sort by

7 publications mentioning ame-mir-184

Open access articles that are associated with the species Apis mellifera and mention the gene name mir-184. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 65
Ten of these 64 mRNAs were significantly (p<0.05) upregulated in treated relative to control larvae, and 15 were down-regulated (p<0.05), of which 8 mRNAs showed more than a 2-fold reduced expression in the miR-184 treated larvae. [score:9]
Target prediction with the Miranda package [41] identified 116 potential mRNA targets of miR-184 in the bee genome, of which 64 mRNAs were expressed in the treated or control larvae. [score:7]
In Drosophila, miR-184 is expressed in embryos, larvae and adults [66], and its expression shows dynamic changes through embryo development, particularly in the central nervous system [66], [67]. [score:6]
In the mouse, miR-184 participates in a regulatory network that controls the balance between proliferation and differentiation of neural stem cells [64], and its expression is under the control of methyl CpG -binding proteins, thus providing a link to DNA methylation [65]. [score:4]
miR-184 was the most abundantly expressed miRNA in two mosquito species [62], and the Drosophila miR-184 has a critical role in female germline and early embryonic development. [score:4]
In one case (miR-184) this included a range of characters and was also reflected in substantial changes to the larval mRNA expression pattern. [score:3]
The mRNA expression profiling data used for miR-184 study are publically accessible through GEO (GSE44911). [score:3]
Feeding with miR-184 affects the mRNA expression profile of queen larvae. [score:3]
Moreover, miR-184 is also expressed in the central nervous system of both insects and vertebrates [57]. [score:3]
Figure S5 Enriched Gene Ontology term of 279 differentially expressed mRNAs after feeding larvae miR-184. [score:3]
An overall analysis of all experiments in which this miRNA was tested further gave significant differences in birth weight, body length and wing size between miR-184 treated and control bees, suggesting an overall switch in development towards worker bee differentiation (Table 1). [score:2]
miR-184 also significantly reduced wing width (5%, p<0.0003), wing length (3%, p<0.005) and consequently wing area (7%, p<0.0002) (see Figure 5), but increased the proboscis length of the adult bees (F [2,31] = 4.301, p = 0.0225, One-way ANOVA; p = 0.0405, Tukey's test). [score:1]
the birth length was significantly reduced by feeding miR-184 in larval food (F [2,25] = 4.051, p = 0.0299, One-way ANOVA; P = 0.0285, Tukey's test); d). [score:1]
In comparison, the variations in worker jelly miRNA concentrations were smaller, less systematic, and generally positive, particularly from day 4 to day 5. Worker jelly miRNAs with significant (p<0.05, paired t-test) day-to-day/diurnal changes, either showed a persistent 1.5–1.7 fold increase in concentration from day 4 through day 6 (miR-275 and miR-279), or a transient (1.4–4.5 fold) increase in concentration from day 4 to day 5, followed by a slightly less marked (1.7–2.1 fold) decrease from day 5 to day 6 (e. g., bantam, miR-184; Figure 4B). [score:1]
We therefore studied this case further by analyzing the mRNA profiles of queen larvae fed with miR-184. [score:1]
Morphological changes in honeybees treated with miR-184. [score:1]
the miR-184 treated adult bee (right) and the control adult bee (left); b). [score:1]
the birth weight was significantly reduced by feeding miR-184 in larval food (F [2,25] = 5.255, p = 0.0124, One-way ANOVA; p<0.0036, Tukey's test); c). [score:1]
The birth weight of newly emerged adults fed with miR-184 was on average 8% lighter than bees that had received DEPC treated water (p<0.0036), and their body length was 5% smaller (p<0.0285; Figure 5). [score:1]
mRNA analysis after feeding bee larvae with miR-184. [score:1]
wings of the miR-184 treated adult bee (Bottom) and the control adult bee (top); e). [score:1]
These were fed either 5 ul DEPC -treated water (Control group) or 5 ul miR-184 (100 ng/µl) in DEPC -treated water (miR-184 group), respectively, when they were 2 days (26∼32 hrs after hatching) and 3 days (50∼56 hrs after hatching) old. [score:1]
The Control and miR-184 groups consisted of queen larvae reared with royal jelly in queen cups. [score:1]
This group of miRNAs, including miR-275, miR-276, miR-1, miR-2, miR-8, miR-184, Let-7 etc. [score:1]
the wing width was significantly reduced by feeding miR184 in larval food (F [2,25] = 8.496, p = 0.0015, One-way ANOVA; P = 0.0003, Tukey's test). [score:1]
the wing length was significantly reduced by feeding miR184 in larval food (F [2,25] = 4.683, p = 0.0187, One-way ANOVA; P = 0.0055, Tukey's test). [score:1]
Morphological changes in the adult queen after ingestion of miR-184 in royal jelly by the larvae. [score:1]
the wing area was significantly reduced by feeding miR184 in larval food (F [2,25] = 9.307, p = 0.001, One-way ANOVA; P = 0.0002, Tukey's test). [score:1]
Loss of the fly miR-184 induces deficient oogenesis and embryogenesis and complete loss of egg production [63], which accords well with a potential role in differentiation between the fertile queen bee and the infertile worker bee programs. [score:1]
