sort by

62 publications mentioning osa-MIR169j

Open access articles that are associated with the species Oryza sativa and mention the gene name MIR169j. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 219
Now that all the detected seven target genes can be down-regulated by miR169 at either transcriptional or translational level, and up-regulated by the miR169’s target mimicry, it is questionable whether all of them similarly or equally regulate rice immunity against M. oryzae. [score:14]
To figure out whether miR169 suppresses the expression of the other target genes at protein levels, we also tested the expression of two target genes by using the reporter system. [score:11]
Particularly, the total accumulation of all miR169 isoforms was highly up-regulated upon M. oryzae inoculation in LTH, but significantly down-regulated at 12 hpi, up-regulated at 24 hpi and back to the background level at 48 hpi in IRBL9-W (Figure 1D), which was consistent with the total reads in LTH and IRBLKm-Ts (in Supplementary Table S1 of Li et al., 2014). [score:10]
To further confirm the translation inhibition by miR169 on 3′-UTR of Os03g29760, we constructed the target mimicry of miR169a, MIM169a, which could act as a sponge to trap miR169a because of the insertion of three nucleotides between positions 10 and 11, and as a result, the cleavage on the formed double strand RNA was inhibited because of the loop formation at the mismatched nucleotides (Franco-Zorrilla et al., 2007). [score:9]
In addition, different miR169 isoforms may differentially regulate their target genes through transcript cleavage or translation inhibition. [score:8]
Taken together, these results confirmed that miR169 natively regulates rice immunity, whereas, its target genes, or some of its target genes, positively regulate rice immunity against M. oryzae. [score:7]
Nevertheless, each miR169 isoform may have its preferential target genes so that their expressions will be preferentially repressed when overexpressing a miR169 isoform. [score:7]
The indicated YFP-3′-UTR [Os03g29760] and YFP -based reporter constructs were transiently expressed alone or co-expressed with miR169a (C) or/and the miR169 target mimicry MIM169a (D) in Nicotiana benthamiana leaves using Agrobacterium -mediated infiltration at the indicated optical density (O. D. ) concentration. [score:7]
For example, in Arabidopsis, overexpression of miR169 abrogates the resistance phenotypes of clv1 and clv2, the mutants of the LRR-receptor-like kinases CLAVATA1 and CLAVATA2, to the bacterial wilt pathogen Ralstonia solanacearum via the suppression on NF-YA expressions (Hanemian et al., 2016). [score:7]
Indeed, the lesions on the leaves from transgenic lines were obviously smaller than that on the leaves from the control plants, and the fungal biomass on the transgenic lines were also decreased significantly than that on the control plants (Figure 6B), indicating that the up-regulation of miR169’s target genes alleviated rice susceptibility to M. oryzae. [score:6]
By examining the expression of miR169 target genes in transgenic lines and in susceptible/resistant accessions, we identified candidate NF-YA genes that might act as positive regulators for rice immunity. [score:6]
Artificial target mimicry sequences of miR169a were inserted into the IPS1 to replace the miR399 target site with primers miR169-IPS1-F, miR169-IPS1-R, miR169mimic-F, and miR169mimic-R (Supplementary Table S2) as described previously (Franco-Zorrilla et al., 2007), and cloned into KpnI- SpeI sites of binary vector 35S-pCAMBIA1300, resulting in the overexpression construct p35S:MIM169a. [score:6]
To express the YFP-tagged 3′-UTRs of target genes, the 3′-UTRs of Os03g29760 (NF-YA2), Os03g44540 (NF-YA3), and Os03g48970 (NF-YA4) containing the target site of miR169 were amplified from Nipponbare (NPB) cDNAs using gene-specific primers (Supplementary Table S2). [score:6]
In wheat, the expression of miR169 is reduced, whereas the expression of NF-YAs, are induced by N and P starvation (Qu et al., 2015). [score:5]
Expression of zma-miR169 miRNAs and their target ZmNF-YA genes in response to abiotic stress in maize leaves. [score:5]
On the other hand, the expression of Os03g29760 (NF-YA2) could also be suppressed by other miR169 isoforms via transcript cleavage, because its transcription was slightly decreased in the susceptible accession LTH upon M. oryzae infection, which was reversely correlated with the induced accumulation of miR169 isoforms (Figure 1C). [score:5]
Different Target Genes of miR169 are Differentially Expressed in Susceptible and Resistant Rice Accessions. [score:5]
In maize, the expression of Zma-miR169 and its target genes ZmNF-YAs is conversely responsive to drought, salt, and hormone stresses (Luan et al., 2014, 2015). [score:5]
Overexpressing miR169a Leads to Enhanced Susceptibility to M. oryzaeAll miR169 isoforms target the same eight NF-YA genes (Wu et al., 2009; Li Y. F. et al., 2010; Zhou et al., 2010) because of their high sequence identity (Supplementary Figure S1). [score:5]
Finally, although miR169 targets the same batch of NF-YA genes, different target genes may function differently. [score:5]
The three genes, Os03g07880 (NF-YA1), Os03g29760 (NF-YA2), and Os07g41720 (NF-YA6) most likely contribute to the resistant phenotype of IRBL9-W. FIGURE 7Differential expression of miR169’s target genes in susceptible and resistant accessions upon M. oryzae infection. [score:5]
The three genes, Os03g07880 (NF-YA1), Os03g29760 (NF-YA2), and Os07g41720 (NF-YA6) most likely contribute to the resistant phenotype of IRBL9-W. FIGURE 7Differential expression of miR169’s target genes in susceptible and resistant accessions upon M. oryzae infection. [score:5]
Thus, it is feasible to investigate the integrative role of all miR169 isoforms in rice immunity against M. oryzae by over expressing one of the miR169 isoforms, although the authentic miR169-NF-YA regulation module could be much more complicated due to different miR169 isoform has different expression pattern and is differentially responsive to different stimuli (Zhao et al., 2007, 2009). [score:4]
A miR169 isoform regulates specific NF-YA targets and root architecture in Arabidopsis. [score:4]
Rice contains 11 NF-YA genes that are classified into several clades in a phylogenetic tree (Petroni et al., 2012), eight of the NF-YA genes are identified to be the target of miR169 (Wu et al., 2009; Li Y. F. et al., 2010; Zhou et al., 2010). [score:3]
Members of miR-169 family are induced by high salinity and transiently inhibit the NF-YA transcription factor. [score:3]
In rice, eight of the 11 NF-YA genes are identified to be the authentic targets of miR169, including from NF-YA1 to NF-YA6, NF-YA10 and NF-YA11 (Wu et al., 2009; Li Y. F. et al., 2010; Zhou et al., 2010; Petroni et al., 2012). [score:3]
These results indicate that overexpressing miR169 can compromise rice defense responses so as to facilitate M. oryzae invasion at the early infection stage. [score:3]
All miR169 isoforms target the same eight NF-YA genes (Wu et al., 2009; Li Y. F. et al., 2010; Zhou et al., 2010) because of their high sequence identity (Supplementary Figure S1). [score:3]
In addition, different NF-YA genes are differentially induced by drought, salt and temperature stresses, but only OsNF-YA7 (Os08g09690), a non-target of miR169, is highly induced by drought and salt treatment (Lee et al., 2015). [score:3]
In addition, co -expression of miR169 isoforms and NF-YA5 in N. benthamiana revealed that miR169a was more efficient than miR169c in repressing NF-YA5 at transcriptional level (Li et al., 2008). [score:3]
Therefore, different target genes of miR169 are differently responsive to M. oryzae infection in the resistant and susceptible accessions and thus may act differently in rice immunity against M. oryzae. [score:3]
Taken together, our data demonstrate that miR169 acts as a negative regulator for rice immunity against M. oryzae. [score:2]
Recently, emerging evidence indicates that miR169/NF-YA modules also play roles in regulation of plant responses to biotic stresses. [score:2]
These literatures indicate that miR169/NF-YA modules regulate tolerance to abiotic stresses in both monocots and dicots. [score:2]
However, it is unclear what roles the miR169/NF-YA regulation modules play in rice immunity against M. oryzae. [score:2]
These data imply that miR169 may integratively act as a negative regulator in rice immunity against M. oryzae. [score:2]
Therefore, miR169 seems to negatively regulate rice immunity via multiple NF-YAs. [score:2]
Taken together, our data demonstrated that miR169 acts as a negative regulator in rice immunity against M. oryzae. [score:2]
Here, we provide data to show that miR169 acts as a negative regulator for rice immunity against the blast fungus M. oryzae. [score:2]
In alfalfa, miR169/NF-YA module is involved in regulating symbiotic nitrogen fixation (SNF) process (Kaur et al., 2014) and freezing tolerance (Shu et al., 2016). [score:2]
In rice, different miR169 isoforms are differentially accumulated in the resistant and susceptible accessions upon M. oryzae infection (Li et al., 2014, 2016), and are differentially responsive to elicitor treatment (Campo et al., 2013; Baldrich et al., 2015), indicating the involvement of miR169/NF-YA modules in rice responses to M. oryzae. [score:1]
