sort by

64 publications mentioning hsa-mir-485

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-485. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 83
Based on our results, miR-485-5p can have tumor-suppressor roles, by targeting and downregulating the mutant TP53, as the targeting region in the 3′-UTR is identical between the wild-type and the mutant. [score:10]
Five out of seven genes tested showed downregulation at the RNA level upon miR-134 overexpression (EGFR, RAF1, AKT2, TP53 and MMP2), whereas, two (MMP2 and RAF1) shared similar fate after miR-485 overexpression [Supplemental file]. [score:8]
Amongst various miRNAs, miR-134 (eight targets) and miR-485-5p (six targets) were predicted to target the maximum number of genes in the ‘glioma’ pathway [17]. [score:7]
We chose miR-134 and miR-485 from C14-IP-3 as they were predicted to target the highest number of targets in the “glioma” pathway [17]. [score:5]
The protein levels of EGFR and AKT showed about 10% decrease upon overexpression of both the miRNAs, whereas, TP53 showed ~8% decrease upon miR-485-5p overexpression. [score:5]
Mou X Liu S MiR-485 inhibits metastasis and EMT of lung adenocarcinoma by targeting Flot2Biochem. [score:4]
As we earlier reported, miR-485-5p and miR-134 target important genes in the “glioma” pathway [17]. [score:3]
Additionally, we identified TP53 as a novel target of miR-485-5p, and validated it. [score:3]
The results for overexpression of miR-134 and combination (miR-134 + miR485-5p) were negligible. [score:3]
Figure 4 Invasion suppression by miR-134 and miR-485-5p. [score:3]
Furthermore, the key miRNAs, miR-134 and miR-485-5p show the tumor suppressive potential for GBM and reveal novel therapeutic potential for glioma. [score:3]
Interestingly, the most dramatic decrease (~75%) was seen in pAKT levels upon miR-485-5p overexpression. [score:3]
Figure 3 Target validation of miR-134 and miR-485-5p. [score:3]
MiR-485-5p has been found to be differentially expressed in various cancers, including leukemia [41] and lung [42] cancer. [score:2]
MiR-485-5p overexpression blocks GBM cell proliferation. [score:2]
The effect of overexpression of both the miRNAs on cell proliferation of U87 cells, 48 hours post transfection, was striking (~50% decrease in case of miR-134 and ~75% decrease in case of miR-485) compared to normal cells. [score:2]
TP53 was also validated to have direct interaction with miR-485-5p in this study. [score:2]
However, there was ~1.4 fold higher cells in the early apoptotic section upon miR-134 overexpression, and a similar trend of 1.3 fold higher upon miR-485-5p transfection compared to scrambled transfection. [score:2]
This effect is dramatically increased upon transfection of both miR-134 and miR-485-5p, which resulted in ~50% decrease in invasion of glioma cells. [score:1]
Figure 5 G2-M arrest by miR-134 and miR-485-5p. [score:1]
We also found minimal decreased invasion in miR-485-5p transfected cells, but the data remained inconclusive. [score:1]
This effect is dramatically increased upon transfection of both miR-134 and miR-485-5p, which resulted in ~2 fold increase in total apoptotic cell population, with not much change in early apoptotic cells. [score:1]
Histogram showing ~1.5 fold increase in early apoptotic cell population upon either miR-134 or miR-485-5p transfection, and moderate increase in total apoptotic cell population. [score:1]
Histogram showing 2 fold increase in G2-M population, with a ~40% decrease in S-phase cells upon miR-485-5p transfection. [score:1]
Panel B: Histogram showing luciferase reporter based of miR-485-5p with TP53, and negligible evidence of CDK6 interaction. [score:1]
A comparison with scrambled transfection showed a statistically significant decrease in proliferation only for miR-485-5p. [score:1]
Figure 6 Apoptosis induction by miR-134 and miR-485-5p. [score:1]
We also observed a G2-M phase block after 24 hours of transfection of miR-485-5p, evident from increased G2-M population of cells (2 fold increase). [score:1]
BrdU assay revealed ~40% decrease in cell proliferation, upon overexpression of miR-485-5p in glioma cell line, compared to the scrambled, evident from the decreased S-phase population of cells upon miR-485-5p transfection. [score:1]
This effect is dramatically increased upon transfection of both miR-134 and miR-485-5p, which resulted in ~2.2 fold increase in G2-M phase cells. [score:1]
However, we could not find positive interaction of CDK6 with miR-485-5p. [score:1]
[1 to 20 of 31 sentences]
2
[+] score: 55
The relative expression of serum miR-451a, miR-485-3p and miR-4298 were depicted in the scatter plot of Fig 1. The results showed that the expression of the three miRNAs detected by qRT-PCR were significantly different between 24 GBM patients and 12 healthy volunteers (all P<0.05, Fig 1), of which 2 serum miRNAs (miR-485-3p, Fig 1B and miR-4298, Fig 1C) were significantly lower, while another serum miRNA (miR-451a, Fig 1C) was significantly higher in GBM patients than in healthy volunteers. [score:5]
Lou et al reported that miR-485-3p is decreased in breast cancer tissues and can inhibit migration and invasion of breast cancer cells by targeting PGC-1α [35]. [score:5]
miR-485 acts as a tumor suppressor by inhibiting cell growth and migration in breast carcinoma T47D cells. [score:5]
Multivariate Cox regression analysis demonstrates that serum miR-485-3p is an independent prognostic factor for PFS and OS in GBM patients, which suggests that miR-485-3p may be involved in GBM development and prognosis, and functions as a tumor suppressor. [score:4]
Another miRNA, miR-485-3p, was decreased in serum of GBM patients and also selected for validation based on the published data that showed its aberrant expression in human cancer cell lines [24– 27]. [score:3]
