sort by

30 publications mentioning zma-MIR168b

Open access articles that are associated with the species Zea mays and mention the gene name MIR168b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 68
miR156 target: GRMZM2G126018_T01 (SBP23); miR159 target: GRMZM2G139688_T01 (GA-MYB); miR164 target: GRMZM2G393433_T01 (CUC2); miR168 target: GRMZM2G039455_T01 (AGO1c). [score:9]
On the other hand, increments of both, miRNA and target, upon hormone 50% reduction (e. g., miR156, miR164, miR168) suggest miRNA up-regulation might be required to control the levels of transcripts induced during SE. [score:6]
Another AGO1 isoform also exhibiting the miR168 target sequence (GRMZM2G441583_T01, AGO113 or AGO1a) remains highly expressed during seed maturation and germination (Sekhon et al., 2011). [score:5]
According to a global transcriptome analysis for the maize B73 line, AGO1c transcript (target of miR168) is highly expressed in differentiating tissues, such as the shoot apical meristem, immature cob, and tassel (Sekhon et al., 2011). [score:5]
In a previous study performed on VS-535-derived EC, we found that development-related miRNAs such as miR156, miR159, miR164 and miR168 decreased as the length of subculture increased, while stress-related miRNAs such as miR397, miR398, miR408, and miR528 remained highly expressed (Dinkova and Alejandri-Ramirez, 2014). [score:4]
In maize, the presence of several putative AGO1 genes, not all of them exhibiting the miR168 target sequence, further adds a complexity level to the interpretation of miRNA -mediated regulation. [score:4]
However, other miRNAs, significantly up-regulated in the dedifferentiation process, were miR156k, miR168, miR397, miR398, and miR408. [score:4]
Although miR159 and miR168 displayed slight changes in response to plant regeneration stimuli, their target levels (GRMZM2G139688_T01, Giberellic Acid-responsive MYB, GA-MYB for miR159 and GRMZM2G039455_T01, AGO1c for miR168) showed significant fluctuations at least for 0% hormones in darkness and photoperiod (Figure 3, lanes c and e). [score:3]
AGO1c shows the greatest identity with the Arabidopsis AGO1 homolog and has conserved the miR168 target sequence (Table 1). [score:3]
Others represent enzymes involved in plant stress response (targets of miR397, miR398, miR408, miR528) or the miRNA biogenesis pathway itself (miR168). [score:3]
A regulatory miR168-AGO1 loop might also participate in the differential regulation observed between darkness/light and genotypes. [score:3]
To assess the possible role of some conserved miRNAs at translation level, polyribosomal fractions were obtained from 2 years-subcultured VS-535 EC and the presence of miR159, miR168, miR398, and miR528 was analyzed (Figure 5). [score:3]
AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. [score:3]
miR168 is known as master regulator of the general miRNA pathway since it is required for fine-tuning the AGO1 levels in Arabidopsis (Vaucheret et al., 2006). [score:2]
For instance, at least two-fold increase in miR156, miR164, miR168 and miR408, was observed in VS-535, 50% hormones, while a modest 1.2-1.4-fold increase under the same conditions was evident for H-565 (Figure 2 and Supplementary Material, Figure S1). [score:1]
However, in maize EC subcultured for long periods (up-to 2 years) we have found a gradual reduction in miR156, miR164 and miR168 levels without impairment on the callus embryogenic potential (Dinkova and Alejandri-Ramirez, 2014). [score:1]
It remains high for few days upon pollination, while in the mature and germinating maize seed AGO1c and miR168 are both decreased. [score:1]
In Arabidopsis, the presence of miR168 and miR398 in polyribosomes was previously demonstrated in 10 days-old seedlings (Lanet et al., 2009). [score:1]
Similar to miR156 and SBP23, there was poor correlation between miR168 and AGO1c transcript levels. [score:1]
While the greatest increase in miR168 was observed for VS-535 at 50% hormones under photoperiod, AGO1c levels reached a two-fold increase in the same sample (Figure 3A, lane d). [score:1]
In addition, while miR168 importantly increased (around two-fold) in 50% hormones for VS-535, it remained at similar levels for H-565. [score:1]
They identified miR528, miR156, miR166, miR168, miR390, miR164, miR167, miR398, miR397, miR408, and miR319 as the most abundant during dedifferentiation. [score:1]
A greater reduction in this AGO1c transcript was observed for H-565, 0% hormones and photoperiod (25-fold) without accompanying changes in miR168 (Figure 3B, lane e). [score:1]
Previous studies in maize long-term subcultured EC indicated that miR156, miR159, miR164, miR168, and miR319 importantly reduce their levels in subcultures maintained for more than 18 months (Dinkova and Alejandri-Ramirez, 2014). [score:1]