Our data confirmed that the abundance of different miR169 isoforms was quite different, with the least abundant being for miR169f/g and miR169n/o, the most abundance being for miR169b/c, and the middle being for miR169a and miR169h/i/j/k/l/m (Figures 1B,C). [score:1]
The transcriptional level of miR169 family members was normalized to miR169a in untreated LTH (0 h). [score:1]
FIGURE 1Differential accumulation of miR169 in susceptible and resistant accessions upon Magnaporthe oryzae infection. [score:1]
Moreover, the accumulation pattern of miR169b/c was quite similar to the sum accumulation pattern of miR169 (Figure 1D). [score:1]
To figure out the integrative role of miR169 in rice immunity against the blast fungus, we first examined the abundance of different miR169 isoforms in the susceptible accession LTH and the resistant accession IRBL9-W upon M. oryzae infection. [score:1]
To address the question of how different miR169 isoforms are differentially responsive to M. oryzae infection, we examined the accumulation of the five most abundant miR169 isoforms in the susceptible accession LTH and the monogenic resistant accession IRBL9-W that contains the resistance (R) gene Pi-9 (Tsumematsu et al., 2000) and confers high resistance to M. oryzae (Khanna et al., 2015). [score:1]
In Arabidopsis, miR169/NF-YA module is linked with drought stress (Li et al., 2008), nitrogen (N) stress (Zhao et al., 2011; Liang et al., 2012), and associated with carbohydrate metabolism and cell expansion (Leyva-Gonzalez et al., 2012). [score:1]
Stress -induced early flowering is mediated by miR169 in Arabidopsis thaliana. [score:1]
Therefore, it is possible to engineer rice blast resistance via managing the accumulation of miR169. [score:1]
In fact, miR169 is a big microRNA family containing 17 known members representing nine different mature isoforms in rice (Zhao et al., 2007). [score:1]
It is intriguing that the accumulation of all the tested miR169 isoforms was increased in LTH upon M. oryzae infection, whereas, the accumulation of miR169b/c was quite stable in IRBL9-W, although the accumulation of the other miR169 isoforms was also increased at certain time points (Figures 1B,C). [score:1]
Among these miRNAs, miR169 family members were differentially accumulated in the resistant accession IRBLkm-Ts and the susceptible accession Lijiang xin Tuan Heigu (LTH) upon M. oryzae infection (Li et al., 2014). [score:1]
Different miR169 Isoforms Are Differentially Accumulated in the Susceptible and Resistant Accessions. [score:1]
Arabidopsis CLAVATA1 and CLAVATA2 receptors contribute to Ralstonia solanacearum pathogenicity through a miR169 -dependent pathway. [score:1]
The miR169 family is conserved and contains 17 members in rice (Zhao et al., 2007). [score:1]
Therefore, it is intriguing to investigate the integrative role of miR169 because all the miR169 isoforms share high sequence identity and target to the same batch of genes encoding nuclear transcription factor Y (NF-Y) (Wu et al., 2009; Li Y. F. et al., 2010; Zhou et al., 2010). [score:1]
However, the high abundance of miR169b/c might mask the fluctuation of the other isoforms so that its pattern is similar to the sum of miR169 (Figure 1D). [score:1]
Involvement of miR169 in the nitrogen-starvation responses in Arabidopsis. [score:1]
First, the sum accumulation of all miR169 isoforms was increased in the susceptible accession LTH, but fluctuated slightly in the resistant accession IRBL9-W (Figure 1), which was consistent with the previous high-throughput sequencing data in LTH and another resistant accession IRBLTs-Km (in Supplementary Table S1 of Li et al., 2014). [score:1]
[1 to 20 of 61 sentences]
[+] score: 96
Our subsequent data validated that two of the predicted target genes were down-regulated as the members of the miR-169 were induced by high salinity. [score:6]
We identified members of the miR-169 family as salt -induced miRNAs and analyzed their evolution, gene organization, expression, transcriptional regulation motif and target gene. [score:6]
Our data suggested that the salt-inducible members of the miR-169 family could be pivotal molecules in inhibiting these down-regulated genes under Abiotic stresses. [score:6]
In addition, we searched the target genes of the miR169 family in silica, and genes of NF-YA family were predicted as its target genes. [score:5]
To identify the target genes of Osa-miR-169, we performed a target gene search by running miRU against the TIGR Rice Genome mRNA database (OSA1 release 5, 01/23/2007) [38]. [score:5]
Consistent with the previous report, several NF-YA genes, a large CCAAT-box binding transcription factor family conserved in all eukaryotes, were predicted to be target genes of miR-169 in rice (see Additional File 1). [score:3]
The expression of miR-169 after salt treatment in Arabidopsis was determined. [score:3]
The transient inhibition suggested some mechanisms help the NY-YA gene to escape from cleavage by miR-169 after long-time treatment of high salinity. [score:3]
Target genes of the salt -induced miR-169 genes. [score:3]
We also showed that NF-YA transcription factor, Os03g29760, is a target gene of these salt-inducible miR-169 members and were cleaved rapidly after high salinity treatment. [score:3]
The mRNA levels of the predicted target genes of miR-169 were quantified by RT-PCR (A) and quantitative real-time PCR (B). [score:3]
In Arabidopsis, some CCAAT-box binding transcription factors have been reported as target genes of the ath-miR-169 family [4, 37]. [score:3]
Figure 1 The miR-169 expression under high salinity. [score:3]
Other members of miR-169 family showed either no induction by high salinity stress or no expression, in keep with our previous report (Figure 1A). [score:3]
Figure 4 The Os03g29760 transcript is a target gene of miR-169. [score:3]
We further identified Os03g29760 (NF-YA-8 or OsHAP2E) as a target gene of miR-169 by 5'-RACE. [score:3]
We also showed that these miR-169 members selectively cleaved one of the NF-YA genes, Os03g29760, which is a CCAAT-box binding transcription factor and participates in transcriptional regulation of large number genes. [score:2]
Because the sequences of the ath-miR-169 family are very similar, only one probe was used for northern blot. [score:1]
However, miR-169g and miR-169 (o) were induced by high salinity through both DRE and ABRE, where ABRE is an ABA -dependent element (Table 2). [score:1]
MiR-169 is a large miRNA family containing 17 known members that represent nine different mature sequences with a little different [22]. [score:1]
In Arabidopsis, at least one member of the ath-miR-169 family was induced significantly by high salinity. [score:1]
Response of the miR-169 family to high salinity in rice. [score:1]
Finally, we found that one or more ath-miR-169 member was also induced by high salinity. [score:1]
This indicated that some members of miR-169 family might be a general property in plants. [score:1]
Finally, we found one or more ath-miR-169 member that was also induced by high salinity. [score:1]
All probes used were described as previous and listed in Additional File 2. The probe (os-miR-169a, b, c, e) were also used to detect ath-miR-169. [score:1]
MiR-169 is one of the largest families of miRNAs in plants. [score:1]
For this reason, we thus could not exclude that other members of miR-169 could be induced by more intense salt stress condition. [score:1]
From our studies, we speculated that miR-169 could be a miRNA family that responds to various stress conditions. [score:1]
In all, our data confirmed that Os03g29760 (NF-YA-8 or OsHAP2E), an NF-YA gene, was transiently cleaved by miR-169 after salt treatment in rice. [score:1]
Thus, we further tested the response of the miR-169 family to high-salt stress and wondered whether any members of miR-169 family were induced by high salinity. [score:1]
This indicated that at least one member of the ath-miR-169 family was induced significantly by high salinity. [score:1]
Interestingly, it seemed that only a minority of members of the large miR-169 family responded to these stresses. [score:1]
Our studies have shown that some miR-169 members were induced by these stresses in rice and Arabidopsis. [score:1]
Thus, the detected signal was the sum signal from all the miR-169 members. [score:1]
These results suggested that the induction of some miR-169 members by abiotic stress was a common phenomenon in plants. [score:1]
MiR-169g was the only member of the miR-169 family induced by drought. [score:1]
Figure 5 Ath-miR-169 is induced by salt. [score:1]
As in rice, the probe to the ath-miR-169 family detected a similar induced signal (Figure 5). [score:1]
Thus, our data showed that there were both overlapping and distinct responses of the miR-169 family to drought and salt stresses. [score:1]
To verify our deduction, we plotted the phylogenic tree of the miR-169 family stem-loops. [score:1]
The mRNA levels of Os03g29760 and Os07g41720 declined immediately after high salinity treatment, according to the induction of miR-169 in rice. [score:1]
To determine whether the response of the miR-169 family to high salinity also occurs in other plants, we treated Arabidopsis seedling with high salinity. [score:1]
These data indicated that the mechanism of the miR-169 response to drought and salt was obviously different. [score:1]
The response of the miR-169 family to high salinity in ArabidopsisTo determine whether the response of the miR-169 family to high salinity also occurs in other plants, we treated Arabidopsis seedling with high salinity. [score:1]