To determine whether serum miR-485-3p expression level was an independent risk factor for prognosis of GBM patients, the Cox univariate and multivariate hazard regression mo dels were employed to analyze the miRNAs and clinical features. [score:3]
In 2011, Chen et al. provided evidence that increased levels of miR-485-3p can decrease the chemoresistance of human leukemic lymphoblastic cells to Teniposide by targeting NFYB gene [26]. [score:3]
It was demonstrated that patients with a low expression of miR-485-3p had significantly shorter PFS and significantly worse OS in GBM patients (n = 36) (P = 0.004 and P = 0.023, Fig 2B). [score:3]
As shown in Tables 2 and 3, serum miR-485-3p expression level was an independent factor for predicting the PFS (RR: 0.135, 95% CI: 0.048–0.382, P <0.001, Table 2) and OS (RR: 0.171, 95% CI: 0.056–0.523, P = 0.002, Table 3) in GBM patients. [score:3]
To further investigate the roles of serum miR-485-3p expression levels in GBM progression, the relationship between the 3 serum miRNAs expression levels and clinicopathological features was statistically analyzed in all 36 GBM patients. [score:3]
In addition, miR-485-3p may promote proliferation, migration/invasion or apoptosis by targeting NTRK3 or MAT1A in HCC cells [36, 37]. [score:3]
miR-485-3p, together with miR-154, miR-299-5p, miR-376a, etc, is mapped to the 14q32.31 region in which allelic deletions [33] and translocations [34] are frequently identified in cancer, suggesting that miR-485-3p may be a tumor suppressor. [score:3]
In sharp contrast, Lucotti et al found that miR-485-3p increased the chemoresistance of DU-145 prostate cancer cells to Fludarabine by targeting NFYB [27], implying that miR-485-3p may have different functions in different conditions. [score:3]
0184969.g002 Fig 2 (A) There is no difference of survivals (OS and PFS) between patients with a low and high level of serum miR-451a (B) Patients with a low level of serum miR-485-3p had significantly shorter OS (P = 0.023) and PFS (P = 0.004) than those with a high level. [score:1]
These studies demonstrate that miR-485-3p has different functions in different cancers. [score:1]
In the present study, based on the profiling result of serum miRNAs in GBM patients, we first carried out qRT-PCR on 3 miRNAs (miR-451a, miR-485-3p and miR-4298) in an new cohort (24 GBM patients and 12 healthy volunteers) to validate the microarray data. [score:1]
In conclusion, we have demonstrated for the first time that serum miR-485-3p is a potential prognostic marker for GBM patients. [score:1]
Comparison of overall survival (OS) and progression-free survival (PFS) of the GBM patients with lowand high levels of serum miR-451a, miR-485-3p and miR-4298. [score:1]
Serum miR-485-3p is a prognostic marker in patients with GBM. [score:1]
Validation of serum levels of miR-451a, miR-485-3p and miR-4298 by qRT-PCR in GBM patients. [score:1]
Interestingly, they also found that miR-485-3p was decreased in GBM patients, which is concordant with our result. [score:1]
The result shows that serum miR-485-3p is significantly reduced in GBM patients than in healthy volunteer and associated with PFS and OS of GBM patients. [score:1]
[1 to 20 of 22 sentences]
3
[+] score: 44
Accordingly, it is noteworthy that - as an example - components of the TGFbeta pathway were identified as over-expressed in ependymomas, and they are putative targets for miR-485-5p (down-regulated in our analysis) (Table 2, Figure 1C and Figure S1B). [score:8]
Interestingly, we have identified a miRNA, miR-485-5p, that is down-regulated in ependymomas and putatively targets members of the TGFbeta family of genes. [score:6]
Over-expressed miRs (miR-135a and miR-17-5p) and down-regulated miRNAs (miR-383 and miR-485-5p) are represented. [score:6]
We have identified miRNAs that are over-expressed in ependymomas, such as miR-135a and miR-17-5p, and down-regulated, such as miR-383 and miR-485-5p. [score:6]
Specific miRNAs were confirmed as over-expressed and down-regulated in ependymomas, such as miR-135a, miR-34a, miR-17-5p, miR-383 and miR-485-5p (Figure S1B). [score:6]
Individual assays were then performed to confirm the over -expression (e. g. miR-135a and miR-17-5p), and the down-regulation (e. g. miR-383 and miR-485-5p) of a few selected miRNAs (Figure S1B). [score:5]
Interestingly, we have identified 3 genes from the TGF beta family as putative targets of miR-485-5p. [score:3]
MiR-485-5p was identified in these analyses as down-regulated in ependymomas when compared to normal controls (Table 2 and Figure 1C). [score:2]
Individual miRNA expression analysis for miR-135a, miR-17-5p, miR-485-5p, miR-383 and miR-34a were performed in triplicate in 96 well plates using the TaqMan® Individual miRNA assays (Applied Biosystems) according to the manufacture's instructions. [score:2]
[1 to 20 of 9 sentences]
4
[+] score: 36
miRNAExpression change [a] miRbase accession numberExpression change [b] miR-132-5p Down MIMAT0004594 DownLi et al., 2013 miR-125b-1-3p Down MIMAT0004592 DownLi et al., 2013; Mar-Aguilar et al., 2013a miR-34c-5p Down MIMAT0000686 DownYang et al., 2013 miR-382-3p Down MIMAT0022697 DownLi et al., 2013; Mar-Aguilar et al., 2013b miR-485-5p Down MIMAT0002175 DownAnaya-Ruiz et al., 2013 miR-323b-3p Down MIMAT0015050 NA NA miR-598-3p Down MIMAT0003266 NA NA miR-224-5p Up MIMAT0000281 UpHuang et al., 2012 miR-1246 Up MIMAT0005898 UpPigati et al., 2010 miR-184 Up MIMAT0000454 NA NA a Expression change in this study. [score:7]
Collectively, these results indicate that down -expression of miR-485 facilitates the expression of CD59, thereby improving the proliferation rates and cell migration of breast cancer cells. [score:5]
