdi-MIR166i, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR156j, bdi-MIR160f, bdi-MIR166j, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR171e, bdi-MIR171f, bdi-MIR395q
The miR160a, miR164d, miR169f, miR172a, miR172b, miR319, miR390, miR393, miR394, miR395a, miR397a, miR529 and miR827 were moderately expressed, and were represented by the number of sequences varying between 10 and 100. [score:3]
Some miRNAs, including miR166, miR319, miR393, and miR396, respond to cold stress in Arabidopsis [16, 17], but in our experiment no obvious change was found for these miRNAs after the cold treatment. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, ctr-MIR171, osa-MIR395x, osa-MIR395y, osa-MIR1440b
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
For example, miR319, miR156/157, miR169, miR165/166, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [9]. [score:1]
[1 to 20 of 2 sentences]
30
[+] score: 4
Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 4
A similar study showed that miR156, miR166, miR171, miR172, miR319, miR164 along with their target genes, were differentially expressed in stress-tolerant maize hybrids compared with stress-sensitive lines [52]. [score:4]
[1 to 20 of 1 sentences]
32
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5083, ppe-MIR171f, ppe-MIR394a, ppe-MIR828, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR394b, ppe-MIR396a, ppe-MIR396b, ppe-MIR397, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, ppe-MIR403, ppe-MIR827, ppe-MIR858
The expression of 8 conserved (miR166, miR168, miR319, miR394, miR399, miR827, miR894 and miR5139) and six novel miRNAs (miRC1, miRC14, miRC16, miRC112, miRC179 and miRC181) showed no significant change in different tissues (Figs. 5A and 5B). [score:3]
Among the miRNA families in peach, miR156, miR159, miR160, miR166, miR171, miR319, miR390 and miR396 showed a high conservation in plants, indicating that these 12 peach miRNA families are ancient. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR528, osa-MIR529a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR815c, osa-MIR818d, osa-MIR529b, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR1436, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1858a, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR812f, osa-MIR1862d, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1428f, osa-MIR1428g, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR812n, osa-MIR812o, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1861o
MiR159, miR319, miR812, and miR819 target gene transcripts coding MYB family transcription factor (MYB), TCP family transcription factor (TCP), 1-aminocyclopropane-1-carboxylate oxidase protein (ACC), and BRASSINOSTEROID INSENSITIVE 1 -associated receptor kinase 1 precursor (BAK1), which are involved in the regulation of ABA, jasmonic acid, ethylene, and brassinosteroid homeostasis, respectively [21], [54], [60]. [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 4
High-throughput sequencing of miRNAs showed that 14 rice miRNA families (osa-miR156, miR160, miR164, miR166, miR167, miR168, miR171, miR319, miR396, miR397, miR408, miR528, miR530, miR820) were significantly down-regulated after drought treatment [23]. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR396e, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818b, osa-MIR169r, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
In addition, miR171 and miR319 expression is either increased or repressed, depending on the specific drought conditions [15]. [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR164f, osa-MIR390, osa-MIR439a, osa-MIR439b, osa-MIR439c, osa-MIR439d, osa-MIR439e, osa-MIR439f, osa-MIR439g, osa-MIR439h, osa-MIR439i, osa-MIR396e, osa-MIR444a, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR171a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, tae-MIR156, tae-MIR319, tae-MIR167b, tae-MIR169, tae-MIR444b, tae-MIR171b, tae-MIR396, tae-MIR167c, tae-MIR397
Some of these miRNA families (for example, miR319, miR390, and miR165/166) are conserved deeply, including in lower plants such as Physcometrella [26- 28]. [score:1]
MiR169 was represented by five members, miR156, miR165/166, miR167, miR170/171 and miR172 were represented by three members each, and miR159, miR319 and miR168 were represented by two members each in the library. [score:1]
These include miRNA156/157, miR159, miR160, miR164, miR165/166, miR167, miR168, miR169, miR170/171, miR172, miR319, miR390, miR393, miR396, miR397, miR399 and miR408, which are conserved in diverse plant species (Table 2). [score:1]
[1 to 20 of 3 sentences]
37
[+] score: 3
Rice ragged stunt virus (RRSV) and Rice black streaked dwarf virus (RBSDV) infections in rice increase the level of miR319, which suppresses jasmonic acid mediated antiviral defense in rice [10]. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Previous results showed that overexpression of miR164, miR159a, and miR319 affected members of the NAC, MYB, and TCP families of transcription factor genes, respectively [58– 60]. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
The tissue-specific expression patterns were presented for the conserved miRNAs, miR160, miR167, miR169, miR319, miR390 and miR396, and the less-conserved miRNAs, miR828, miR858 and miR2118 (Figure 2b). [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Other miRNAs from this paper: osa-MIR319b
For example, the miR319-regulated TCP (TEOSINTE BRANCHED/CYCLOIDEA/PCF) transcription factors regulate the JA biosynthesis gene LOX2, controlling JA content and affecting leaf senescence [47]. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Other miRNAs from this paper: osa-MIR319b