Sequence alignment, RNA folding and phylogenic analysis of Osa-miR-169 family. [score:1]
For the miR-169 family, miR-169g was induced by drought via the DRE, an ABA-independent element. [score:1]
Our data also indicated that the salt-induction of some miR-169 members was a general property in plants. [score:1]
To date, the rice miR-169 family contains 17 members in the MicroRNA Registry 10.0 [42, 43]. [score:1]
The response of the miR-169 family to high salinity in Arabidopsis. [score:1]
[1 to 20 of 50 sentences]
[+] score: 46
The expression of six HAP2 genes with the predicted miR169 target sites in their 3' UTRs (OsHAP2C, D, E, F, G, and H) increased in the first transcriptome change, but those of two HAP2 genes without a target site (OsHAP2A and OsHAP2B) did not change (See Additional file 10), suggesting the function of miR169 in the regulation of HAP2 expression in the first major transcriptome change. [score:10]
In this scenario, increased expression of OsHAP2 caused by miR169 reduction promotes reproductive transition in rice through functional inhibition of the CCT-domain containing proteins and the resultant induction of RFT1 expression, which was observed at the first major transcriptional change. [score:7]
Expression profile of miR169 and its target gene, OsHAP2. [score:5]
HAP genes without the miR169 target sites (OsHAP2A and OsHAP2B) did not show change in expression. [score:5]
Click here for file 0Expression profile of miR169 and its target gene, OsHAP2. [score:5]
The target of miR169 is the HAP2 type transcription factor (also as known as NF-YA), which is thought to be involved in various traits, e. g., flowering and drought tolerance in Arabidopsis [34, 35], and nodule development in Medicago truncatula [36]. [score:4]
Therefore, miR169 -mediated HAP2 genes expression might synchronously regulate not only flowering time but also other agronomically important traits such as resistance to biotic and abiotic stress. [score:4]
We used these probes to examine the expression of miR169 and miR399. [score:3]
For example, it has been reported that NFYA5, a HAP2 type transcriptional factor regulated by miR169, is important for drought resistance in Arabidopsis [35]. [score:2]
We observed the reduction of miR169 precursors at the first transcriptome change (Figure 5C; See Additional file 10). [score:1]
[1 to 20 of 10 sentences]
[+] score: 26
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1427, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5485, osa-MIR5486, osa-MIR5487, osa-MIR5488, osa-MIR5492, osa-MIR5497, osa-MIR5509, osa-MIR2275c, osa-MIR5517, osa-MIR2275d, osa-MIR5528, osa-MIR5791, osa-MIR5792, osa-MIR5793, osa-MIR5796, osa-MIR5797, osa-MIR5800, osa-MIR5806, osa-MIR5818, osa-MIR5179
Among the 18 members in osa-MIR169, 11 members show up-regulation in expression in the IR87705-7-15-B of our study. [score:6]
We would like to highlight that the up-regulation of these multiple miRNA members from osa-MIR169 family were not observed in our previous drought study on vegetative tissues, suggesting the potential regulatory importance of this conserved miRNA family in drought response circuitry specifically in rice inflorescence. [score:5]
It is noteworthy that mature miRNAs from osa-MIR160 were induced in the IR87705-7-15-B while repressed in IR64; and mature miRNAs of osa-MIR166 show down-regulation both in the IR77298-14-1-2-10 and the IR87705-7-15-B. The remaining 5 conserved miRNA families were either specifically repressed (osa-MIR164) or induced (osa-MIR169, osa-MIR396, osa-MIR398 and osa-MIR408) in the IR87705-7-15-B (S2 Table). [score:4]
In addition, miR169 was also reported as up-regulated in roots of wheat [63] and rice [38] under drought stress. [score:4]
However, based on the observation of multiple miRNA members from osa-MIR169 (i. e. 11 out of 18 miRNA members) being induced in IR87705-7-15-B under drought via Illumina sequencing, osa-miR169 is very likely to play a significant role in drought response mechanisms of IR87705-7-15-B. The disparity of results between Illumina sequencing and qPCR was also observed in our previous drought study on vegetative rice and this scenario could be caused by: (i) difference in fresh plant tissues for qPCR analysis, (ii) although the drought stress treatments in greenhouse were identical, the expression of miRNAs may fluctuate as determination of tissue sampling time based on the leaf rolling is not precise enough [53]. [score:3]
The study also revealed a potential regulatory interaction between miR169/ AtNF-YA and flowering repressor gene FLOWERING LOCUS C (FLC). [score:2]
Interestingly, MIR169 family had been demonstrated to be involved in the regulation of stress -induced flowering in Arabidopsis [64]. [score:2]
[1 to 20 of 7 sentences]
[+] score: 25
Other miRNAs from this paper: osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR398a, osa-MIR398b, osa-MIR160e, osa-MIR160f, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR167j, osa-MIR437, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, tae-MIR160, tae-MIR167a, tae-MIR1117, tae-MIR1118, tae-MIR1120a, tae-MIR1122a, tae-MIR1125, tae-MIR1127a, tae-MIR1128, tae-MIR1131, tae-MIR1133, tae-MIR1135, tae-MIR1136, tae-MIR1139, osa-MIR169r, osa-MIR1436, osa-MIR1439, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, bdi-MIR167a, bdi-MIR1139, bdi-MIR1122, bdi-MIR437, bdi-MIR169b, bdi-MIR1127, bdi-MIR1135, osa-MIR395x, osa-MIR395y, tae-MIR167b, tae-MIR169, tae-MIR395a, tae-MIR395b, tae-MIR398, tae-MIR5085, bdi-MIR5070, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR160a, bdi-MIR395b, bdi-MIR167b, bdi-MIR160b, bdi-MIR167c, bdi-MIR169k, bdi-MIR160c, bdi-MIR167d, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR169e, bdi-MIR398a, bdi-MIR169a, bdi-MIR169h, bdi-MIR169c, bdi-MIR395c, bdi-MIR5180b, bdi-MIR5175a, bdi-MIR5175b, bdi-MIR395d, bdi-MIR398b, bdi-MIR5180a, bdi-MIR169f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, osa-MIR818f, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR5049, bdi-MIR160f, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR395q, bdi-MIR2118a, bdi-MIR2118b, tae-MIR1122b, tae-MIR1127b, tae-MIR1122c, tae-MIR167c, tae-MIR5175, tae-MIR1120b, tae-MIR1120c, tae-MIR6197, tae-MIR5049
Other miRNAs included in this study (miR169, miR5085, miR6220, miR2118) may also be expressed, under stress conditions, in other wheat tissues and/or at different developmental stages. [score:4]
In order to show expression of selected pre-miRNAs (pre-miR2118, pre-miR169, pre-miR5085, pre-miR6220, pre-miR5070), RT-PCR and qRT-PCR was performed using Chinese Spring cDNA. [score:3]
0069801.g002 Figure 2PCR screening of pre-miRNA coding sequences in flow sorted 5D short and long chromosome arms (5DS and 5DL); Triticum aestivum L. cv Chinese Spring (CS) and nullitetrasomic lines (N5D-T5A and N5D-T5B) (A) pre-miR169 (B) pre-miR5085 (C) pre miR5070 (D) pre-miR6220 (E) pre-miR2118. [score:1]
PCR screening of pre-miRNA coding sequences in flow sorted 5D short and long chromosome arms (5DS and 5DL); Triticum aestivum L. cv Chinese Spring (CS) and nullitetrasomic lines (N5D-T5A and N5D-T5B) (A) pre-miR169 (B) pre-miR5085 (C) pre miR5070 (D) pre-miR6220 (E) pre-miR2118. [score:1]
0069801.g004 Figure 4q-RT PCR (A) Five miRNA coding regions (pre-miR169, pre-miR5085, pre-miR6220 and pre-miR5070) in Triticum aestivum L. cv Chinese Spring (CS) B) Levels of non 5D-specific miR5070, detected by qRT-PCR in nullitetrasomic line (N5D-T5A) and Triticum aestivum L. cv Chinese Spring (CS). [score:1]
miR2118 was shown to be located on both arms of the 5D chromosome (5D specific), while miR5085 and miR169 were found to be specific to the long arm (Figure 2). [score:1]
In this study, five pre-miRNA (miR169, miR5085, miR2118, miR6220, miR2118) coding sequences were verified to be located to the 5D chromosome (Figure 2). [score:1]
q-RT PCR (A) Five miRNA coding regions (pre-miR169, pre-miR5085, pre-miR6220 and pre-miR5070) in Triticum aestivum L. cv Chinese Spring (CS) B) Levels of non 5D-specific miR5070, detected by qRT-PCR in nullitetrasomic line (N5D-T5A) and Triticum aestivum L. cv Chinese Spring (CS). [score:1]
PCR screening of 5DL specific pre-miRNA coding sequences (A) pre-miR169 (B) pre-miR5085 in Triticum aestivum L. cv Chinese Spring (CS) deletion lines (5DS-2, 5DS-5, 5DL-5, 5DL7) (C) Fraction length values of deletion lines. [score:1]
2.5 mM MgCl [2] (stock concentration : 25 mM) was used for the amplification of miR6220, miR5070 and miR2118 and this value was optimized to 2 mM and 3 mM for the miR5085 and miR169 amplicons. [score:1]
Three of these pre-miRNAs (miR169, miR5085, miR2118) were shown to be 5D specific (Figure 2). [score:1]
Independent studies in different plant species including A. thaliana, O. sativa,and Populus trichocarpashowed drought stress responsiveness of miR160,miR167, miR169, miR1125, and miR398, which were also found in wheat chromosome 5D [55]– [57]. [score:1]
Coding regions of both 5DL specific pre-miRNAs (pre-miR5085, pre-miR169) were found to be located between the breakpoint of 5DL-7 (FL : 0.29) and the centromere (Figure 3). [score:1]
To experimentally validate 5D chromosome localization of selected pre-miRNAs (miR169, miR5085, miR2118, miR5070, miR6220), PCR screening was carried out using DNA from flow-sorted 5D chromosome arms. [score:1]