miR-485 acts as a tumor suppressor by inhibiting cell growth and migration in breast carcinoma T47D cells. [score:5]
In this study, we found that CD59, the cluster of differentiation 59, was a common target of miR-1246 and miR-485-5p belonging to the 10 differentially expressed miRNAs (Figure 5). [score:5]
For example, the previous studies showed that miR-132 (Li et al., 2013), miR-125b (Zhang et al., 2011), miR-34c (Yang et al., 2013), and miR-485 (Anaya-Ruiz et al., 2013), functioning as suppressors, played an important role in breast cancer by suppressing cell proliferation and migration. [score:5]
On the other hand, miR-485 was also found to act as a tumor suppressor by affecting the proliferation rates and cell migration of breast carcinoma T47D cells (Anaya-Ruiz et al., 2013). [score:3]
Because miRNAs can regulate cell-fate decisions, we concluded that miR-1246 and miR-485 may regulate the apoptotic vs. [score:3]
Figure 5 miR-1246 and miR-485 molecules bind to the target gene. [score:3]
[1 to 20 of 8 sentences]
5
[+] score: 26
Together, these results suggest that the upregulation of miR485 and the negative regulation of miR150 levels are key events triggered by Beijing M. tuberculosis clinical strains to sustain the activation of the canonical Wnt pathway during macrophage infection of healthy individual and that of individual with active disease. [score:7]
The previous data indicate that the Beijing M. tuberculosis clinical strains upregulate the canonical Wnt pathway by inducing miR485 expression, to modulate the macrophage response in order to ensure a successful infection. [score:6]
An enrichment pathway analysis performed in the WebGestalt platform using the Kyoto Encyclopedia of Genes and Genomes indicates that the miRNA485 potentiates the canonical Wnt pathway through negatively regulating protein levels involved in the inhibition of these pathways, while by controlling the protein levels of key signaling molecules might inhibit the non-canonical Wnt pathway. [score:6]
In contrast, miR485 might inhibit the non-canonical Wnt pathways by negatively modulating FZD4, RAC-1, and PKC (88) (Figure 9). [score:3]
A gene ontology analysis revealed that through negatively modulating the levels of the SFRP1 and those of the Strabismus 1 (STB1), miR485 might positively regulate the canonical Wnt pathway. [score:2]
Figure 9The Beijing Mycobacterium tuberculosis (M. tuberculosis) strains regulate the Wnt pathway during macrophage infection of healthy individuals or that of macrophages from patients with active tuberculosis by enhancing miR485 and reducing miR150 levels, respectively. [score:2]
[1 to 20 of 6 sentences]
6
[+] score: 25
While the over -expression of miR-485-3p was associated with increased cellular iron levels, the inhibition of miR-485-3p expression decreased cellular iron content [51]. [score:7]
Fpn -mediated iron export can be repressed through direct inhibition of Fpn by miR-485-3p. [score:4]
Cellular export may also represent a miRNA -mediated point of regulation in the maintenance of iron homeostasis as the mRNA encoding the only known cellular iron exporter FPN was recently shown to be targeted by miR-485-3p [51]. [score:4]
Sangokoya C. Doss J. F. Chi J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin PLoS Genet. [score:4]
miRNA Target mRNA Reference(s) miR-Let-7d DMT (∆IRE), BACH1Andolfo et al. (2010) [42], Hou et al. (2012) [43] miR-122 HFE, HJVCastoldi et al. (2009) [44] miR-196 BACH1Hou et al. (2010) [45] miR-200b FTHShpyleva et al. (2009) [46] miR-210 ISCU, TFRChan et al. (2009) [47], Yoshioka et al. (2012) [48] miR-214 LactoferrinLiao et al. (2010) [49] miR-320 TFRSchaar et al. (2009) [50] miR-485-3p FPNSangokoya et al. (2013) [51] miR-584 Lactoferrin ReceptorLiao et al. (2010) [52] Whereas hepcidin is considered to be the primary means of regulating systemic iron homeostasis, a family of cytosolic RNA binding proteins known as Iron Regulatory Proteins (IRP) is considered to be the global regulators of cellular iron homeostasis. [score:4]
These findings provide evidence that miR-485-3p contributes to the coordination of iron homeostasis by regulating iron release through Fpn. [score:2]
[1 to 20 of 6 sentences]
7
[+] score: 19
Over -expression of miR-520d, miR-101, miR-140, miR-485 and miR-448 in different T-ALL cell lines resulted in down-regulation of TAL1 transcript (Figure 4A) and/or protein (Figure 4B-4C) expression levels in a range of 20-60%. [score:8]
Moreover, T-ALL patient samples expressed lower levels of miR-101, miR-140-5p, miR-448 and miR-485-5p as compared to normal bone marrow cells (Figure 6C), which still express TAL1 (data not shown). [score:4]
For further analysis we selected microRNAs that significantly lowered the luciferase expression in 25-50%: miR-101, miR-520d-5p, miR-140-5p, miR-448 and miR-485-5p (see Figure 2 for miRNA binding details). [score:3]
Interestingly, miR-101 [20, 43- 52], miR-140-5p [53- 56], miR-520-5p [57], and miR-485-5p [58- 60], are all reported as putative tumor suppressors in different cancers. [score:3]
F. miR-448 and G. miR-485-5p binding to TAL1 3′UTR details are depicted according to microRNA. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 19
It is speculated that when increased amounts of the H5N1 virus present in cells, the miR-485 would change its shift from suppressor of RIG-I signaling pathway to the inhibitory role to decrease H5N1 production. [score:5]
The dual functional miR-485 was found to directly target RIG-I mRNA, resulting in degradation of the mRNA. [score:4]
Ingle H. Kumar S. Raut A. A. Mishra A. Kulkarni D. D. Kameyama T. Takaoka A. Akira S. Kumar H. The microRNA miR-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral replication Sci. [score:4]