It was then decreased by four-fold at 0% hormones under the same condition when also miR168 decreased (Figure 3A, lane e). [score:1]
[1 to 20 of 25 sentences]
2
[+] score: 45
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR156a, gma-MIR156b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR166l, zma-MIR166m, zma-MIR156k, osa-MIR535, gma-MIR167c, gma-MIR1507a, gma-MIR167d, gma-MIR1507b, gma-MIR167e, gma-MIR167f, zma-MIR156l, zma-MIR166n, zma-MIR167j, gma-MIR167g, gma-MIR156f, gma-MIR156g, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR167j, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR166l, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR167k, gma-MIR167l
miR168 is highly expressed in corn kernel and rice grain, but is not the most abundant miRNA in these plants. [score:3]
This result is unlikely due to trivial contamination of animal sRNA libraries with plant material, because in any plant tissue, multiple plant miRNAs are expressed and miR168 in many cases is not the most abundant plant miRNA (e. g., Figure 2 and Additional file 3). [score:3]
In order to validate the direct impact of a food source upon the selective accumulation of miR168 in insects, we conducted controlled feeding experiments and sRNA northern blot analysis to detect miR168 and other sRNAs in Helicoverpa zea Boddie (corn earworm, CEW), Spodoptera frugiperda J. E. Smith (fall armyworm, FAW) and WCR feeding on natural plant tissues. [score:2]
Our analyses revealed that plant miRNAs were present in the animal sRNA datasets, and significantly miR168 was extremely over-represented. [score:1]
Nipponbare) was probed for corn miR168 sequence (Panel A); soybean miR168 sequence (Panel B), or miR166 (Panel C). [score:1]
This observation suggests that the presence of miR168 as a dominant plant miRNA in animal sRNA datasets from animal tissues cannot be explained simply as a reflection of its relative miRNA abundance in plants. [score:1]
Monocot miR168 is the dominant or singular plant miRNA observed in most analyzed public sRNA animal datasets. [score:1]
For the 19 public animal sRNA datasets with numerous sequence reads that matched to plant miRNAs (Table 1, Figure 1), if we exclude the datasets where plant miRNAs are overwhelmingly monocot miR168, then only two (SRR039190 from human blood and SRR080701 from pig abdominal fat) have significant levels of plant miRNAs other than miR168. [score:1]
Surprisingly, the miR168 sequence was detected as the predominant or sole plant miRNA in animal datasets, including insect examples from different phylogenetic lineages, representing diverse digestive anatomy and physiology. [score:1]
Furthermore, our insect feeding experiments did not reveal any specific/preferential accumulation of miR168 in insects fed on a plant diet containing miR168. [score:1]
For instance, over 99% of miR168 from pea aphid and 100% of miR168 from silkworm datasets are of monocot origin (Figure 1). [score:1]
Interestingly, mature miR168 was one of the plant miRNAs detected at the highest level in mice fed with raw rice. [score:1]
Furthermore, all or nearly all (>96%) miR168 sequences were monocot derived for most datasets, including datasets for two insects reared on dicot plants in their respective experiments. [score:1]
Monocot miR168 observed is disproportionately abundant in the public animal datasets and may be adventitious in some circumstances. [score:1]
For all other insect libraries, miR168 represents no more than the seventh most abundant number of reads that map to plant miRNAs (Table 2). [score:1]
Even in this instance, the number of reads mapped to miR168 is moderate. [score:1]
The plant miRNAs used in the search include miR156, miR166, miR167, miR168, miR535 and miR3522. [score:1]
For all the datasets analyzed, reads mapping to plant miRNAs were mostly or exclusively miR168, except for the pig abdominal fat dataset (SRR080701) where the most abundant plant miRNA family is miR535, which accounts for 42.3% of total plant miRNAs within the plant-specific miRNAs observed in that sample (Table 1, Figure 1A). [score:1]
Interestingly, the miR168 sequence in pig is predominately UCGCUUGGUGCAGGUCGGGAA, which is found in dicots such as Arabidopsis (ath-miR168a and b), soybean (gma-miR168), and Brassica napus (bna-miR168). [score:1]
However, the appearance of miR168 does not align with the experimental setup in all cases. [score:1]
This could implicate a special property of miR168 and select additional miRNAs to be preferentially stable and/or have particular associations with other factors that protect and shepherd them through the GI tract and into distal organs. [score:1]