0069801.g003 Figure 3PCR screening of 5DL specific pre-miRNA coding sequences (A) pre-miR169 (B) pre-miR5085 in Triticum aestivum L. cv Chinese Spring (CS) deletion lines (5DS-2, 5DS-5, 5DL-5, 5DL7) (C) Fraction length values of deletion lines. [score:1]
Our experimental results supported our in silico predictions: 5DS was verified to harbour regions coding for pre-miR2118 and pre-miR5070, and 5DL was confirmeded to contain both of the above plus pre-miR6220, pre-miR5085 and miR169 coding regions. [score:1]
For instance, in several reports, miR169 was implicated in a broad range of stress responsive mechanisms including nitrogen starvation, arsenic, salt and drought stresses and response to virus infection [69]– [73]. [score:1]
pre-miR169, pre-miR5085 and pre-miR2118 coding regions were found to be 5D chromosome-specific. [score:1]
Quantification with real-time PCR using CS gDNA suggested that coding regions of the selected pre-miRNAs had variable copy number: pre-miR169, pre-miR5085 and pre-miR5070 were shown to have approximately 8.6, 2.2 and 1.5 fold more copies than pre-miR6220. [score:1]
5DL specific pre-miRNA (miR169, miR5085) coding sequences were shown to be located between the centromer and the breakpoint present in 5DL-7 (FL : 0.29) deletion line (Figure 3). [score:1]
[1 to 20 of 20 sentences]
[+] score: 23
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
miR169 targets a CCAAT-box transcription factor, which is involved in diverse processes, such as embryo development, flowering time control and root development [53]. [score:5]
These results suggested that miR171b*, miR1127* and miR169* might be de facto miRNAs with important regulatory functions in specific tissues and developmental stages. [score:3]
Four of the 15 known miRNA families, including miR169, miR166, miR164 and miR160 were preferentially expressed in the developing seeds with the logarithm of the fold changes of 0.3 ~ 3.0. [score:3]
Of the 15 known miRNA families, 4 (miR169, miR166, miR164 and miR160) were preferentially expressed in the developing seeds (with the logarithm of the fold changes of 0.3 ~ 3.0 in the developing seeds, more than those in the flag leaves) (Figure  3a, Table  2). [score:3]
From 5 days post-anthesis to 20 days post-anthesis, miR164 and miR160 increased in abundance in the developing seeds, whereas miR169 decreased, suggesting their coordinating functions in the different developmental stages of wheat seed. [score:2]
The decreased abundance of miR169 from the 5-d seeds to the 20-d seeds was coordinated with its functions in seed development. [score:2]
From 5 days post-anthesis to 20 days post-anthesis, miR164 and miR160 increased in abundance, whereas miR169 decreased, suggesting that these miRNAs have coordinating functions in the different developmental stages of wheat seed. [score:2]
However, mature miRNA sequences for miR171b*, miR1127* and miR169* were not found in any of the five tissues tested. [score:1]
From 5 DPA to 20 DPA, miR164 and miR160 increased in abundance, whereas miR169 decreased (Figure  3a, Table  2). [score:1]
The highest level of miR169* was observed in the seedlings (28 reads), followed by the flag leaves (5 reads). [score:1]
[1 to 20 of 10 sentences]
[+] score: 23
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR529b, osa-MIR1425, osa-MIR1430, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1440a, osa-MIR531b, osa-MIR1847, osa-MIR1848, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1865, osa-MIR812f, osa-MIR1874, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1320, osa-MIR827, osa-MIR2090, osa-MIR396f, osa-MIR2118c, osa-MIR2863a, osa-MIR2863b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR3981, osa-MIR5082, osa-MIR2863c, osa-MIR5337a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1440b, osa-MIR818f, osa-MIR1861o
In Arabidopsis thaliana, miR169 regulates NF-YA2 targets at the post-transcriptional level and down-regulates the response to drought tolerance. [score:7]
Among them, 7 miRNAs, including miR156, miR168, miR169, miR171, miR319, miR396, and miR397 had the same expression pattern in our study. [score:3]
Under conditions of Cadmium(Cd) stress, 141 known miRNAs and 39 miRNAs express in the root and shoot, including miR156, miR159, miR168, miR169, miR171, miR369, miR529, miR1433, miR1440, etc. [score:3]
The expression profiles confirmed that miR169, miR397, miR528, miR1425, miR827, miR319a. [score:3]
Furthermore, miR169 targets NF-YA2 to control root architecture [19]. [score:3]
The miR156, miR164, miR166, miR167, miR169, miR171, and miR444 responded to Cd treatment in 7-day-old rice seedlings [17]. [score:1]
In combination with prior reports, we identified 13 miRNAs, including miR156, miR164, miR166, miR167, miR169, miR171, miR444, miR397, miR528, miR1425, miR827, miR319a. [score:1]
2, miR390-3p, miR531b, miR1430, miR1847.2, miR1865-5p, miR1874-3p, and miR5082, whereas 24 miRNAs were identified that were significantly accumulated in the whole roots, including miR156, miR164, miR166, osa-miR169, miR171, miR393, miR408, miR528, miR529, osa-miR812, miR1320, osa-miR1432, miR1861, miR3979, etc. [score:1]
In Arabidopsis thaliana, the same phenotype of miR169 was observed, indicating that miR169 plays a role in controlling root architecture [19]. [score:1]
[1 to 20 of 9 sentences]
[+] score: 23
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR440, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR1428a, osa-MIR169r, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1866, osa-MIR1862d, osa-MIR1862e, osa-MIR1877, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR2275a, osa-MIR2275b, osa-MIR2871a, osa-MIR2871b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1862f, osa-MIR1862g, osa-MIR2863c, osa-MIR5159, osa-MIR5337a, osa-MIR5485, osa-MIR2275c, osa-MIR2275d, osa-MIR5337b
For example, a genome-wide study conducted across different developmental stages of rice revealed that 16 miRNAs, including miR156, miR159 and miR168, were downregulated by drought stress, while 14 miRNAs, such as miR169, miR319 and miR395, were upregulated [42]. [score:8]
Also in Arabidopsis, miR169 is downregulated by drought through an ABA -dependent pathway to control the expression of the NFYA5 transcription factor, which mediates tolerance to drought [27]. [score:6]
However, the change of expression was a little bit less than 2-fold in both cases and miR169 was not identified as stress-regulated miRNA based on our criteria. [score:4]
For example, miR169 has been previously found to be downregulated in drought-stressed Arabidopsis[27] and salt-stressed Nicotiana[60], but induced by drought in Nicotiana[60] and rice [45], and by UV irradiation in Populus tremula[63]. [score:4]
This list contains some known miRNAs in the miRBase, including 7 miR166 family miRNAs derived from a LINE element, two miR169 family miRNAs derived from En/Spm transposons, and 19 miR809 family miRNAs derived from MITEs (Additional file 9). [score:1]
[1 to 20 of 5 sentences]
[+] score: 23
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
In Arabidopsis, miR156, miR158, miR159, miR165, miR167, miR168, miR169, miR171, miR319, miR393, miR394, miR396, and miR397 are up-regulated by salt stress while the expression of miR398 is down-regulated (Liu et al., 2008). [score:9]
MiR397, miR169, miR165, miR166, miR393, miR396, and miR408 were shown to be up-regulated by cold stress in Arabidopsis (Sunkar and Zhu, 2004; Liu et al., 2008). [score:4]
The expression of miR156, miR159, miR160, miR166, miR168, miR169, miR393, and miR827 is increased, while miR172 is significantly repressed under heat stress in wheat (Xin et al., 2010). [score:3]
In contrast, miR169 is significantly repressed by N starvation while NFYA, the target of miR169, is induced (Zhao et al., 2011). [score:3]
A great number of miRNAs, for example, miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 have been identified to be regulated by drought in Arabidopsis (Liu et al., 2008). [score:2]
Involvement of miR169 in the nitrogen-starvation responses in Arabidopsis. [score:1]
In rice, 14 miRNAs (miR159, miR169, miR171, miR319, miR395, miR474, miR845, miR851, miR854, miR896, miR901, miR903, miR1026, and miR1125) are significantly induced while 16 miRNAs are significantly repressed by drought (Zhao et al., 2007; Zhou et al., 2010). [score:1]
[1 to 20 of 7 sentences]
[+] score: 20
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR528, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR821a, osa-MIR821b, osa-MIR821c, osa-MIR1432, osa-MIR169r, osa-MIR1846d, osa-MIR1846a, osa-MIR1846b, osa-MIR1876, osa-MIR1846c, osa-MIR1846e, osa-MIR395x, osa-MIR395y
NFY- A family transcription factor (nuclear factor Y, subunit A), the target of the miR169, has been reported to be down-regulated under N deprivation [41]. [score:6]
Since an analysis of target genes of miR169 and miR167 family had already been evaluated in earlier studies [17], [30], we selected few target genes from miR156, miR164, miR168, miR528, miR820 and miR1318 families to observe the expression pattern in low-N tolerant (IC-547557) and low-N sensitive (Vivek Dhan) rice genotypes under nitrogen limited condition. [score:5]
Variable expression pattern of miR169 family under N limitation was also reported earlier in roots and leaves of Arabidopsis [41], rapeseed [30] and maize [31]. [score:3]
For example, miR164, miR167, miR168 and miR169 showed differential expression patterns under nitrogen limitation in maize and Arabidopsis, [31], [41]. [score:3]