In cells infected with a low abundance of H5N1 virus, miR-485 suppresses the antiviral response and enhances viral replication [75]. [score:3]
The dual functional miR-485 can inhibit the replication of H5N1 virus by binding to the viral RNA polymerase gene PB1, which is required for viral replication in a sequence-specific manner [75]. [score:3]
[1 to 20 of 5 sentences]
9
[+] score: 18
Furthermore, expression levels of miR-485-3p, which has 2 consensus binding sites in the FPN 3′UTR (at bases 448-454 and 618–625, respectively) and has been shown to be involved in the inhibition of FPN expression by iron deficiency in HepG2 cells [30], were not altered in quercetin -treated Caco-2 cells (Figure 6D). [score:7]
While there was no significant effect of quercetin on miR-485-3p expression in Caco-2 cells, we identified miR-17-3p as a quercetin -induced candidate regulator of FPN mRNA expression. [score:6]
Interestingly, miRNAs have been shown to play a role in modulating the expression of a number of key players in iron homeostatic regulation, including hepcidin (miR-122; [47]), DMT1 (Let-7d; [48]) and FPN (miR-485-3p; [30]). [score:4]
Figure S2 Predicted binding sites for miR17-3p, miR17-5p and miR485-3p in human FPN 3′UTR. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 18
Other miRNAs from this paper: hsa-mir-375, dre-mir-375-1, dre-mir-375-2, gga-mir-375
A similar role may be played by miR485-5p with respect to the regulation of CEL expression during pancreatic beta cell development. [score:5]
The prediction of a microRNA (miRNA; miR485-5p) binding site in the 3′untranslated region of human CEL is also potentially of major significance for the regulation of this gene. [score:4]
Supplementary Table presents comparative nucleotide sequences for miR485-5p like CEL gene regions for several vertebrate genomes which shows high levels of sequence identity, particularly among mammalian CEL miRNA target sites and suggests that this site has been predominantly conserved during vertebrate evolution, particularly by eutherian mammalian CEL genes. [score:3]
The human CEL genome sequence contained a microRNA site (miR485-5p) located in the 3′-untranslated region and a CpG island (CpG51). [score:3]
Table  1 of presents comparative nucleotide sequences for miR485-5p-like CEL gene regions for several vertebrate genomes which shows high levels of sequence identity, particularly among mammalian CEL miRNA target sites and suggests that this site has been predominantly conserved during vertebrate evolution, particularly by eutherian mammalian CEL genes. [score:3]
[1 to 20 of 5 sentences]
11
[+] score: 17
Tested miRNAs (Table 1) included the 32 mentioned above; 6 additional miRNAs that appeared in more recent versions of the miRbase database and had putative target sites in the truncated isoform (miR-485-3p, miR-509, miR-617, miR-625, miR-765 and miR-768-5p) were also included because allelic variants were found in their target sites after re-sequencing of patients with anxiety disorders [19]. [score:5]
As for TR-NTRK3 (Figure 3C), a significant downregulation, ranging between 20% and 30%, was observed with miR-128, miR-485-3p, miR-765 and miR-768-5p; the strongest repression was caused by miR-128 (32% reduction) and miR-485-3p (30%). [score:4]
In fact, we identify one miRNAs regulating the full-length isoform of NTRK3 (miR-151-3p) and 4 miRNAs regulating the truncated isoform (miR-128, miR-485-3p, miR-765 and miR-768-5p). [score:3]
Three natural mutations occurring in the 3'UTR of TR-NTRK3 had been previously identified, which fall within the predicted binding sites of these four miRNAs [19]: ss102661458 at the binding sites for miR-768-5p (A-> C at the +3 seed region position) and miR-128 (+13 position), rs28521337 at the binding site for miR-485-3p (G-> C at the +3 seed region), and ss102661460 at the binding site for miR-768-5p (C-> G at the +3 seed region). [score:2]
Luciferase-validated miRNAs were therefore transfected into either undifferentiated (miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p) or differentiated SH-SY5Y cells (miR-151-3p and miR-185), and protein levels were assessed by western blotting 72 h after transfection. [score:1]
In the case of pGL4.13-TR, the luciferase activity was significantly reduced by 8 miRNAs (Figure 1A), all of which were predicted by at least one program: miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p. [score:1]
We identify one microRNA (miR-151-3p) that represses the full-length isoform of NTRK3 and four microRNAs (miR-128, miR-485-3p, miR-765 and miR-768-5p) that repress the truncated isoform. [score:1]
[1 to 20 of 7 sentences]
12
[+] score: 13
miR-485 acts as a tumor suppressor by inhibiting cell growth and migration in breast carcinoma T47D cells. [score:5]
Similarly, with transfectants for miR-363-5p mimic 27 of 29 miRNAs exhibited significantly decreased expression (about 50% of the level found in scrambled controls), only miR-363-5p and miR-485-5p exhibited increased (some 40-fold) expression (D). [score:5]
A similar case can be made as regards the 40-fold increase in the level of miR-485-5p in cells transfected with miR-363-5p mimic, as miR-485-5p has been shown to functions as a tumor suppressor in breast carcinoma cells (Anaya-Ruiz et al., 2013). [score:3]
[1 to 20 of 3 sentences]
13
[+] score: 13
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-132, hsa-mir-34c
Recent studies have demonstrated a role of miR-485-5p in axonal development and Tau expression downregulation during synaptic plasticity in hippocampal rat neurons. [score:7]
The Tau 3′ UTR sequence has two possible miR-485-5p binding sites [158] and contains a target sequence for miR-132-3p, which is strongly downregulated in the brains of AD patients [149]. [score:6]