We hypothesize that the plant miRNA abundance detected in animal tissue datasets should reflect the distribution of miRNAs in plant tissues unless miR168 undergoes preferential uptake or stabilization in animals, or that alternatively there is active discrimination against more abundant plant miRNAs. [score:1]
The second and third most abundant miRNAs in the pig abdominal fat dataset are miR156 and miR168, with 1584 and 1085 reads, respectively (Additional file 2). [score:1]
B. Relative abundance of monocot miR168 sequence observed. [score:1]
In contrast, predominate miR168 sequence in other datasets is UCGCUUGGUGCAGAUCGGGAC, which is only found in monocots such as rice (osa-miR168a), corn (zma-miR168a & b), and Sorghum bicolor (sbi-miR168) (Figure 1B). [score:1]
Presence of miR168 comparable to that observed in pea aphid and silkworm from NCBI was not observed in CEW, FAW, and WCR. [score:1]
If contamination contributes to the observation of miR168 in our WCR, CEW, and FAW datasets, then other plant miRNAs should be similarly affected. [score:1]
While neither of these dicot food sources have publically accessible sRNA datasets to confirm fortuitous identity to the monocot version of miR168, datasets are available for soybean and Medicago truncatula (other species within the same sub -family, Faboideae, of the Fabaceae that includes broad bean as a member) support the likely conservation of dicot miR168 sequence in broad bean. [score:1]
Combined, our observations suggest that the observed predominant monocot miR168 sequence is present as a result of contamination from a non-plant source. [score:1]
The public datasets where miR168 sequence is over-represented in detected plant miRNAs are from insects, chicken and mammals. [score:1]
In soybean seed, miR168 ranks below 20 [th] within the steady-state abundance of miRNAs (Additional file 3). [score:1]
In addition, miR168 detected from corn and soybean-fed insect libraries in Run 1 has a mixture of dicot and monocot miRNA sequences, i. e., both dicot and monocot miR168 sequences are detected in corn-fed insects and in soybean-fed insects (data not shown). [score:1]
Since in the same run there are 10 lettuce leaf libraries, one soybean leaf library and two corn libraries, it is very likely that monocot miR168 in soybean-fed insects results from contamination from the corn library and the dicot miR168 in corn-fed insects is from soybean/lettuce libraries. [score:1]
Three replicates of insect carcass RNA was probed for uptake of miR168 or endogenous insect control miRNAs (miR-307, miR-279, and miR-8-5p). [score:1]
miR168 is the dominant miRNA in only one insect library (Feeding 6, CEW fed on corn leaf, replicate 3 in Table 2). [score:1]
A. Relative proportion of miR168 vs. [score:1]
Although miR168 was easily observed in the plant samples used for feeding (Figure 2), northern blot analysis did not reveal detectable miR168 signal in tested insects (Figure 3). [score:1]
sRNA northern blot analysis of select miRNAs from different plant sources that are variously parts of animal diets corroborates our sequencing result that miR168 is equal to or less abundant than other plant miRNAs in soybean, rice and corn seed (Figure 2). [score:1]
Figure 1 Monocot miR168 is over-represented in detected plant miRNAs in 19 animal sRNA datasets. [score:1]
For the lepidopteran larvae, CEW and FAW neonates were each split into two groups and fed on one of two plant food sources that have known miR168 nucleotide sequences that are distinguished by two nucleotide differences (soybean: UCGCUUGGUGCAG GUCGGGA A; corn: UCGCUUGGUGCAG AUCGGGA C). [score:1]
[1 to 20 of 40 sentences]
3
[+] score: 25
Maize miR168 has also been found to be salt stress related and is up-regulated in the salt-tolerant maize inbred line, but down-regulated in the salt-sensitive line [19]. [score:7]
Six miRNAs (miR160, miR168, miR169, miR319, miR395, and miR399) were identified to be differentially expressed in roots in response to the transient low N condition and all of them were up-regulated (Table S2). [score:6]
miR168 and AGO1 maintain the balance between miRNAs and their targets. [score:3]
With regards to tissue specificity(or tissue dependent), some miRNAs were only regulated in roots or leaves, such as miR160, miR167, miR168, miR319 and miR395 in roots, and miR164, miR172, miR397, miR398 and miR827 in leaves, while some others were regulated in both tissues, such as miR169, miR399, miR408 and miR528 (Fig. 4). [score:3]
The third category consists of miRNA168 which has been shown to target the ARGONAUTE1 (AGO1) gene, which encodes the RNA slicer enzyme in the miRNA pathway [56]. [score:3]
A microRNA homeostasis module of miR168/ARGONAUT (AGO) (Fig. 2) might be involved in the stress adaptation process. [score:1]
Nine miRNA families (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) were identified in leaves, and nine miRNA families (miR160, miR167, miR168, miR169, miR319, miR395, miR399, miR408, and miR528) identified in roots. [score:1]