These miRNAs belong to miR156, miR164, miR166, miR167, miR168, miR169, miR528, miR535, miR820, miR821, miR1318, miR1432, miR1846, miR1876, and miR2123 families. [score:1]
1,2,3 Nuclear transcription factor Y subunit, putative miR169 LOC_Os06g23650.1 NAM domain containing proteins, putative miR164 LOC_11g03310. [score:1]
Repression of miR169 resulted in tolerance to drought stress and thus may mediate low-N stress generated osmotic imbalance [61], [62]. [score:1]
[1 to 20 of 7 sentences]
[+] score: 19
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166d, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR396e, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818b, osa-MIR169r, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
Similarly, some members of the miR156, miR159, miR167 and miR169 families (pre-miR156b/i, pre-miR159b/f, pre-miR166a/b/c, pre-miR167b/g, pre-miR169f/p) were up-regulated while others (pre-miR156d/f/g/j, pre-miR159a, pre-miR166d, pre-miR167d/e, pre-miR169a/b/h/l/m/q) were down-regulated by drought stress. [score:7]
Several miRNAs have been reported to regulate drought-responsive genes [10, 15, 16], and it has been shown that rice miR159, miR169, miR395 and miR474 are drought-inducible, while the expression of miR156, miR168, miR170, miR172, miR396, miR397 and miR408 is suppressed by drought [13, 16]. [score:6]
For example, miR169 is down-regulated under drought stress in Arabidopsis thaliana, whereas its target gene, NFYA5, is drought -induced [19]. [score:6]
[1 to 20 of 3 sentences]
[+] score: 16
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
In general, miRNAs that are conserved across plants, such as miR156, miR164, miR167 and miR169, target transcription factors (TFs), whereas less-conserved miRNAs target fewer TFs (Additional file 8). [score:5]
It was reported that five conserved miRNAs (miR159, miR162, miR166, miR390, and miR399) presented similar expression levels in root apexes and nodules, but miR169, miR171, miR393, and miR396 enriched in root tips [41]. [score:3]
NF-YAs, the targets of miR169, participate in N and drought stress responses [50]. [score:3]
Soybean 5 NF-YA transcripts are potentially targeted by miR169 members (Additional file 7). [score:3]
One last set of results in regards to P nutrition shows that miR778, miR398, miR169 and miR408 are also responsive to P limitation [10, 11]. [score:1]
In this study, the abundance of several miR169 family members (miR169c, miR169p, miR169q, and miR169r) was low yet still detectable in soybean leaves (Table 3), which indicates some roles for these miRNAs in leaves, and stands in contrast to the report that gma-miR169 is abundant in soybean shoot apical meristem (SAM) and undetectable in mature soybean leaves [35]. [score:1]
[1 to 20 of 6 sentences]
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR166c, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160f, osa-MIR164d, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR419, osa-MIR390, osa-MIR444a, osa-MIR528, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR529b, osa-MIR1425, osa-MIR1429, osa-MIR1431, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1441, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1853, osa-MIR1860, osa-MIR812f, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1319a, osa-MIR2096, osa-MIR2864, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR3979, osa-MIR812n, osa-MIR812o, osa-MIR5161, osa-MIR5338, osa-MIR5512a, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1319b, osa-MIR5512b, osa-MIR818f
In the miR169 family, the highest expression library for miR169b and miR169c was CWR-F2, this pattern differed from miR169h, i, j, k, l and m, which were expressed at their highest levels in CWR-V2. [score:5]
MiR169 represses C gene expression in sepals and petals that target the nuclear transcription factor NF-YA, may promote drought stress and induce Arabidopsis early flowering in long days [23], [24]. [score:4]
Unlike these two families, however, the miR167 and miR169 families showed different expression trends in the three libraries. [score:3]
[1 to 20 of 3 sentences]
[+] score: 11
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR444a, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR818a, osa-MIR818b, osa-MIR818c, osa-MIR818d, osa-MIR818e, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1423, osa-MIR1425, osa-MIR1427, osa-MIR1428a, osa-MIR1429, osa-MIR1430, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR810b, osa-MIR1435, osa-MIR1436, osa-MIR1437a, osa-MIR1440a, osa-MIR1441, osa-MIR1442, osa-MIR1439, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1428f, osa-MIR1428g, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR1440b, osa-MIR818f, osa-MIR1437b
The most abundantly expressed miRNA family in rice seedlings is miR169 which is represented by 8 members corresponding to 17 loci in rice (Table 4). [score:3]
The expression of four members of the rice miR169 family has been reported previously [32]. [score:3]
The frequency of miRNA families in rice in our control library varied from 1 (miR394, miR399 and miR408) to 4948 times (miR169) indicating that the expression varies highly among different miRNA families in rice seedlings. [score:3]
The most abundant miRNA family across the three libraries was miR169 (Table 4). [score:1]
The very high abundance of miR169 in rice seedlings is also in agreement with the data from a small RNA library generated using wheat seedlings [43]. [score:1]
[1 to 20 of 5 sentences]
[+] score: 11
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR827, osa-MIR396f, bdi-MIR171a, bdi-MIR167a, bdi-MIR397a, bdi-MIR156a, bdi-MIR172d, bdi-MIR166a, bdi-MIR171c, bdi-MIR169b, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, bdi-MIR169d, bdi-MIR169i, bdi-MIR395a, bdi-MIR169j, bdi-MIR166f, bdi-MIR171b, bdi-MIR390a, bdi-MIR160a, bdi-MIR528, bdi-MIR395b, bdi-MIR166d, bdi-MIR171d, bdi-MIR167b, bdi-MIR166b, bdi-MIR160b, bdi-MIR164b, bdi-MIR167c, bdi-MIR396d, bdi-MIR169k, bdi-MIR168, bdi-MIR160c, bdi-MIR396c, bdi-MIR167d, bdi-MIR156b, bdi-MIR169g, bdi-MIR160d, bdi-MIR160e, bdi-MIR396e, bdi-MIR156c, bdi-MIR172a, bdi-MIR396a, bdi-MIR166e, bdi-MIR166c, bdi-MIR169e, bdi-MIR394, bdi-MIR398a, bdi-MIR164a, bdi-MIR393a, bdi-MIR169a, bdi-MIR172b, bdi-MIR156d, bdi-MIR393b, bdi-MIR169h, bdi-MIR396b, bdi-MIR169c, bdi-MIR395c, bdi-MIR827, bdi-MIR166g, bdi-MIR319a, bdi-MIR395d, bdi-MIR398b, bdi-MIR164c, bdi-MIR169f, bdi-MIR162, bdi-MIR164e, bdi-MIR164f, bdi-MIR395m, bdi-MIR395e, bdi-MIR395f, bdi-MIR395g, bdi-MIR395h, bdi-MIR395j, bdi-MIR395k, bdi-MIR395l, bdi-MIR395n, bdi-MIR529, bdi-MIR319b, bdi-MIR397b, bdi-MIR156e, bdi-MIR156f, bdi-MIR156g, bdi-MIR156h, bdi-MIR156i, bdi-MIR166h, bdi-MIR166i, bdi-MIR167e, bdi-MIR395o, bdi-MIR395p, bdi-MIR156j, bdi-MIR160f, bdi-MIR166j, bdi-MIR167f, bdi-MIR167g, bdi-MIR169l, bdi-MIR169m, bdi-MIR169n, bdi-MIR171e, bdi-MIR171f, bdi-MIR395q
The expression of miR169e was difficult to be detected due to its sequence similarity to other members in the miR169 family and low expression level. [score:5]
MiR169 and miR397 were also shown to be cold -upregulated in Populus [19]. [score:4]
MiR164, miR166 and miR172 were represented by two variants and miR169 was represented by four variants in the library (Table 2). [score:1]
Then, miR169 and miR172 were found to be responsive to cold stress in Arabidopsis both through a computational, transcriptome -based approach and by microarray analysis almost simultaneously [17, 18]. [score:1]
[1 to 20 of 4 sentences]
[+] score: 11
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
For instance, miR169 targeted seven different CCAAT -binding transcription factors in the four stages (category 0 or 2) with very high abundance, but it also guided the slicing of three other non-conserved targets with very low abundance. [score:5]
Four identified targets of miRs4 (category 0 or 2) were the same as those of miR169, providing further evidence that miRs4 is a member of the miR169 family. [score:3]
Click here for file The sequence conservation of mature miRNAs between members of known miR169 family and miRs4. [score:1]
The sequence conservation of mature miRNAs between members of known miR169 family and miRs4. [score:1]
The sequence of miRs4 was similar to that of members of the miR169 family (Additional file 7), indicating that miRs4 may be a member of that family. [score:1]
[1 to 20 of 5 sentences]
[+] score: 10
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR444a, osa-MIR528, osa-MIR530, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR1429, osa-MIR1431, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1857, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1883a, osa-MIR1883b, osa-MIR1320, osa-MIR827, osa-MIR1846e, osa-MIR2121a, osa-MIR2864, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3980a, osa-MIR3980b, osa-MIR812n, osa-MIR812o, osa-MIR5083, osa-MIR5143a, osa-MIR5156, osa-MIR5513, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR6248, osa-MIR6249a, osa-MIR531c
The target genes of miR156, miR159, miR169, and miR172 are categorized into different transcription factor families – SBP, MYB, CBF, bZIP – which further regulate gene expression and signal transduction and probably play roles in stress responses [35]. [score:6]