[1 to 20 of 2 sentences]
14
[+] score: 12
The expression levels of miRNAs were ranked according to BH values and the top five significant miRNAs were: miR-337-3p, miR-185-5p, miR-485-3p, miR-197-3p, and miR-299-5p, all down-regulated in MPM. [score:6]
We observed a statistically significant down-regulation in MPM samples, after Bonferroni’s correction, for miR-197, miR-185 and miR-299 (see Table  1), whereas we could not validate the results for miR-337 and miR-485. [score:4]
microRNALog [2](FC) p-value miR-197-3p −2.540 3.72 × 10 [−7] miR-185-5p −2.742 2.22 × 10 [−4] miR-299-5p −1.239 0.0014 miR-337-3p −0.758 0.0201 miR-485-3p −0.488 0.1886 In addition, from our microarray analysis we could confirm previous findings from several high-throughput studies where mesothelial cell lines or normal mesothelial tissues were used as controls (Table  2). [score:1]
microRNALog [2](FC) p-value miR-197-3p −2.540 3.72 × 10 [−7] miR-185-5p −2.742 2.22 × 10 [−4] miR-299-5p −1.239 0.0014 miR-337-3p −0.758 0.0201 miR-485-3p −0.488 0.1886 In addition, from our microarray analysis we could confirm previous findings from several high-throughput studies where mesothelial cell lines or normal mesothelial tissues were used as controls (Table  2). [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 12
MiR-485 has been implicated in synaptic formation and maintenance and has been reported to be dysregulated in Alzheimer’s disease and Huntington’s disease [32], miR-124 is known as a neurodevelopmental regulator [33], miR-219 required for neural precursor differentiation in zebrafish [34] and promotes myelination in rats [35], miR-127 regulates cell proliferation and senescence by targeting BCL6 [36] while miR-136, miR-873 and miR-410 have all been studied in the context of glioma growth, invasiveness and apoptosis 37– 39. [score:11]
miRNAlog [2]FoldChange P-value Corrected P-value hsa-mir-577 −3,28 1,46E-10 3,87E-08 hsa-mir-182-5p −2,70 6,50E-15 3,44E-12 hsa-mir-485-5p −2,12 8,79E-05 8,45E-03 hsa-mir-124-3p −1,83 1,05E-05 1,85E-03 hsa-mir-218-5p −1,68 1,54E-04 1,16E-02 hsa-mir-183-5p −1,62 3,14E-04 2,08E-02 hsa-mir-873-5p −1,58 9,80E-04 3,25E-02 hsa-mir-133a −1,53 6,05E-04 2,29E-02 hsa-mir-487b −1,45 1,56E-03 4,59E-02 hsa-mir-219-5p −1,44 9,55E-04 3,25E-02 hsa-mir-409-3p −1,34 1,12E-03 3,48E-02 hsa-mir-889 −1,23 5,71E-04 2,29E-02 hsa-mir-136-3p −1,15 1,75E-03 4,87E-02 hsa-mir-410 −1,12 4,02E-04 2,29E-02 hsa-mir-127-3p −0,95 5,61E-04 2,29E-02 hsa-mir-148a-3p 1,23 4,99E-04 2,29E-02 hsa-mir-155-5p 1,82 9,56E-05 8,45E-03 hsa-mir-221-3p 2,10 4,82E-04 2,29E-02For each differently expressed miRNA we report the standard name according to MirBase database, the log [2] fold-change, the P-value and the corresponding corrected P-value as calculated by DESeq. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 11
Previous report indicated that miR-485-3p post-transcriptionally targeted NF-YB [24], a direct transcriptional repressor of Top2α gene and of MDR1 and CCNB2 genes [26] in regulation of the cell cycle, Our results suggest that high miR-485-3p possibly facilitates survival of the Beijing/W strains in macrophages and evades apoptosis or alters macrophage lysis and subsequent downstream immune response toward clearance of MTB. [score:5]
Hsa-miR485-3p was found to be upregulated in Beijing/W infected macrophages. [score:4]
Hsa-miR-485-3p has been shown to be involved in cell survival [24] and knockdown of this miRNA in hepatic cells increased apoptosis [25]. [score:2]
[1 to 20 of 3 sentences]
17
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
In addition to studies of T cells, a number of reports have examined peripheral blood mononuclear cells and have shown miR-192 downregulation in mild asthmatics [34] and miR-211 and miR-485-3p upregulation in pediatric patients with asthma [18, 20]. [score:7]
Liu F. Qin H. B. Xu B. Zhou H. Zhao D. Y. Profiling of miRNAs in pediatric asthma: Upregulation of miRNA-221 and miRNA-485-3pMol. [score:4]
[1 to 20 of 2 sentences]
18
[+] score: 11
Of these five targets, four miRNAs (miR-101, miR-140-5p, miR-448 and miR-485-5p) were downregulated in T-ALL patient specimens and T-ALL cell lines [55]. [score:6]
By performing computational target prediction, luciferase reporter system, and mutagenesis assays; five candidate miRNAs (miR-101, miR-520d-5p, miR-140-5p, miR-448 and miR-485-5p) were found to directly target TAL1. [score:5]
[1 to 20 of 2 sentences]
19
[+] score: 10
Also, miRNAs miR-485-5p and miR-409-5p are down-regulated in KSHV-infected cells and this directly correlates with the up-regulation of their predicted target, MDM2, which mediates the degradation of p53 [57, 58], an inducer of apoptosis. [score:10]
[1 to 20 of 1 sentences]
20
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Out of these 25 miRNAs, 18 miRNAs were differentially expressed in a consistent manner between the 2 groups (Figure 4A, highlighted); 8 miRNAs were downregulated in both groups (miR-16, miR-200, miR-205, miR-3064, miR-379, miR-431, miR-485 and miR-491) and 10 miRNAs were upregulated in both groups (miR-194, miR-1894, miR-211, miR-3072, miR- 3077, miR-4436, miR-5128, miR-669a, miR-669c and miR-6967). [score:9]
[1 to 20 of 1 sentences]
21
[+] score: 8
Profiling of miRNAs in pediatric asthma: upregulation of miRNA-221 and miRNA-485-3p. [score:4]
In another study, miR-221 and miR-485-3p were upregulated in peripheral blood from pediatric asthmatic human patients compared with controls, suggesting that these miRNAs contribute to the development of asthma (56). [score:4]
[1 to 20 of 2 sentences]
22
[+] score: 8