Three miRNAs (miR160, miR168, miR319) were identified in roots from the transient response in addition to the chronic response (Table S2). [score:1]
[1 to 20 of 8 sentences]
4
[+] score: 24
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
The miR168 -mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. [score:6]
These 17 targets were targets of 11 miRNA families (miR156, miR164, miR166, miR167, miR168, miR169, miR319, miR393, miR408, miR528 and zma-miRn6). [score:5]
A-K represented the expression profiles of some predicted target genes of miR156, miR164, miR166, miR167, miR168, miR169, miR319, miR393, miR408, miR528 and zma-miRn6 in dry and imbibed seeds, respectively. [score:5]
The 12 down-regulated miRNA families were miR156, miR159, miR164, miR166, miR167, miR168, miR169, miR172, miR319, miR393, miR394 and miR397. [score:4]
In Arabidopsis, exclusive target of miR168 is AGO1, which is the core component of the RNA -induced silencing complex (RISC) [64]. [score:3]
The most abundant families were miR156/miR157, miR166, miR168 and miR528, and the least abundant families were miR162 and miR399 (Figure 3). [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 21
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397a, zma-MIR397b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
Interestingly, in addition to the expression of mature miR168-5p, we also observed the expression of miR168-3p (Figure 4E). [score:5]
The expression profiles of miRNA168-5p/168-3p in particular developmental stages also differed, which may suggest a functional role of both miRNA species, as was reported for miR319b and miR319b. [score:4]
The expression level of the mature miR168-5p is notably stronger than the miR168-3p. [score:3]
In Arabidopsis, miR168 targets mRNA coding for the Argonaute (AGO1) protein, which is crucial for miRNA function; hence miR168 is involved in a negative-feedback mechanism for controlling all miRNAs biogenesis [58, 62]. [score:3]
It should be noted that a target mRNA sequence for the miR168-3p molecule has not yet been identified. [score:3]
The detailed structures of MIR168a-5p/168a-3p gene and its pre-miRNA are shown in Figure 4A and B. miR168 is a relatively small family consisting of only two members in A. thaliana (miR168a and miR168b), three members in O. sativa (miR168a-5p/miR168a-3p, miR168b) and four in Zea mays (miR168a-5p/168a-3p, miR168b5-p/miR168b-3p) [3, 4, 8, 56]. [score:1]
There are two possible explanations for this observation: (i) as postulated for rice and maize, both miR168-5p and miR168-3p molecules could be functional in barley [57, 63] or (ii) miR168-3p represents a relatively stable molecule of miRNA*. [score:1]
Detection of pri-, pre-, and mature miR168-5p and miR168a-3p. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 17
Expression profiles were established based on stem-loop real-time RT-PCR analysis of six selected miRNAs, comprising miR156, miR164, miR167, miR168, miR169 and miR396, as well as real-time RT-PCR analysis of their target mRNAs. [score:5]
The results indicated that all but the target gene of miR168 showed significantly differential expression between the hybrid Yuyu22 and its parental inbred lines (Table 2). [score:5]
Interestingly, miR168, which targets AGO1 and is a negative feedback regulator of RISC in Arabidopsis, was predominately repressed in the maize hybrid Yuyu22. [score:4]
The predominant repression of maize miR168 might cause de-repression of most other miRNA target genes, most of which are indicated to be transcription regulation factors; thus, the functional genes contributing to heterosis in hybrid might much flourish compared to the parental inbred lines. [score:3]
[1 to 20 of 4 sentences]
7
[+] score: 13
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
In contrast, miR156, miR159, miR167, miR168, miR169, miR171, miR319, and miR529 had high expression counts (slightly over 3,000 RPM, on average). [score:3]
It has been reported that in Arabidopsis, rice, and wheat, miR168 targets AGO1 (ARGONAUTE1) [66]– [69]. [score:3]
For example, miR168 family has a read count of at least 2400 RPM in all tissues surveyed, reflecting its role in maintaining a steady-state balance of the RNA silencing machinery by targeting the slicer AGO1 (ARGONAUTE1) of the RISC complex [66]– [69]. [score:3]
The miR156, miR164, miR168, miR393, miR395, miR396, miR398, and miR399 families had higher signatures in juvenile root and seedling tissues while miR172 demonstrated a higher expression level in reproductive tissues (tassel and ear). [score:3]
Evidence for subfunctionalization has been reported in tandem duplicate paralogs of miR168 in the Brassicaceae [50]. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR1432, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