On the other hand, miR160f-3p, miR166c-5p and miR169r-3p were down-regulated in the two rice genotypes at 48 h. Since osa-miR160, osa-miR166 and osa-miR169 were previously reported to respond to auxin [34], GA [35] and ABA [36], respectively, they probably modulate the genes involved in hormone pathways [37]. [score:4]
[1 to 20 of 2 sentences]
[+] score: 10
Zhao et al. [39] also found that rice miR169 was up-regulated under salinity stress. [score:4]
Zhao B Members of miR-169 family are induced by high salinity and transiently inhibit the NF-YA transcription factorBMC Mol Biol. [score:3]
For an example, NF-Y a target of miR169 modifies carbohydrate metabolism and cell elongation under salinity stress [39]. [score:3]
[1 to 20 of 3 sentences]
[+] score: 10
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR164f, osa-MIR390, osa-MIR439a, osa-MIR439b, osa-MIR439c, osa-MIR439d, osa-MIR439e, osa-MIR439f, osa-MIR439g, osa-MIR439h, osa-MIR439i, osa-MIR396e, osa-MIR444a, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR171a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, tae-MIR156, tae-MIR319, tae-MIR167b, tae-MIR169, tae-MIR444b, tae-MIR171b, tae-MIR396, tae-MIR167c, tae-MIR397
Twelve conserved miRNA families (miR156/157, miR159/319, miR160, miR164, miR165/166, miR167, miR169, miR170/171, miR172 and miR444) have been predicted to target 24 transcription factors, including squamosa promoter binding proteins, MYB, NAC1, homeodomain-leucine zipper protein, auxin response factor, CCAAT -binding protein, scarecrow-like protein, APETELA2 protein and MADS box protein (Additional data file 2). [score:3]
The frequencies of the miRNA families varied from 2 (miR390, miR396, miR397, miR399) to 757 (miR169), indicating that expression varies highly among the different miRNA families in wheat (Figure 2). [score:3]
This analysis revealed perfect matching of nine miRNA families, miR159, miR160, miR164, miR167, miR169, miR170, miR399, miR408 and miR444, to 14 ESTs. [score:1]
Furthermore, our analysis revealed that the library included all known members of several miRNA families: miR156, miR159, miR167, miR169, miR168, miR171 and miR172. [score:1]
MiR169 was represented by five members, miR156, miR165/166, miR167, miR170/171 and miR172 were represented by three members each, and miR159, miR319 and miR168 were represented by two members each in the library. [score:1]
These include miRNA156/157, miR159, miR160, miR164, miR165/166, miR167, miR168, miR169, miR170/171, miR172, miR319, miR390, miR393, miR396, miR397, miR399 and miR408, which are conserved in diverse plant species (Table 2). [score:1]
[1 to 20 of 6 sentences]
[+] score: 10
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR169a, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR169a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR391, ath-MIR156g, ath-MIR156h, ath-MIR159c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR535, ath-MIR781a, ath-MIR782, ath-MIR847, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, osa-MIR1846d, osa-MIR1857, osa-MIR1846a, osa-MIR1846b, osa-MIR1846c, osa-MIR1846e, ath-MIR2112, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, gma-MIR391, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR169f, gma-MIR169g, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR169i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, ath-MIR781b, ath-MIR156i, ath-MIR156j, gma-MIR156p, gma-MIR156q, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR156t, gma-MIR169t, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR169w
The targets were annotated as Nuclear Factor Y (NFY), which were previously shown to be targeted by miR169 in Arabidopsis [26], [27]. [score:5]
Although only a few cleavage targets of the highly accumulated RC-miRNAs were detected, several RC-miRNAs were shown to possess great potential to guide DNA methylation in both Arabidopsis (RC_ath-miR2112, RC_ath-miR391, RC_ath-miR781, RC_ath-miR782, and RC_ath-miR847) and rice (RC_osa-miR156, RC_osa-miR159, RC_osa-miR169, RC_osa-miR1846, RC_osa-miR2118, and RC_osa-miR535) (Figure 4 and Table S6). [score:3]
However, it is hard to tell that either RC-osa-miR169 or osa-miR169, or both exert their cleavage -based regulatory roles. [score:2]
[1 to 20 of 3 sentences]
[+] score: 9
Second, the positions mapped were not located between the 10 and 11 nucleotides from the 5′-end of miR169*, which was atypical for miRNA-directed cleavage [54]. [score:2]
Although we cloned cDNA fragments with the 5′-end mapped to the miR169* complementary region of SmAGO5, they were probably not the products of miR169*-directed cleavage. [score:2]
They represent 6 miRNA gene families, including miR167, miR168, miR169, miR396, miR403 and miR530 (Figure  5). [score:1]
A total of 24 hairpin structures were identified for six miRNA families, including miR167, miR168, miR169, miR396, miR403 and miR530 (Figure  5). [score:1]
First, the penalty scores for miR169*: SmAGO5 were at least 9.5, suggesting low complementarity between miR169* and SmAGO5. [score:1]
We also cloned 5′-RACE products with the 5′-end mapped to the miR169* complementary region of SmAGO5; however, the positions are not between the 10 and 11 nucleotides from the 5′-end of the miRNA (data not shown). [score:1]
However, the scores for miR167*: SmAGO8, miR169*: SmAGO5, miR396*: SmAGO3 and were at least 5.5, 9.5, and 5.0, respectively. [score:1]
[1 to 20 of 7 sentences]
[+] score: 9
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, osa-MIR414, osa-MIR437, osa-MIR390, osa-MIR440, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR531a, osa-MIR529b, osa-MIR1425, osa-MIR1427, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR1439, osa-MIR531b, osa-MIR1846d, osa-MIR1848, osa-MIR1850, osa-MIR1846a, osa-MIR1846b, osa-MIR1859, osa-MIR1860, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1863a, osa-MIR1864, osa-MIR1865, osa-MIR1871, osa-MIR1874, osa-MIR1862d, osa-MIR1876, osa-MIR1862e, osa-MIR1878, osa-MIR1879, osa-MIR1319a, osa-MIR1846c, osa-MIR2055, osa-MIR1846e, osa-MIR2096, osa-MIR396f, osa-MIR2106, osa-MIR2120, osa-MIR2275a, osa-MIR2275b, osa-MIR2863a, osa-MIR2863b, osa-MIR2872, osa-MIR2875, osa-MIR2876, osa-MIR2877, osa-MIR2878, osa-MIR1863c, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1863b, osa-MIR1862f, osa-MIR1862g, osa-MIR3979, osa-MIR3981, osa-MIR5072, osa-MIR5073, osa-MIR5076, osa-MIR5079a, osa-MIR5082, osa-MIR5083, osa-MIR2863c, osa-MIR5150, osa-MIR5151, osa-MIR5155, osa-MIR5160, osa-MIR5161, osa-MIR5162, osa-MIR5484, osa-MIR5504, osa-MIR5505, osa-MIR5513, osa-MIR2275c, osa-MIR2275d, osa-MIR5788, osa-MIR5792, osa-MIR5809, osa-MIR5812, osa-MIR1319b, osa-MIR6246, osa-MIR6250, osa-MIR6253, osa-MIR5079b, osa-MIR531c
The up-regulation of osa-miR169, osa-miR390, and osa-miR5082 in N22 root after SDS suggests that these miRNAs may be involved in root development of N22 under high temperature stress. [score:5]
In comparison with control, the root tissue of N22 showed up-regulation of osa-miR5504, osa-miR169, osa-miR1427, osa-miR390, osa-miR166b-5p, osa-miR5082, and osa-miR319a-3p after SDS. [score:4]
[1 to 20 of 2 sentences]
[+] score: 8
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839. [score:1]
1 TAGCCAAGGATGACTTGCCTG 44,458 miR169j. [score:1]
2-3p, miR169j. [score:1]
1* AATCTTGCGGGTTAGGTTTCA 9 miR169j. [score:1]
2)-QRTF, AATGGGAGCTGATTATTACGAGACTGC; At5g48300(miR169j. [score:1]
2-3p TTATATGTTCTTCTCTTTCATC 9 At5g02710 miR169j - miR169j. [score:1]
2-3p (At5g02710), miR169j. [score:1]
2-3p)-QRTR, CCTTGTTGAATTTCTTTTCTTCAATCC; At5g48300(miR169j. [score:1]
[1 to 20 of 8 sentences]
[+] score: 8
Five members of the osa-miR169 family (osa-miR169h, osa-miR169i-3p, osa-miR169k-p3, osa-miR169r-3p, osa-miR169r-5p_R+1) were also up-regulated in the phyB mutant, whereas osa-miR169a-p3 was down-regulated significantly in the phyB mutant (Additional file 4), which suggests they may have distinct and common functions in phyB -mediated processes. [score:7]
Interestingly, a gene encoding a nuclear transcription factor Y subunit (LOC_Os12g42400) was found to be sliced by not only the osa-miR169 family (osa-miR169b/f/h/n/r), but also by osa-MIR1430-p5, which originates from the same loci as osa-miR1430 (Additional file 6). [score:1]
[1 to 20 of 2 sentences]
[+] score: 7
It was reported that miR169 negatively regulates rice immunity against the fungal pathogen of rice blast (Magnaporthe oryzae) by differentially repressing its target genes [37]. [score:4]
miR169 targets the NF-YA family members, which play important roles in plant stress -induced response. [score:3]
[1 to 20 of 2 sentences]
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR426, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR530, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR810a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR820a, osa-MIR1423, osa-MIR1425, osa-MIR1432, osa-MIR169r, osa-MIR810b, osa-MIR1436, osa-MIR1441, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR812f, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR827, osa-MIR396f, osa-MIR2873a, osa-MIR2878, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR1862f, osa-MIR1862g, osa-MIR812n, osa-MIR812o, osa-MIR2873b, osa-MIR5071, osa-MIR5074, osa-MIR5075, osa-MIR5077, osa-MIR5080, osa-MIR5081, osa-MIR5144, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR5795, osa-MIR812s, osa-MIR5802, osa-MIR812t, osa-MIR812u, osa-MIR5805, osa-MIR812v, osa-MIR5807, osa-MIR2873c, osa-MIR6253, osa-MIR1861o