Zhang X. N. Wang C. C. Zhou J. The long noncoding rna neat1 contributes to hepatocellular carcinoma development by sponging mir-485 and enhancing the expression of the stat3J. [score:4]
Interestingly, Zhang et al., showed that by acting as ceRNA for miR-485, NEAT1 is indeed able to enhance STAT3 expression in HCC [64]. [score:3]
Other studies have described similar negative correlations with miR-613 [111] and miR-485 [64]. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 7
Differential expression analysis between the validation group and RRMS samples identified eight out of nine significantly dysregulated miRNAs as identified previously (miR-15b-5p, miR-23a-3p, miR-223-3p, miR-374a-5p, miR-30b-5p, miR-433-3p, miR-485-3p, miR-342-3p, miR-432-5p) (Table  3). [score:4]
A combination of just three miRNAs (miR-223-3p, miR-485-3p, miR-30b-5p) had a 95% accuracy rate of predicting disease progressive forms of MS from RRMS as identified by Random Forest analyses, suggesting that they may be useful clinical biomarkers. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
25
[+] score: 7
For the efficient target ARSD, miR-485-5b repressed it only in normal stage, and it had contribution to the ‘post-translational protein modification’ process only in CIN I stage. [score:5]
Our finding suggests that based on miR-485-5b’s differential regulation on ARSD, the degradation of keratin sulfate was enhanced in CIN I stage, thus promoting keratocyte pathological transformation. [score:2]
[1 to 20 of 2 sentences]
26
[+] score: 6
Furthermore, BACE1-AS masks the miR-485-5p binding site located within the CDS of BACE1 mRNA, and thereby counteracts miR-485-5p -mediated repression of BACE1 mRNA translation [60]. [score:3]
Actually, the levels of expression of miR-485-5p are reduced but those of BACE1-AS are elevated in the entorhinal cortex and the hippocampus of AD. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 6
Additionally, miR-485, miR-34c, miR-221, or miR-193a and miRNAs from the mir-10 or let-7 families identified as deregulated in HPV -negative tumors in our study participate in the regulation of proliferation, apoptosis, and invasion, and have been proposed as a prognostic indicators in patients with solid cancers [56– 60]. [score:3]
MiRNAs miR-135b-3p, miR-146b-5p, miR-205-5p, miR-425-3p, miR-625-3p, and miR-485-3p which are involved in signaling and cell migration connected with epithelial to mesenchymal transition, tumor invasion, and metastasis, were detected in both the comparison of HPV immortalized keratinocytes with primary keratinocytes and the comparison of telomerase immortalized clones with primary keratinocytes. [score:1]
Twelve miRNAs in group 5 (miR-196b, miR-485-3p, miR-589, miR-324-3p, miR-342-3p, miR-92a1#, miR-155, miR-146b, miR-142-3p, miR-1260, miR-143, and miR-142-5p) have strong loading (absolute value ≥ 0.8). [score:1]
Twelve miRNAs in this group (miR-196b, miR-485-3p, miR-589, miR-324-3p, miR-342-3p, miR-92a-1#, miR-155, miR-146b, miR-142-3p, miR-1260, miR-143, and miR-142-5p) seem to be influential on patient prognosis. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 5
MiR-485 and miR-609 have no target site in the 3′UTR of Twist1 and were used as negative (mock) controls to calculate the unrepressed expression level of the reporter in these cells (Fig. 2). [score:3]
Accession numbers for two miRNAs used as negative controls are: hsa-miR-485 (MI0002469) and hsa-miR-609 (MI0003622). [score:1]
The dashed line indicates the unrepressed expression level of the reporter (0,176; calculated from the average of two negative controls (*), miR-485 and miR-609). [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 5
In fact, when these experiments were repeated, the differences in miRNA expression between operators for miR-21 and miR-485-3p were not seen, leading us to conclude that this was within the range of experimental error and not a significant issue. [score:3]
Inter-operator variability using the Qiagen miRNeasy technique yielded 2 miRNAs (miR-485-3p and miR-21) with statistically significantly different ΔCT values (p-values comparing the ΔCT of the two different operators, 0.0191 and 0.0500, respectively) (Table 10, raw data S4 Table). [score:1]
miRNA ΔΔCT(mean) p-value miR-374 -0.4458 0.454 miR-142-3p -0.4136 0.4322 miR-523 -0.5518 0.3424 miR-374-5p -0.2611 0.6425 miR-376c -0.4312 0.5867 miR-27a -0.3863 0.4776 miR-520d-5p -0.3081 0.7506 miR-122 -0.0856 0.9251 miR-485-3p -0.2611 0.6392 miR-21 -0.3976 0.5261 miR-218 -1.332 0.1659 miR-374 -0.4458 0.454 Comparison of mean ΔΔCT’s for various plasma miRNA from plasma samples drawn from the same 7 individuals on the same day 12 hours apart. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 5
The 3′UTR of human, mouse and rat p53 mRNA all have miR-485 conserved predicted target sites, but only the 3′UTRs of human p53 mRNA has miR-125b target site, (B–D) Quantitative RT-PCR assays were performed to examine p53 mRNA levels in three cell types (H460, NIH/3T3 and H9C2) treated with p53 siRNA and other miRNAs for 48 h. GAPDH served as the internal control (top). [score:4]
In fact, not only miR-138, miR-125b regulation of p53 also has species specificity, compared with miR-485 without this feature. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
Accordingly, in AD patients, the expression patterns of BACE1 antisense transcript and miR-485 are deregulated compared to healthy individuals (Faghihi et al., 2010). [score:3]
When the natural antisense BACE1 transcript binds to the BACE1 mRNA, it blocks the negative effect of miR-485 (Faghihi et al., 2010). [score:1]
Recently, it was shown that the BACE1 antisense transcript competes with miR-485 for binding within the ORF of the BACE1 mRNA. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 5