Though miR156, regulators of flowering time, phase changing modulation, later embryonic maturation and root development [76], together with miR168, regulators of stress responses and signal transductions in plant development [67], showed very similar expression patterns between maize and rice during de-etiolation (Additional file 14). [score:7]
For those miRNAs that showed similar expression patterns between maize and rice, i. e., miR156, miR166, miR168, miR172, miR2275 and miR528, GO enrichment analysis of their predicted targets was applied (Additional file 13). [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 11
Adding to the complexity by regulating the sRNA targeting machinery itself, MIR168b which regulates Ago1 homeostasis through a negative feedback loop during development (Vaucheret et al., 2004, 2006; Ding et al., 2009) is the only MIR differentially expressed between meiocytes and anthers (Table 2). [score:8]
AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 9
Other miRNAs from this paper: zma-MIR168a
We also found that miR168 level was up-regulated in SCMV infected maize plants (Supplementary Fig. S1), in addition to the results that AGO1a and AGO1b mRNAs were up-regulated (Fig. 9A), suggesting that miR168 could be sequestered by AGO18a as reported previously 32. [score:7]
Interestingly, the accumulation of miR168 had no obvious change in MCMV or S + M infected maize plants in which the AGO1a, b, c mRNAs were not induced (Fig. 9B), suggesting that the significantly induced AGO18a might be involved in antiviral defence by other modes of action, such as influencing the function of other miRNAs associated by AGO18 32. [score:1]
Recent research demonstrated that AGO18, a member of a monocot-specific AGO protein clade, played a role in antiviral defence by sequestering miR168 and was induced in virus-infected tissues 32. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 8
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR528a, zma-MIR528b, zma-MIR827
miR168 is a known feedback regulator of the miRNA pathway, where it targets ARGONAUTE1 (AGO1), which is important for miRNA function [22], [23]. [score:4]
The modulation of AGO1 mediated by miR168 is essential to proper development in Arabidopsis [22]. [score:2]
We suggest that miR168-controlled feedback regulation is also required for plant reproduction. [score:2]
[1 to 20 of 3 sentences]
12
[+] score: 8
The greatest number of potential targets of Zea mays miRNAs was for the P111 gene targetted by eighteen different miRNAs (miR156j-3p, miR160a-3p, miR164c-3p, miR164h-3p, miR164h-5p, miR166k-5p, miR166l-5p, miR168b-3p, miR171b-5p, miR171f-5p, miR319a-5p, miR319c-5p, miR399h-5p, miR408b-5p, miR444a, miR444b, miR528a-3p, and miR528b-3p), in combination, at a total of 13 loci of P111 gene. [score:5]
Among all the targeting miRNAs of Zea mays for silencing MCMV genome, ten miRNAs (miR159a-3p, miR159b-3p, miR159f-3p, miR159h-3p, miR159i-3p, miR159j-3p, miR159k-3p, miR166k-5p, miR168b-3p, and miR399h-5p) were predicted by at least three algorithms (including) or by all the four algorithms used (Figure 5). [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 7
Unlikely, Zma-miR168 was consistently expressed with high levels during both kernels and endosperms, possibly because of its key role in regulating the production of miRNAs (Mallory and Vaucheret, 2006) (Figure 2A). [score:4]
Among them, Zma-miR168, Zma-miR166, Zma-miR156, Zma-miR528, Zma-miR827, and Zma-miR167 were the top six most abundantly expressed miRNAs in both reciprocal crosses, corresponding to more than 98% of the total number of known miRNAs (Table S2, Figure 2A). [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Of the 15 known miRNA families, 8 (miR396, miR168, miR156, miR172, miR159, miR398, miR1318 and miR167) showed different levels of preferential expression in wheat flag leaves, with the logarithm of the fold changes ranged from 0.5 to 5.2 as well as more than those in the developing seeds (Figure  3a, Table  2). [score:3]
In the present study, miR168, which targets an AGO-coding gene (Ta. [score:3]
The highest read abundance (approximately 238,000 RPM) was detected in the miR168 family and was 3.8 to 78 times more abundant than the other miRNA families, including miR156, miR166, miR167 and miR172, whose abundance ranged from about 2,900 RPM to 62,000 RPM (Table  2). [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 6
Intriguingly, one target of miR168 was AGO1 which was essential for miRNA maturation [15, 32], and the interaction between miR168 and AGO1 maintained proper embryo development. [score:4]
Besides, miR168 was also responsive for several salt-stresses in maize [33, 34]. [score:1]