Among the 21 highly conserved miRNA families in rice, mature miRNAs of over 15 and 16 families were found to be differentially expressed in leaf and stem respectively with 11 families having at least a common mature miRNA member that was differentially expressed between both tissues such as osa-MIR159, osa-MIR160, osa-MIR166, osa-MIR169, osa-MIR171, osa-MIR390, osa-MIR394, osa-MIR397, osa-MIR398, osa-MIR399 and osa-MIR408 (refer to Additional file 8 for their functional information). [score:5]
as high [transcripts per million (TPM) > 10000/100000; osa-MIR168, osa-MIR156, osa-MIR166], moderate (TPM = 100–10000; osa-MIR167, osa-MIR397, osa-MIR408, osa-MIR159, osa-MIR164, osa-MIR172, osa-MIR396) and low (TPM < 100; osa-MIR160, osa-MIR162, osa-MIR169, osa-MIR171, osa-MIR390, osa-MIR393, osa-MIR394, osa-MIR395, osa-MIR398, osa-MIR399, osa-MIR827). [score:1]
However when the results of both these studies were compared, only 5 miRNAs (miR156, miR159, miR169, miR172 and miR408) were found to be commonly regulated by drought stress. [score:1]
[1 to 20 of 3 sentences]
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR396f, osa-MIR395x, osa-MIR395y, osa-MIR3980a, osa-MIR3980b, osa-MIR5794
GmNFYA3, a target gene of miR169, is a positive regulator of plant tolerance to drought stress. [score:4]
MiR169 and its target gene LOC_Os12g42400 (Os12g0618600 in RAP locus) have been reported to be ABA-responsive (Tian et al., 2015) and it has been well-known that ABA plays a pivotal role in adaptive responses to various abiotic and biotic stresses (Lee and Luan, 2012). [score:2]
These miRNA families include the three conserved miRNA families, miR166, miR169, and miR319, which have been confirmed to play pivotal roles in other stresses (Zhou et al., 2010; Ni et al., 2013; Li Y. et al., 2014). [score:1]
[1 to 20 of 3 sentences]
[+] score: 7
It was reported that miR396, miR168, miR167, miR165, miR319, miR159, miR394, miR156, miR393, miR171, miR158, and miR169 were up-regulated in salt stress in Arabidopsis (Liu et al., 2008), while Ath-miR398 was down-regulated under salt stress (Jagadeeswaran et al., 2009). [score:7]
[1 to 20 of 1 sentences]
[+] score: 7
GmNFYA3, a target gene of miR169, is a positive regulator of plant tolerance to drought stress. [score:4]
MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. [score:3]
[1 to 20 of 2 sentences]
[+] score: 6
Although they were not used for validation in this study, several reports have shown that miR169 expression might be involved in changes to the root architecture (35) and the promotion of stress -induced flowering (36) by targeting the NF-YA transcription factor in Arabidopsis thaliana. [score:5]
In addition, several miR169 family members with fold changes < 1 were also selected by RiceATM screening. [score:1]
[1 to 20 of 2 sentences]
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR1876, osa-MIR395x, osa-MIR395y
Most miRNA clusters encode several copies of conserved miRNAs from the same family, that is, miR166, miR169, or miR395. [score:1]
Specific miRNA clusters (such as those coding for miR395, miR169 and miR166) are highly conserved. [score:1]
Homologous clusters were found for miR166, miR169 and miR395 families (based on the <10-kb threshold). [score:1]
Furthermore, clustering of specific miRNAs (for example, miR395, miR169, miR166) is evolutionarily conserved. [score:1]
In plant genomes, miR156, miR160, miR162, miR167, miR169, miR171 and miR395 families experienced large expansions via tandem or segmental duplication events and loss of family members ([29, 30, 52] and this study). [score:1]
Most of the few reported plant miRNA clusters contain several copies of the same conserved miRNA (miR156, miR166, miR169, miR395 or miR399), in contrast to animals where miRNAs with unrelated sequences are often included in the same clusters [18, 19, 25, 35]. [score:1]
[1 to 20 of 6 sentences]
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395d, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1846d, osa-MIR1853, osa-MIR1860, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, osa-MIR5078, osa-MIR5826
For an example, miR169 -targeted NF-Y, which conditions whole plant growth through modifying cell elongation and carbohydrate metabolism, was wi dely regulated under salinity stress [59]. [score:4]
For an example, in the control library, both oco-miR2118 and oco-miR444 families had maximum of6 members each whereas, in the treated library, oco-miR166 family had maximum of 12 members followed by both oco-miR396 andoco-miR169 families, each with 8 members. [score:1]
[1 to 20 of 2 sentences]
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, ctr-MIR171, osa-MIR395x, osa-MIR395y, osa-MIR1440b
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
Additionally, fifteen miRNA families namely miR156, miR159, miR160, miR162, miR164, miR166, miR167, miR168, miR169, miR171, miR172, miR390, miR394, miR403, and miR1446, were found to have some thousands to tens of thousands of redundancies while four families (miR395, miR396, miR397, miR414, and miR827), had more than one hundred redundancies. [score:1]
For example, miR319, miR156/157, miR169, miR165/166, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [9]. [score:1]
[1 to 20 of 3 sentences]
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR156b, mtr-MIR167a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR393b, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR156h, mtr-MIR166f, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, osa-MIR169r, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR397, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, osa-MIR827, osa-MIR396f, mtr-MIR2118, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, mtr-MIR169k, mtr-MIR169j, mtr-MIR399q, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, mtr-MIR4414a, mtr-MIR4414b, mtr-MIR482, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, sly-MIR482e, sly-MIR482a, mtr-MIR167b, mtr-MIR168c, mtr-MIR408, mtr-MIR396c, mtr-MIR171g, stu-MIR6024, sly-MIR6024, stu-MIR482c, stu-MIR482b, stu-MIR482a, stu-MIR482d, stu-MIR482e, sly-MIR482b, sly-MIR482c, stu-MIR6025, stu-MIR6026, sly-MIR6026, sly-MIR168a, sly-MIR168b, mtr-MIR169i, mtr-MIR172d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, stu-MIR7980a, stu-MIR7983, stu-MIR8007a, stu-MIR8007b, stu-MIR7980b, stu-MIR399a, stu-MIR399b, stu-MIR399c, stu-MIR399d, stu-MIR399e, stu-MIR399f, stu-MIR399g, stu-MIR399h, stu-MIR3627, stu-MIR171b, stu-MIR166a, stu-MIR166b, stu-MIR166c, stu-MIR166d, stu-MIR171a, stu-MIR171c, stu-MIR399i, stu-MIR827, stu-MIR172b, stu-MIR172c, stu-MIR172a, stu-MIR172d, stu-MIR172e, stu-MIR156a, stu-MIR156b, stu-MIR156c, stu-MIR156d, stu-MIR171d, stu-MIR167c, stu-MIR167b, stu-MIR167a, stu-MIR167d, stu-MIR399j, stu-MIR399k, stu-MIR399l, stu-MIR399m, stu-MIR399n, stu-MIR399o, stu-MIR393, stu-MIR398a, stu-MIR398b, stu-MIR396, stu-MIR408a, stu-MIR408b, stu-MIR397, stu-MIR171e, stu-MIR156e, stu-MIR156f, stu-MIR156g, stu-MIR156h, stu-MIR156i, stu-MIR156j, stu-MIR156k, stu-MIR169a, stu-MIR169b, stu-MIR169c, stu-MIR169d, stu-MIR169e, stu-MIR169f, stu-MIR169g, stu-MIR169h, sly-MIR403, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR827, sly-MIR393, sly-MIR398a, sly-MIR399b, sly-MIR6025, sly-MIR169f, sly-MIR171f
MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. [score:3]
For example, miR166 and miR169 regulate nodule organogenesis in Medicago trunctula (Combier et al., 2006; Boualem et al., 2008). [score:2]
[1 to 20 of 2 sentences]
[+] score: 5
In rice, while miR164:NAC module plays important role in drought tolerance, over -expression of miR169 leads to enhance drought tolerance in tomato 20, 21. [score:3]
Zhang X Over -expression of microRNA169 confers enhanced drought tolerance to tomatoBiotechnol. [score:2]
[1 to 20 of 2 sentences]
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR528, osa-MIR529a, osa-MIR812a, osa-MIR812b, osa-MIR812c, osa-MIR812d, osa-MIR812e, osa-MIR815c, osa-MIR818d, osa-MIR529b, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR1436, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1858a, osa-MIR1861a, osa-MIR1861b, osa-MIR1861c, osa-MIR1861d, osa-MIR1861e, osa-MIR1861f, osa-MIR1861g, osa-MIR1861h, osa-MIR1861i, osa-MIR1861j, osa-MIR1861k, osa-MIR1861l, osa-MIR1861m, osa-MIR1861n, osa-MIR812f, osa-MIR1862d, osa-MIR812g, osa-MIR812h, osa-MIR812i, osa-MIR812j, osa-MIR1428f, osa-MIR1428g, osa-MIR812k, osa-MIR812l, osa-MIR812m, osa-MIR812n, osa-MIR812o, osa-MIR812p, osa-MIR812q, osa-MIR812r, osa-MIR812s, osa-MIR812t, osa-MIR812u, osa-MIR812v, osa-MIR1861o
miR169d*,l*,m*,e. 2*, more abundant than miR169, mediate the cleavage of the arbuscule-specific protein MtBcp1, and miR5024* targets a GRAS transcription factor specifically expressed in mycorrhizal roots of Medicago truncatula [41]. [score:5]
[1 to 20 of 1 sentences]
[+] score: 5
In rice, a similar miR169-invovel subnetwork was identified, although no such mimic—miR169* regulatory relationship existed (Additional file 13: Figure S9). [score:2]
Within the ath-miR169 -mediated subnetwork, the miRNA star species, ath-miR169g*, was found to be potentially regulated by three mimic transcripts, AT1G52060.1, AT4G16070.1 and AT4G16070.2 (Additional file 13: Figure S9). [score:2]
However, based on the TIGR rice annotations, two mimic genes of osa-miR169, LOC_Os05g24010 and LOC_Os09g37800, were suggested to be responsive to stress. [score:1]
[1 to 20 of 3 sentences]
[+] score: 4
In contrast, all the putative targets of osa-miR169g and osa-miR169j have been lost after mutation. [score:4]