Ingle H. Kumar S. Raut A. A. Mishra A. Kulkarni D. D. Kameyama T. Takaoka A. Akira S. Kumar H. The microRNA miR-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral replicationSci. [score:4]
Then in recent 2015, another miRNA miR-485 was proven to bind the viral PB1 gene as the same [33]. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 4
Schizophrenia risk genes were more likely to be regulated by miRs, as revealed by gene set analyses with the strongest enrichment for targets of miR-9-5p, miR-485-5p and miR-137. [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 4
Other miRNAs, like hsa-miR-298, hsa-miR-485-3p, and hsa-miR-100, which were matched with downregulated circRNAs in our study, have also been reported to be related to breast cancer [36– 38]. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
yes Han Chinese[50] hypertriglyceridaemia miR-485-5p APOA5c. [score:1]
In this case, the rare c. *158C APOA5 allele creates a new functional binding site for miR-485-5p. [score:1]
APOC3 and APOA5 | miR-4271 and miR-485-5p. [score:1]
APOC3 and APOA5 | miR-4271 and miR-485-5p APOC3 and APOA5 are genes that encode apolipoprotein C3 and A5, respectively. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 4
Nine miRNAs (miR-519a, miR-212, miR-320b, miR-27a [∗], miR-30d [∗], miR-23a [∗], miR-30d [∗], miR-23a [∗], and miR-10a [∗]) and 5 miRNAs (miR-375, miR-485-3p, miR-23b, miR-485-3p, miR-23b, miR-627, and miR-1197) were up- or downregulated by glucose, respectively (Figure 2). [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
An APOA5 3′ UTR variant associated with plasma triglycerides triggers APOA5 downregulation by creating a functional miR-485-5p binding site. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 3
It had been subsequently shown that BACE1AS stabilizes BACE1 mRNA by masking a non-canonical target site for miR-485-5p in the CDS of BACE1 mRNA (Faghihi et al., 2010). [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
In E. coli-exposed hPBMCs, two miRNA species (initially selected for their consistently increasing expression pattern in F. tularensis-exposed hPBMCs) were found to be DE: hsa-miR-485-5p (P = 0.0170) and hsa-miR-4802-3p (P = 0.0273). [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
For this analysis we focused on six miRNAs that were found to be differently expressed in at least two subgroups by PCR Array, i. e., miR-10b, miR-15b, miR-26a, miR-155, miR-206 and miR-485-5p (Table 2, Table S3). [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
In comparison to Mirg, the longest Meg9 clone has nine additional upstream exons and contains four more microRNAs: miR-382, miR-134, miR-668, and miR-485. [score:1]
Mirg apparently is a truncated RNA generated when the exonic miR-485 precursor is removed from the Meg9 transcript. [score:1]
The location of the 5′ end of Mirg indicated that this truncated transcript results as result of processing of the exonic miR-485 precursor. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 3
BACE1-AS renders BACE1 mRNA stability by masking the binding site of miR-485-5p (Figure1A). [score:1]
The sense-antisense RNA duplex between BACE1 and BACE1-AS in the cytoplasm potentially perturb the interaction between miR-485-5p and BACE1 mRNA, which to some extent, explains the mRNA stabilization by BACE1-AS transcript [34]. [score:1]
BACE1-AS and miR-485-5p compete for binding in the sixth exon of BACE1 mRNA. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 3
A recent study about Alzheimer’s disease found that the antisense transcript of the Alzheimer -associated b-secretase-1 (BACE), known as BACEAS, increases BACE mRNA stability [43], most likely by masking the binding sites for miR-485-5p [83], which suggested that lncRNAs could interfere with miRNA -mediated mRNA destabilization. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 2
Formosa A, Markert EK, Lena AM, Italiano D, Finazzi-Agro E, Levine AJ, et al. s, miR-154, miR-299-5p, miR-376a, miR-376c, miR-377, miR-381, miR-487b, miR-485-3p, miR-495 and miR-654-3p, mapped to the 14q32.31 locus, regulate proliferation, apoptosis, migration and invasion in metastatic prostate cancer cells. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Patients with alcoholic cardiomyopathy showed changes in several microRNAs (miR-138, miR-485-5p, miR-506, miR-512-5p, miR-548-3p, and miR-4262) and suggested to be involved in the development of cardiac dysfunction [171]. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
This result captures the complexity and likely non-linear relationships of miRNA associations with pathology as miR-433, miR-487b and miR-485-3p are all negatively associated with AD in univariate analysis. [score:1]
On the other hand, miR-433, miR-487b and miR-485-3p are negatively associated with NP and also positively associated with AD in our joint mo del. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 2
In conclusion, we identified 24 novel differentially abundant miRNAs in the plasma of patients with class IV lupus nephritis (hsa-miR-589-3p, hsa-miR-1260b, hsa-miR-4511, hsa-miR-485-5p, hsa-miR-584-5p, hsa-153-3p, hsa-miR-6087, hsa-miR-3942-5p, hsa-miR-7977, hsa-miR-323b-3p, hsa-miR-4732-3p, hsa-miR-6741-3p) that are good candidates for further assessment as diagnostic biomarkers of class IV lupus nephritis. [score:1]
Alterations in the relative abundance of miR-589-3p, miR-1260b, miR-4511, miR-485-5p, miR-584-5p, miR-543, miR-153-3p, miR-6087, miR-3942-5p, miR-7977, miR-323b-3p, miR-4732-3p and miR-6741-3p, and its possible association with lupus nephritis is described for the first time. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 1