A recent study in creeping bentgrass showed that overexpressing Osa-miR319 exhibited improved salt and drought tolerance in transgenic plants also with remarkably wider leaves and thicker stems 45 46, but the detailed mechanism still needs to be elucidated. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1423, osa-MIR1425, osa-MIR1427, osa-MIR1428a, osa-MIR1429, osa-MIR1430, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1435, osa-MIR1436, osa-MIR1437a, osa-MIR1440a, osa-MIR1441, osa-MIR1442, osa-MIR1439, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1440b, osa-MIR818f, osa-MIR1437b
Of these, 7 miRNA families, i. e., miR156/157, miR160, miR159, miR319, miR165/166, miR390 and miR408 have been also found in primitive land plants such as Physcometrella and Selaginella suggesting that these are deeply conserved [18- 21]. [score:1]
Similarly, miR319 and miR397 are represented by one member each but represented by two loci in the rice genome. [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members. [score:1]
For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2). [score:1]
[1 to 20 of 2 sentences]
44
[+] score: 2
The resolution of northern blots did not permit distinction between family members, so that each band could contain multiple members of a family of miRNAs/miRNA*s. Using clustalW [60], we analyzed the conservation of precursor sequences of miR159, miR319, and miR394 in different plants (Figure S3). [score:1]
The resolution of northern blots did not permit distinction between family members, so that each band could contain multiple members of a family of miRNAs/miRNA*s. Using clustalW [60], we analyzed the conservation of precursor sequences of miR159, miR319, and miR394 in different plants (Figure S3). [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR820a, osa-MIR1423, osa-MIR1425, osa-MIR1432, osa-MIR169r, osa-MIR810b, osa-MIR1436, osa-MIR1441, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR827, osa-MIR396f, osa-MIR2873a, osa-MIR2878, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5071, osa-MIR5074, osa-MIR5075, osa-MIR5077, osa-MIR5080, osa-MIR5081, osa-MIR5144, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR5795, osa-MIR812s, osa-MIR5802, osa-MIR812t, osa-MIR812u, osa-MIR5805, osa-MIR812v, osa-MIR5807, osa-MIR2873c, osa-MIR6253, osa-MIR1861o
Previously reported variants that were observed within a ±2 nt range away from the 5′ or 3′ ends of the annotated miRNAs such as osa-miR156l [miRBase:MIMAT0001021], osa-miR156k [miRBase:MIMAT0001020], osa-miR167d-j, osa-miR319a/b, osa-miR820a-c and osa-miR1432-5p [miRBase:MIMAT0005966] [30] were among the many mature miRNA variants detected in our study (Additional file 5). [score:1]
Of these, 7 miRNA families, namely miR156/157, miR160, miR159, miR319, miR165/166, miR390 and miR408 were found in primitive land plants such as Physcomitrella and Selaginella suggesting that they are highly conserved over wide evolutionary distance [14]. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 2
Some novel miRNAs have been reported to regulate the pollen and spikelet fertility, such as miR159, miR172, miR319 and miR397 [20– 23]. [score:2]
[1 to 20 of 1 sentences]
47
[+] score: 2
Similarly, miR319 acts as a positive regulator of cold stress tolerance in rice [22]. [score:2]
[1 to 20 of 1 sentences]
48
[+] score: 1
2,e ATPase, AAA-type, core domain GO:0005783 Os08g0482700 osa-MIR444 Conserved hypothetical protein GO:0003674 Os04g0459600 osa-MIR442 Mog1/PsbP, alpha/beta/alpha sandwich domain NA Os05g0414700 osa-MIR403 Brassinosteroid insensitive 1 receptor kinase 1 GO:0005102 Os05g0557700 osa-MIR399j Conserved hypothetical protein GO:0005575 Os01g0850700 osa-MIR397b′ Cupredoxin domain containing protein GO:0009056 Os01g0121600 osa-MIR396c-3p Conserved hypothetical protein GO:0006810 Os01g0180800 osa-MIR396c Heat shock protein Hsp70 family protein GO:0005634 Os03g0225500 osa-MIR395f ′ Nucleoporin, Nup133/Nup155- GO:0005515 Os05g0574500 osa-MIR395c′o′ GTP -binding nuclear protein Ran1B GO:0005515 Os03g0195300 osa-MIR395 Low affinity sulfate transporter 3 GO:0016020 Os03g0559700 osa-MIR393ab′ Conserved hypothetical protein NA Os03g0388900 osa-MIR319a. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
Three P. taeda miRNA families, including pta-MIR319, pta-MIR398 and pta-MIR408, were not found in P. densata. [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
The similar length of conserved intergenic region surrounding MIR319a locus in orthologous species of Arabidopsis has already been reported [66]. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, ath-MIR167d, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR396a, ath-MIR396b, ath-MIR398a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR531a, osa-MIR1425, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1862f, osa-MIR1862g, ath-MIR5021, osa-MIR5072, osa-MIR5077, ath-MIR156i, ath-MIR156j, osa-MIR531c
6, miR319a. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
2-3p −1.169925001 Hypo-methylation 0.022704 * osa-miR319a-3p. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR418, osa-MIR396e, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR531b, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR531c
of loci miR156 ND d 1 miR159 MYB and TCP TFs e b 2 miR160 ND d 1 miR162 DICER-LIKE 1 b 1 miR164 ND a 1 miR166 HD-Zip TFs f, h, k h, k, n h, n c 9 miR167 Auxin response factors TFs a, d, f j d a 6 miR168 ARGONAUTE b 1 miR169 CCAAT binding factor and HAP2-like TFs n, p c 3 miR171 SCARECROW-like TFs c, e, f c c, d a 7 miR319 ND a 1 miR395 ATP sulphurylases i, j, k 3 miR396 GRF TFs, rhodenase-like, and kinesin-like protein B b 1 miR397 Laccases and beta-6 tubulin a a 2 miR399 Phosphatase TFs e b, e 3 miR418 ND x x 2 miR420 ND x x x 3 miR441 ND b a, b, c c 5 miR442 ND x x x 3 miR446 ND x x x 3 miR531 ND x x 2 miR535 ND x x x x 4 Total no. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
2 has 6 mismatched bases; osa-miR413 has 6 mismatched bases; osa-miR172a has 5 mismatched bases; osa-miR319a-5p has 5 mismatched bases. [score:1]
[1 to 20 of 1 sentences]