[1 to 20 of 1 sentences]
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169m, osa-MIR171d, osa-MIR171f, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, osa-MIR444a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820c, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1441, osa-MIR1846b, osa-MIR1882e, osa-MIR1883b, osa-MIR1846e, osa-MIR396f, osa-MIR2120, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2879, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR5158, osa-MIR5143b, osa-MIR5835, osa-MIR7693, osa-MIR7695
Interestingly, osa-MIR169m, osa-miR169j, osa-MIR5143b, osa-MIR5143b, osa-MIR2879, and osa-MIR2118q displays similar expression profiles in both RSV and mock samples (S3 Table). [score:3]
For example, the read counts for osa-miR168a-5p and osa-miR169j were 219 counts and 17 counts, respectively, at 3 dpi but they were not detectible at 7 dpi (S3 Table). [score:1]
[1 to 20 of 2 sentences]
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR535, osa-MIR169r, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, ppe-MIR482a, ppe-MIR482b, ppe-MIR171f, ppe-MIR482c, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR398a, ppe-MIR171g, ppe-MIR171b, ppe-MIR482d, ppe-MIR482e, ppe-MIR171c, ppe-MIR398b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR396a, ppe-MIR396b, ppe-MIR482f, ppe-MIR535a, ppe-MIR535b
miR169 can target NFYA to control dehydration responses [47]. [score:3]
Our experiment also identified a high confidence cleavage site for miR169 in peach NFYA. [score:1]
[1 to 20 of 2 sentences]
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
A series of targets for known miRNAs, including gma-miR156, gma-miR159, gma-miR160, gma-miR164, gma-miR167, gma-miR169, gma-miR396, gma-miR398 and gma-miR1514, belong to this class (Tables 3, 4). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR1520h, gma-MIR1520i, gma-MIR1520j, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR4406, gma-MIR169d, gma-MIR1520q, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR167k, gma-MIR167l, gma-MIR169w
We detected seven NF transcription factor YA subunit mRNAs specifically in seed coats that are targets of miR169 family members that occur in both seed coats and cotyledons (). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
In addition, lncRNA3294 was the target of sly-miR169 that is engaged in drought tolerance of tomato (Zhang et al., 2011). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
The tissue-specific expression patterns were presented for the conserved miRNAs, miR160, miR167, miR169, miR319, miR390 and miR396, and the less-conserved miRNAs, miR828, miR858 and miR2118 (Figure 2b). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
In comparison to other plant species, tae-miR169b in wheat and osa-miR169 in rice are the most frequently sequenced miRNAs while miR156 in rice and wheat exhibits low abundance [32]. [score:1]
The largest miRNA family size identified was miR166 that consisted of 14 members and miR156, miR169 and miR167 possessed 12, 12 and 10 members, respectively; whereas other miRNA families such as miR162, miR529, miR827 and miR1432 had only one member detected in this period. [score:1]
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40 and 40 plant species, respectively [36- 38]. [score:1]
[1 to 20 of 3 sentences]
[+] score: 2
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR394a, ath-MIR394b, ath-MIR396a, ath-MIR396b, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, ath-MIR403, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR396e, ath-MIR856, ath-MIR858a, osa-MIR169r, osa-MIR396f, ath-MIR2111a, ath-MIR2111b, osa-MIR396g, osa-MIR396h, osa-MIR396d, ath-MIR858b, ath-MIR156i, ath-MIR156j
Most of the miRNA families were found to be conserved in a variety of plant species e. g. using a comparative genomics based strategy homologs of miR319, miR156/157, miR169, miR165/166, miR394 and miR159 were found in 51,45,41,40,40 and 30 diverse plant species respectively [38]. [score:1]
miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc. [score:1]
[1 to 20 of 2 sentences]
[+] score: 2
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
For example, the pde-MIR482 family has 4 members, whereas only one exists in 19 miRNA families (pde-MIR159, pde-MIR162, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR783, pde-MIR946, pde-MIR947, pde-MIR950, pde-MIR951, pde-MIR1310, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR1448, pde-MIR3701 and pde-MIR3712). [score:1]
It includes pde-MIR159, pde-MIR162, pde-MIR166, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396 and pde-MIR399. [score:1]
[1 to 20 of 2 sentences]
[+] score: 2
miR169 is one of the largest miRNA families that is conserved in all plant species and significantly contributes to proper plant development and in plant response to environmental stress [174]. [score:2]
[1 to 20 of 1 sentences]
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [34, 38, 41]. [score:1]
In comparison to other plant species, tae-miR169b in wheat and osa-miR169 in rice were the most frequently sequenced miRNAs while miR156 in rice and wheat exhibited low abundance [46]. [score:1]
[1 to 20 of 2 sentences]
[+] score: 2
Mature miRNA sequences are highlighted in red, and miRNA169 [*] is highlighted in blue. [score:1]
To validate the predicted novel miRNAs, five novel miRNAs, including novel-miR-32, novel-miR-169, novel-miR-221, novel-miR-259, and novel-miR-368 (Table S4), were selected for confirmation by stem-loop RT-PCR. [score:1]
[1 to 20 of 2 sentences]
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, osa-MIR444a, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1874, osa-MIR2055, osa-MIR827, osa-MIR1428f, osa-MIR1428g, zma-MIR396d, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR827, osa-MIR395x, osa-MIR395y, zma-MIR444a, zma-MIR444b
The most abundant were osa-miR169, encoded by a large multigene family, which was cloned 117 times and osa-miR168 that we cloned 40 times (result not shown). [score:1]
The most abundant species in our libraries were osa-miR169 and miR168 that we cloned 117 and 40 times respectively (result not shown). [score:1]
[1 to 20 of 2 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Among the 14 miRNAs that produced positive signals in the northern blot hybridizations, two are close paralogs of known miRNAs; miR169b is a paralog of miR169 and miR171b is a paralog of miR170. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
The miR162, miR398, miR169, miR172, miR171 and miR167 miRNA families revealed five or more but less than ten representations, and the remaining miRNA families were represented by less than five miRNAs. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
In contrast to miR169 being the most abundant miRNA in rice as reported by Sunker et al. [54], in our study, miR168a was the most abundant. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Interestingly, 65 of the identified rice lincRNAs were predicted to be ‘decoys’ of conserved miRNAs, such as miR160, miR164, miR168, miR169 and miR408 (Additional files 9 and 10). [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR418, osa-MIR396e, osa-MIR531a, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, osa-MIR531b, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, osa-MIR531c
of loci miR156 ND d 1 miR159 MYB and TCP TFs e b 2 miR160 ND d 1 miR162 DICER-LIKE 1 b 1 miR164 ND a 1 miR166 HD-Zip TFs f, h, k h, k, n h, n c 9 miR167 Auxin response factors TFs a, d, f j d a 6 miR168 ARGONAUTE b 1 miR169 CCAAT binding factor and HAP2-like TFs n, p c 3 miR171 SCARECROW-like TFs c, e, f c c, d a 7 miR319 ND a 1 miR395 ATP sulphurylases i, j, k 3 miR396 GRF TFs, rhodenase-like, and kinesin-like protein B b 1 miR397 Laccases and beta-6 tubulin a a 2 miR399 Phosphatase TFs e b, e 3 miR418 ND x x 2 miR420 ND x x x 3 miR441 ND b a, b, c c 5 miR442 ND x x x 3 miR446 ND x x x 3 miR531 ND x x 2 miR535 ND x x x x 4 Total no. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Eighteen of the 27 Vvi-miRNA families contained many members (Table  2), with four families (Vvi-miR169, Vvi-miR156, Vvi-miR166, Vvi-miR171 and Vvi-miR399) possessing 19, 8, 7, 8, and 7 members, respectively. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
Testing the Arabidopsis ath-MIR169 family (14 members), approximately two-thirds could be grouped as homologs: this is as expected, as precursors originating from recent duplications have highly similar loop regions [33]. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, osa-MIR444a, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1436, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y
Six known miRNAs including miR160, miR164, miR167, miR168, miR169, and miR171 were also identified in our study. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, osa-MIR528, osa-MIR169r, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5083, ppe-MIR171f, ppe-MIR394a, ppe-MIR828, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR162, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR394b, ppe-MIR396a, ppe-MIR396b, ppe-MIR397, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, ppe-MIR403, ppe-MIR827, ppe-MIR858
In addition, 11 miRNA families (miR162, miR164, miR167, miR168, miR169, miR172, miR393, miR394, miR397, miR399 and miR827) shared a high conservation in both dicotyledons and monocotyledons. [score:1]
[1 to 20 of 1 sentences]