A well known example includes BACE1AS, an antisense transcript of BACE1, which competes with miR-485-5p for binding to the same region in BACE1 mRNA. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
000631hsa-miR-296-5p2.710.0495120hsa-miR-4685-3p5.040.0009010hsa-miR-150-5p2.850.0092719hsa-miR-23c5.110.00081Xhsa-miR-45402.860.012809hsa-miR-5002-3p5.140.000353hsa-miR-42682.970.009692hsa-miR-56895.330.000546hsa-miR-12363.080.048776hsa-miR-9355.430.0018719hsa-miR-221-5p3.160.03132Xhsa-miR-374b-3p5.795.4E-05Xhsa-miR-36853.260.0035612hsa-miR-1255b-2-3p5.830.008231hsa-let-7d-3p3.350.021539hsa-miR-485-3p6.000. [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
79 ** hsa-mir-365 7.13 *** 77.53 *** hsa-mir-429 54.63 *** 85.25 *** hsa-mir-454 33.25 *** 87.31 - hsa-mir-455-3p 42.76 *** 96.4 - hsa-mir-484 4.83 *** 78.73 - hsa-mir-485-3p 4.75 *** 71.49 *** hsa-mir-501-3p 69.25 *** 91.25 *** hsa-mir-512-5p 21.37 *** 72.89 *** hsa-mir-532-3p 9.5 *** 85.93 *** hsa-mir-541 69.87 *** 97.77 - hsa-mir-600 35.63 *** 93.48 - hsa-mir-625* 28.5 *** 72.89 *** Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-636 2.37 *** 81.98 *** hsa-mir-663 21.38 *** 84.73 *** hsa-mir-664 7.13 *** 82.85 *** hsa-mir-766 45.13 *** 73. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
Interestingly, out of all 65 chromosome-14-miRNAs assessed in four melanoma cell lines, only five miRNAs were shown to be induced in any of the cell lines: mir-127-3p, mir-137, mir-376a (also designated mir-376a-3p), mir-376c and mir-485-3p. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
Besides the conserved start position 771, positions 139 of hsa-miR-1470, 141 of hsa-miR-3622a-3p, 148 of hsa-miR-485-3p, and 582 of hsa-miR-770-5p were highly conserved among more than one thousand sequences of NS1 genes in type 1 while position 137 was predicted start binding position of both hsa-miR-1236 and hsa-miR-1249. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
88E-0327mmu-miR-451mir-4510.3310.722.79E-046.57E-0366mmu-miR-669c-5pmir-4670.178.847.68E-037.41E-0255mmu-miR-485-3pmir-4850.196.755.52E-036.39E-0265mmu-miR-669nmir-669n0.147.887.46E-037.31E-0260mmu-miR-674-5pmir-6740.178.646.08E-036.45E-0254mmu-miR-676-3pmir-6760.156.634.48E-035.28E-0211mmu-miR-7a-5pmir-70.249.171.37E-057.91E-0436mmu-miR-708-5pmir-7080.179.389.09E-041. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
Seven miRs, including miR-362, -106a, -20b, -363, -542, -450a-1, and -450a-2, were part of a cluster of ≥6 miRs, and miR-485 and -323a were part of a cluster of ≥13 miRs. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
miRNA △△Ct2 [−] [△△Ct] hsa-miR-1290 −10.05 1063.66 hsa-miR-1275 −9.36 655.36 hsa-miR-1260 −9.25 609.09 hsa-miR-574-3p −4.49 22.48 hsa-miR-454 −4.45 21.93 hsa-miR-148a −4.38 20.85 hsa-miR-539 −4.36 20.57 hsa-miR-223 −4.27 19.29 hsa-miR-142-5p −4.27 19.26 hsa-miR-485-3p −4.21 18.56 hsa-miR-548c-5p −4.13 17.56 hsa-miR-17 −4.12 17.41 hsa-miR-484 −4.10 17.17 hsa-miR-652 −4.09 17.01 hsa-miR-660 −4.07 16.78 hsa-miR-20b −4.06 16. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
23131:− GL894231.1_44082 6189.5 12,132 gucauacacggcucuccucucu 22 hsa-miR-485-3p hsa-mir-485 100.0 3.00E − 25 GL894231.1:16,616.. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
55 (33) CDK6, DAPK1, MAP3K2, STK39, TRIB20.0214HSA-MIR-485–3P. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
3/3p21.32 −3.91 hsa-miR-487b 14q32.2 −3.82(29) hsa-miR-487a 14q32.2 −3.78 hsa-miR-758 14q32.2 −3.65 hsa-miR-485-5p 14q32.2 −3.60 hsa-miR-138-1* 16q13.3/3p21.32 −3.55 hsa-miR-382 14q32.2 −3.53(12, 29) hsa-miR-504 Xq26.3 −3.45(52) hsa-miR-128 2q21.3/3p22.3 −3.43(12, 14, 51, 59) hsa-miR-490-5p 7q33 −3.42 hsa-miR-770-5p 14q32.2 −3.35 hsa-miR-410 14q32.2 −3.30(29) hsa-miR-432 14q32.2 −3.29 hsa-miR-485-3p 14q32.2 −3.02 hsa-miR-490-3p 7q33 −2.88 hsa-miR-381 14q32.2 −2. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
Furthermore, a recent study confirmed a connection between UCA1 and miR-485-5p/MMP14 [25]. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Interestingly, 5 of the 42 survival -associated miRs (hsa-miR-770-5p, hsa-miR-541, hsa-miR-485-3p, hsamiR- 656, hsa-miR-668) were encoded in the chromosome 14q32 region. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
P1) 8-mer 8th hsa-miR-485-3p NTRK3 19370765 rs72481816 15: 88521572 G C NA 8-mer 8th hsa-miR-765 NTRK3 19370765 rs72481814 15: 88522372 T C NA 7-8mer 4th hsa-miR-509-3p NTRK3 19370765 rs28574753 16: 28109760 G A. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Specifically, one mechanism by which the BACE1-AS lncRNA enhances BACE1 sense mRNA stability could be by masking the binding site for miR-485-5p (Faghihi et al., 2010). [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
Type of site Context+ Context Structure Energy Is experimental validated rno-miR-326-5p MIMAT0017028 3 8mer 7mer-m8 imperfect −0.442 −0.242 431 −65.97 TRUE rno-miR-485-5p MIMAT0003203 2 7mer-m8 −0.343 −0.372 290 −34.96 TRUE rno-miR-300-5p MIMAT0004743 1 8mer −0.338 −0.421 156 −15.16 TRUE rno-miR-702-5p MIMAT0017884 1 8mer −0.317 −0.274 142 −13.86 TRUE rno-miR-203b-3p MIMAT0017800 2 7mer-m8 −0.298 −0.421 295 −29.93 TRUE rno-miR-33-3p MIMAT0017104 2 8mer 7mer-m8 −0.297 −0.813 305 −22.7 TRUE rno-miR-466b-3p MIMAT0017285 1 8mer −0.295 −0.47 159 −15.26 TRUE rno-miR-532-5p MIMAT0005322 1 7mer-m8 −0.268 −0.302 151 −10.71 TRUE rno-miR-511-5p MIMAT0012829 1 7mer-m8 −0.268 −0.302 152 −10.37 TRUE rno-miR-343 MIMAT0000591 1 7mer-m8 −0.262 −0.24 140 −13.75 TRUE rno-miR-203a-3p MIMAT0000876 1 8mer −0.245 −0. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Peng et al. constructed a serum ncRNA panel (miR-1254, miR-485-5p, miR-574-5p, and lncRNA MALAT1), and tested whether the ncRNA panel could distinguish NSCLC patient samples from controls. [score:1]
[1 to 20 of 1 sentences]