8 publications mentioning ptc-MIR319b

Open access articles that are associated with the species Populus trichocarpa and mention the gene name MIR319b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

The promoters of these three miRNAs are highly abundant in the MBS box, implicating MYB in their activation/repression; thus, evidence that miR159, miR164, and miR319 are positively regulated by the transcription factors they target suggests that the expression of these targets is modulated by a negative feedback loop that buffers small changes in the level of their mRNAs.

For instance, the targets of miR156 and miR160 were genes encoding squamosa promoter -binding (SPB) proteins; the target genes of miR166 encoded a homeodomain-leucine zipper protein (HD-ZIP); and miR159, miR164, and miR319 targeted myeloblastic leukemia (MYB) factors.

Although experimental evidence for MYB involvement in plant disease stress is scarce, the ubiquitous distribution of MBS motifs in this study and the three fungal response miRNA (miR159, miR164, and miR319) targeting MYB TFs illustrate that MBS motifs are also tightly associated with plant disease response.

Poplar canker pathogen, B. dothidea, induced expression of miR159, miR164, and miR319, and these three miRNAs targeted MYB factors (Table S3), suggesting the miRNA -mediated regulation of MYB factors.

In P. euphratica, miR156, miR164, and miR408 are differentially expressed under dehydration stress [22], and miR156, miR319, and miR166 respond to drought stress [21].

In total, 15 qPCR validation reactions (designed for detecting the expression of miR156, miR159, miR160, miR164, miR166, miR168, miR172, miR319, miR398, miR408, miR1448, and miR1450) for the 41 fungi-response miRNAs tested were carried out.

These probes belong to 12 miRNA families (miR156, miR159, miR160, miR164, miR166, miR168, miR172, miR319, miR398, miR408, miR1448, and miR1450) and account for 17.52% of the 234 probes.

Group I included miR159, miR168, miR172, miR319 (miR319f-h), miR1450, and 13 members of miR166.

Among these miRNAs, several also respond to pathogenic fungi in other plants, for example, miR156, miR159, miR160, and miR319 in galled loblolly pine stem infected with C. quercuum f. sp.

2

We also examined the target conservation of the miRNA-like RNAs on miR159a and miR319b precursors across Arabidopsis, a dicotyledonous plant, and rice, a monocotyledonous plant.

As shown, several miRNA-like RNAs, particularly those expressed at a relatively abundant level, are more conserved than their flanking sequences except their cognate miRNAs or miRNA*s. For example, the sequences of miR319b.

miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47].

2* and miR319.1/miR319b.

1*); specifically, miR319a, miR319a*, miR319b.

2 AATGAATGATGCGAGAGACAA 491 1,2 miR319b.

Figure 6a displays the miR159a precursors in Arabidopsis, rice, Medicago and Populus and Figure 6b shows the miR319b precursors in Arabidopsis, rice, moss and Medicago.

2* have a comparable level of conservation to miR319b* (that is, miR319b.

2 and miR319b.

Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level.

For example, miR319b.

This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46].

Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors.

In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2).

1* GAGCTTTCTTCGGTCCACTC 28 miR319b.

2 has 491 reads while miR319b (that is, miR319b.

Furthermore, most of these miRNA-like RNAs, including miR319b.

miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss.

Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively.

Another interesting observation is that not every slot in the phasing pattern of a precursor was filled by sequencing reads, as shown in MIR319b and MIR839 (Figures 1d and 4a).

Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants.

1* (that is, miR319/miR319b*) in four plants, Arabidopsis, rice, Medicago and P. trichocarpa (ptc).

1 TTGGACTGAAGGGAGCTCCCT 27 miR319b + miR319b.

2* and miR319b.

2, and miR319b.

3

Consequently, we predicted 25 target genes for Pto-miR156, Pto-miR159, Pto-miR172 and Pto-miR319 that were different from the previously defined Populus miRNA targets (miRBase 19.0), and a total of 464 targets were identified for the 78 novel miRNAs (Table S3).

Target Prediction for Pto-miR156, Pto-miR159, Pto-miR172 and Pto-miR319 and Novel miRNAs in Andromonoecious P. tomentosa To understand the functions of sex-specific flower development related miRNAs, the first step is to predict and experimentally validate their targets.

Target Prediction for Pto-miR156, Pto-miR159, Pto-miR172 and Pto-miR319 and Novel miRNAs in Andromonoecious P. tomentosa.

Several miRNA families, such as miR156, miR159, miR169, miR319, miR396, and miR1447, had moderate expression levels (Table 2).

In this study, miRNA159 and miRNA319 expression in female flower was 38.8-fold and 51.42-fold higher, respectively, than in male flower.

For example, three miRNA families (miR172, miR159/miR319 and miR156) are involved in flowering-time regulation [27].

miRNA159 and miRNA319 also have been reported to act with miRNA164 and miRNA167 in specifying particular cell types during the later stages of flower development [28].

4

Wong et al. [44], predicted three wood related genes, flavonol synthase-like, xyloglucan fucosyltransferase and glucan synthase-like genes to be the targets of miR170, miR172 and miR319, respectively, and suggested that these miRNAs might be directly involved in regulation of the phenylpropanoid pathway and hemicellulose biosynthesis pathway.

5

miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members.

For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2).

6

Three P. taeda miRNA families, including pta-MIR319, pta-MIR398 and pta-MIR408, were not found in P. densata.

7

Most of conserved families common to Arabidopsis and peach (miR156, miR159, miR160, miR164, miR166, miR171, miR172, miR319, miR390, miR395, and miR396) did not show significant size variation (Figure 4).

8

In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171.