[1 to 20 of 29 sentences]
2
[+] score: 20
These knockdown experiments also hightlighted the relevance of a set of miRNAs involved in the regulation of immune response genes and in the general morphogenesis processes during pharate-adult development (e. g., miR-184 and let-7 locus genes). [score:4]
Among these miRNAs, miR-184 is highly and/or broadly expressed in a number of tissues and developmental stages of vertebrates (Wienholds and Plasterk, 2005) and invertebrates (Jagadeeswaran et al., 2010), including A. mellifera (Chen et al., 2010; Nunes et al., 2013b). [score:4]
Many of the miRNAs affected by EcR knockdown in honeybees (let-7, miR-1, miR-9a, miR-12, miR-14, miR-34, miR-79, miR-92b, miR-124, miR-184, miR-210, miR-219, miR-263a, miR-276, miR-279, miR-283, miR-305, miR-306, miR-316, miR-317) have previously been reported as putatively involved in the regulation of D. melanogaster immune genes, particularly those belonging to the JNK, Imd and Toll signaling pathways (Fullaondo and Lee, 2012). [score:3]
Localized expression pattern of miR-184 in Drosophila. [score:3]
miR-184 has multiple roles in Drosophila female germline development. [score:2]
Moreover, several studies reported a wide spectrum of roles for miR-184, such as germline differentiation, axis formation of the egg chamber, anteroposterior patterning and cellularization of the embryo, gastrulation and neuroectoderm formation, apoptosis, and processes involved in the development and differentiation of imaginal discs (head, wing, and eyes) (see Iovino et al., 2009; Li et al., 2011, and references therein). [score:2]
In addition to these miRNAs of yet unclear functions, we also found conserved and functionally well-defined miRNAs, such as let-7, miR-1, miR-133, miR-375, miR-184, and miR-34. [score:1]
The ecdysone response of miR-184 seen here in pharate-adult honeybees is associated with a period of extensive tissue remo deling, suggesting that miR-184 may play a role in the differentiation of honeybee imaginal disc-derived structures and maintenance of their tissue identities. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 14
Also, four miRNAs (miR-1, miR-133, miR-184 and miR-190) were down-regulated during oviposition activation and recovery, but the suspension of oviposition did not affect their expression. [score:6]
In our trial, miRNA-184 was down-regulated in mated queens but not in virgin queens. [score:4]
In previous works, several miRNAs, such as bantam, miR-184 and miR-315, have been reported to play important roles in modulating tissue patterns, cell differentiation, ovary development and caste determination in honey bees (Ashby et al., 2016; Macedo et al., 2016). [score:2]
Thus, it can be speculated that miRNA-184 could be a candidate marker for oviposition of the honey bee queen. [score:1]
Furthermore, studies in Dorsophlia found that loss of miRNA-184 induced loss of egg production (Iovino, Pane & Gaul, 2009). [score:1]
[1 to 20 of 5 sentences]
4
[+] score: 5
Other miRNAs from this paper: dme-mir-184
We utilized the processing machinery of pri-dme-mir-184 to express miR162 in Drosophila S2 cells. [score:3]
The 300-bp pri-dme-mir-184 was GTTTTCTATTCACGCTTTAGTGCACTTATTTACTCGATTGTATGATCCAAAGCTCCTCTTTGACTCGCCGAATTCCTGTCGATTCAATGGGTATTGGTTTGGTTGGCCGGTGCATTCGTAC CCTTATCATTCTCTCGCCCCGTGTGCACTTAAAGACA ACTGGACGGAGAACTGATAAGGGCTCGTATCACCAATTCATCCTCGGGTCAGCCCAGTTAATCCACTGATTTGCACACTTTTCTTTATACATACGAGGATACTTACCCCACGTTTCGATTACGCGCATCAATCAATCAATCA, and the underlined parts were replaced with TCGATAAACCTCTGCATCCAG and AATGAATGAGAGGCTTTATCGA, respectively. [score:1]
The miR162a sequence was substituted into a 300-bp pri-dme-mir-184 backbone with structurally conserved nucleotide changes to maintain pairing. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 5
Note the differential expression and arm use among the embryo types (such as ame- miR-184-3p and 5p of class II and ame- miR-263-5p of class II in haploids but class III in diploids). [score:3]
However, several miRNAs (ame- miR-375-3p in the diploid embryos and ame- miR-184-3p in the haploid embryos) showed a slight increase in the 0–2 h embryos (Fig 3B), suggesting that miRNAs could be processed during early embryogenesis if the precursor (pre-miRNA) was deposited during oogenesis, which may be possible because the mRNAs of the machinery for miRNA biogenesis are localized in both types of embryos (S2 Fig), an essential condition for the production of mature miRNAs. [score:1]
In cleavage stage of honeybee embryos transcripts of eve (even skipped/GB49029) and run (runt/GB52719) [22] were localized; and during blastoderm formation, eve [22, 26] and ame- miR-184 [29] were found in libraries of haploid and diploid embryos at 0–2 h, 0–6 h, and 18–24 h (S1 Table). [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 4
In the up-regulated miRNAs (Table S1), ame-bantam, ame-mir-184, ame-mir-14, ame-mir-252 were the most abundant in RJM. [score:4]
[1 to 20 of 1 sentences]
7
[+] score: 1
Ame-mir-184 had the highest read count of any miRNA in our small RNA library (Table 1). [score:1]
[1 to 20 of 1 sentences]