Zma-miR168 and zma-miR528 were the top sequenced in seeds and leaves, respectively (Additional file 1). [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 6
Other miRNAs from this paper: zma-MIR168a
In addition, the target sites of miRNA168 were identified in the coding gene with PlantPAN (http://plantpan. [score:3]
In addition, the target sites of miRNA168 were also identified in this gene. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 6
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR390b, zma-MIR444a, zma-MIR444b
MiR168, miR393, miR396 and miR398 were highly expressed in the endosperm at 15 DAP and 20 DAP, indicating their regulation function during middle and late development of the endosperm (Figure 3e). [score:5]
Among them, miR166 was the most abundant family (17,602) followed by miR171 (11,988), miR827 (7686), miR167, miR396, miR528, miR156, miR408, miR160, miR390, miR159, miR444, miR319, miR398, miR168, miR394, miR164, miR393 and miR169 (Figure 3a). [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 5
Among the miRNA most expressed in plants inoculated with H. seropedicae, miR159 and miR168 were also identified as being regulated in soybean nodules [22], suggesting a role for these miRNAs in the association of diazotrophic bacteria with plants. [score:4]
The most abundant family was miR159, followed by miR319, miR168 and miR156 (Table 2). [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 4
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR1432
ARGONAUTE1 (AGO1) mRNA levels are reduced when endogenous miR168 expression is induced by viruses infecting plants (Varallyay et al., 2010). [score:3]
Varallyay E Valoczi A Agyi A Burgyan J Havelda Z 2010 Plant virus -mediated induction of miR168 is associated with repression of ARGONAUTE1 accumulation. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 3
In Arabidopsis, the expression of miR156, miR167, miR168, and miR396 increased 2 h to 24 h after exposure to high-salinity treatment. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, osa-MIR444a, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1874, osa-MIR2055, osa-MIR827, osa-MIR1428f, osa-MIR1428g, zma-MIR396d, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR827, osa-MIR395x, osa-MIR395y, zma-MIR444a, zma-MIR444b
This is in agreement with a recent report using 454 pyrosequencing to identify small RNAs in rice [11] and differs from MPSS high-throughput sequencing that identified osa-miR168 as the most abundant miRNA in their libraries [10]. [score:1]
The most abundant species in our libraries were osa-miR169 and miR168 that we cloned 117 and 40 times respectively (result not shown). [score:1]
The most abundant were osa-miR169, encoded by a large multigene family, which was cloned 117 times and osa-miR168 that we cloned 40 times (result not shown). [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 3
The detected miRNAs in these samples have a significant variety in relative expression abundance, with over 70,000 RPM of miR168 and 1 RPM of miR162 in the 28 DAP sample. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
The miRNAs studied were expressed at strikingly different levels, from very low (miR172) to very high (miR164, miR168). [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR529, zma-MIR390b
Overexpression of miR168, miR171 and miR396 under hypersalinity, mannitol, and cold stress was reported in Arabidopsis (Liu et al., 2008). [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
The six most abundantly expressed miRNA families were miR166, miR168, miR167, miR156, miR159, and miRs6. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 2
Other miRNAs from this paper: osa-MIR168a, osa-MIR168b, zma-MIR168a
The level of AtAGO1 mRNA is maintained and modulated by feedback regulation of miR168 (Vaucheret et al. 2006). [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 1
miR168 was the most abundant family, followed by miR166. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Another study searched for plant miRNA sequences in public sRNA datasets and determined that miR168 was extremely over-represented in animal sRNA datasets, which may result from contamination in the process of sequencing [9, 17]. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Other miRNAs from this paper: zma-MIR168a
We confirmed that miR168, a representative of the 21 nt RNAs that are indicative of microRNAs (miRNAs) and trans-acting siRNAs [27], remained unaffected in mutants via small RNA northern blot (Figure 1B) [28]. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
The abundance of extremely conserved miRNAs has been determined, such as miR156, miR159, miR164, miR166, miR167, miR168, and miR398, which was very similar to previous reports (Zhao et al., 2013). [score:1]
[1 to 20 of 1 sentences]